WO2001068686A1 - A novel polypeptide-human mannosephosphate isomerase 16 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention disclosed a new kind of polypeptide-human mannosephosphate isomerase 16 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also disclosed the method of applying the polypeptide for the treatment of various kinds of diseases, such as leucosis, leucoma, immune disease, other kinds of tumour, metabolic disturbance, embryonic development disorder, dysgenopathy, inflammation, HIV infection. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said human mannosephosphate isomerase 16.

Description

 -A new polypeptide human mannose phosphate isomerase 16 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human mannose phosphate isoenzyme 16, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique

 Acid mannose isomerase is mainly responsible for catalyzing the mutual conversion between 6-phosphate fructose and 6-phosphate mannose, and it also provides sufficient I) -mannose for many eukaryotic glycosylation reactions. There are three different types of beer with phosphomannose isomerase activity in lower eukaryotes. People have cloned a variety of phosphomannose isomerase families from Bacteroides, eukaryotes and humans. And its biological function was studied in detail.

 Covalent binding of sugars and proteins is a common and conservative form of post-transcriptional modification of eukaryotes. The polysaccharides required for these modifications include D-mannose, GDP-mannose, and long alcohol-P-mannose. Most are obtained by converting sugars to phosphorylated D-mannose through the glycolytic pathway. The mannose phosphate isomerase, that is, the conversion of -6-phosphate fructose to mannose phosphate, plays an important catalytic role. The enzyme plays an important role in the formation of the cytoskeleton of bacteria and lower eukaryotes, and There is not much research on phosphomannose isomerase in mammals, and most of them have been started in recent years.

 In 1991, Payton et al. Cloned mannose monophosphate isomerase from Saccharomyces cerevisiae.

& The composition of the cytoskeleton plays an important role in providing 1) -glycan for cytoskeleton formation. Deletion of the enzyme is fatal to Saccharomyces cerevisiae, which will cause the failure of yeast protein secretion and affect the formation of cell walls. [Payton MA, Rheinnecker M. et al., Bacteriol, 173: 2U00- 2010] In 1994, Proudfoot et al. Cloned a mannose monophosphate isomerase from a human race and found that the enzyme was found in all human tissues. It is expressed in all, but it is significantly increased in the heart, brain, and skeletal muscle. It catalyzes and regulates the mannose glycosylation process of multiple polyproteins in eukaryotes. It also plays an important role in the formation of high 4 biological cytoskeleton. effect. [Proudfoot AE, Turcatti (; et al., 1994, Eur J Biochem, 219: 415-423)

Although 1) -mannose is an important precursor of the protein glycosylation process, it has obvious toxicity in some experimental tumor strains. Studies on the lymphocytes of mice with leukemia found that the expression of phosphomannose isomerase was very low; while studies on lymphocytes of patients with chronic leukemia leukemia also found that their mannose phosphate isomerase The activity is significantly reduced. It can be known from the above that mannose phosphate isomerase not only plays an important role in the cytoskeleton formation process, but also has a direct relationship with the occurrence of some tumors and lymphatic diseases in the body. The mutation or abnormal expression of this protein is usually closely related to the occurrence of some diseases of lymphoid immune system disorders, hematological diseases such as leukemia and related tissue tumors and cancers. The new human protein of the present invention has 100% identity and 100% similarity with the known human phosphomannose isomerase at the protein level, and the middle part of the protein sequence thereof is identical to the known human phosphomannose One-shot sequences of isomerases are highly conserved, and the two may be two different transcription and translation products of the same gene. Therefore, it is considered that it is a new human phosphomannose isomerase, which is named human phosphomannose isomerase 16 and is considered to have similar biology to the known human phosphomannose isomerase. Features. The protein may be closely related to the occurrence of various immune system disorders, hematological diseases such as leukemia and related tissues such as heart, brain, skeletal muscle and other tumors and cancer. The protein can also be used for the diagnosis and treatment of various diseases mentioned above.

 As mentioned above, the human phosphomannose isomerase 16 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The human phosphomannose isomerase 16 protein involved in these processes, especially the amino acid sequence of this protein is identified. Isolation of the new human phosphomannose isomerase 16 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human mannose phosphate isomerase 16 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human phosphomannose isomerase 16.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human phosphomannose isomerase 16.

 Another object of the present invention is to provide a method for producing human phosphomannose isomerase 16.

 Another object of the present invention is to provide an antibody against the polypeptide-human mannose isomerase 16 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide-human mannose isomerase 16 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human phosphomannose isomerase 16.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2; (b) a polynucleotide complementary to the polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of:) a sequence having positions 79 9-1 24 at 5 in SEQ ID NO: 1; and (b) having a sequence 1-from SEQ ID NO: 1 1 74 1-bit sequence.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human phosphomannose isomerase 16 white activity, which comprises utilizing the polypeptide of the present invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human phosphomannose isomerase 16 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human phosphomannose isomerase 16.

 Other aspects of the invention will be apparent to those skilled in the art due to the disclosure of the technology herein.

See. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single or double stranded and represent the sense strand or antisense _strand;. Similarly, the term "amino acid sequence" means an oligopeptide, peptide, polypeptide, or protein sequence, and sheet When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean that the amino acid sequence is limited to the entirety related to the protein molecule Of natural amino acids.

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence- "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human phosphomannose isomerase 16, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a hydrate, or any other molecule that binds human phosphomannose isomerase 16.

 "Antagonist" or "inhibitor" refers to a molecular antagonist that can block and regulate the biological or immunological activity of human phosphomannose isomerase 16 when combined with human phosphomannose isomerase 16. And inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind human phosphomannose isomerase 16.

 "Regulation" refers to a change in the function of human phosphomannose isomerase 16, including an increase or decrease in protein-activity, a change in binding characteristics, and any other biological properties, functions, or Changes in immune properties.

"Substantially pure ¹¹ means substantially free of other proteins, lipids, sugars or other substances naturally associated with it. Those skilled in the art can purify human phosphomannose isomerase 16, using standard protein purification techniques, Substantially pure human phosphomannose isomerase 16 produces a single main band on a non-reducing polyacrylamide gel. The purity of human phosphomannose isomerase 16 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Cluster method (Higgins, I). G. and PM Sharp (1988) Gene 73: 237-244) _{0 The} Cluster method checks all pairs The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence B

 X 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (Hein J., (1990) Methods in emzumology 183: 625-645). "Similarity" refers to amino acids The degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having a T, a charged head group has Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and propionate; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? \ ^, It can specifically bind to the epitope of human phosphomannose isomerase 16.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human phosphomannose isomerase 16" means that human phosphomannose isomerase 10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human phosphomannose isomerase 16 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human phosphomannose isomerase 16 peptide The purity can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide-human phosphomannose isomerase 16, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The present invention also includes fragments, derivatives and analogs of human phosphomannose isomerase 16. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to human phosphate that substantially retains the present invention Hexose isomerase 16 has the same biological function or activity as a polypeptide. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more ¾ acid residues is substituted with another group to include a substituent; or (III ) A type in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide Sequences (such as leader sequences or secretory sequences or sequences used to purify this polypeptide or proteinogen sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1741 bases, and its open reading frames 799-1245 encode 1 48 amino hydrazones .. Based on a homology comparison of the I-based acid sequences, it was found that this polypeptide is isomeric with human mannose phosphate The enzyme has a homology of Ιϋ Ο, and it can be deduced that the human phosphomannose isomerase 16 has a similar structure and function to the human phosphomannose isomerase.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomics 1) NA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (the two sequences have at least 50%, preferably 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) hybridization When using denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only two-sequence identity at least Hybridization occurs at 95% or more, and more preferably 97% or more. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, the length of the "nucleic acid slice" contains at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human phosphomannose isomerase 16

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human phosphomannose isomerase 16 of the present invention can be obtained by various methods. For example, the polynucleotide can be isolated by hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) screening of antibodies expressing cultures to detect polynuclear clones with common structural characteristics Nucleotide tablets.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating d) NA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be obtained commercially available cDNA library, Clontech Laboratories, Inc. as different d) NA library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

These genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measurement Set the transcript level of human phosphomannose isomerase 10; (4) Detect the protein product of gene expression by immunological techniques or determination of biological activity. The above method can be used alone or in combination with multiple methods in the first method (1). The probe used for hybridization is homologous to any part of the polynucleotide of the present invention and has a length of at least 10 nucleotides. It is preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The gene itself or the fragment of the present invention can of course be used as a probe, and the labeling of the UNA probe can be performed with a radioisotope, fluorescein or tritium (such as alkaline phosphatase).

 In the (4) method, the protein product for detecting the expression of the human phosphomannose isomerase 16 gene can be amplified using epidemiological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). The DNA / RNA method (Saiki, et al. Science 1985; 230: 1350-1354) is preferred for obtaining the genes of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The 31 substances used for PCR can be based on the polynucleotide sequence information of the present invention disclosed herein. It is appropriately selected and synthesized by a conventional method. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by conventional methods such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Acid sequencing can also be performed using commercial sequencing kits and the like. In order to obtain the full length d) NA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human phosphomannose isomerase 16 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

 In the present invention, a polynucleotide sequence encoding human phosphomannose isomerase 16 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct recombinant expression vectors. An important feature of expression vectors is that they usually contain replication origins, promoters, marker genes, and translation control elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human phosphomannose isomerase 16 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence described can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: E. coli lac or trp promoter; lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs and other known controllable A promoter in which a gene is expressed in a prokaryotic or eukaryotic cell or its virus. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 bases. Pairs act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 1 to 0 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selecting transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture,%

And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human mannose isomerase 16 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells, etc. The transformation of host cells with the [) NA sequence or the recombinant vector containing the DNA sequence according to the present invention can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as a large intestine, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaC method. The steps used are well known in the art. Alternatively, M _g Cl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human phosphomannose isomerase 16 (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human phosphomannose isomerase 16 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3). Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide can be coated in the cell, or expressed on the cell membrane, or secreted outside the cell. If necessary, it can be separated and purified by various separation methods using its physical, chemical and other properties. Recombinant protein. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation,: ^; permeabilization, ultrasonic treatment, ultracentrifugation, molecular sieve layer (gel filtration), adsorption chromatography , Ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and a combination of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 1SU is a comparison diagram of the amino acid sequence homology of the human phosphomannose isomerase 16 and human phosphomannose isomerase of the present invention. The upper sequence is human phosphomannose isomerase 16, and the lower sequence is human phosphomannose isomerase. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human phosphomannose isomerase 16 (16 kDa) as the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are usually performed according to the conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human phosphomannose isomerase 16

 Total RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method. Using Quik mRNA Isolation Kit

(Qiegene product) Isolate poly (A) n] RNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multicloning site of the pBSK (+) vector (ontech) to transform DH5 cc to form a cDNA library. Dye terminate cycle react ion sequencing kit (Perk in_Elnier) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1022e02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 1022e02 clone was 1741 ^ (such as Seq ID NO: 1 ιο (Shown), from the 799th to the 447 open reading frame (0RF), encoding a new protein (as shown in Seq ID NO: 2). We named this clone pBS-1022e02 and the encoded protein was named human phosphomannose isomerase 16. Example 2: Homologous search of cDNA clones

 The sequence of the human phosphomannose isomerase 16 of the present invention and the protein sequence encoded by the same were subjected to the Blast program (Basic loca 1 Alignment search tool) [Altschul, SF et a 1. J. Mol. Biol. 1990; 215 : 403-10], perform homology search in databases such as Genbank, Swissport. The gene with the highest homology to the human phosphomannose isomerase 16 of the present invention is a known human phosphomannose isomerase, and its encoded protein has the accession number X76057 in Genbank. The results of protein homology are shown in Figure 1.The two are highly homologous, with 100% similarity; 100 similarities. Example 3: Cloning of a gene encoding human phosphomannose isomerase 16 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'- TGCTACAGCTGCACCAGCAGTACC-3 '(SEQ ID NO: 3)

 Primer2: 5'- CAACACAAGTGATCTTTAATTGCT-3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

 Amplification reaction conditions: 50mmoi / L ΚΠ, 10mmol / L Tris-

Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μmol / L dNTP, lOpmol primer, TaJ of 11J 1) NA polymerase (product of Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-; ictin was set as a positive control and template blank was set as a negative control. Amplification products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the PCR vector (Unvitrogen product). The results of DNA sequence analysis showed that the DNA sequence of the PCR product was exactly the same as 1-1741bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human mannose isomerase 16 gene expression:

Total RNA was extracted by a single method [Anal. Biochem 1987, 102, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μg of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Ct- ³² P dATP was used to prepare ^j2 P-labeled DNA probe by random primer method. The DNA probe used is the PCR amplified human mannose isomerase 16 coding region shown in FIG. 1 Sequence (799bp to 1245bp). A 32P-labeled probe (approximately 2 x 1 O ^b cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM H ₂ PO ₄ (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC--. 1¾SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: Recombinant human phosphomannose isomerase 16 in vitro expression, isolation and purification

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

 Primer 3: 5'—CCCCATATGATGACGACTGTCTCTCCAGACTGC— 3 '(Seq ID No: 5)

 Primer4: 5'_CATGGATCCTTACAGCAGACAGCAGGCACGGAA- 3 '(Seq ID No: 6)

The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively. The Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b ( +) (Nova gen, Cat. No. 698ϋ5.3) selective endonuclease site. PCR was performed using the pBS-1022e02 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μl containing 10 pg of pBS-1022e02, primers Primer-3 and Primer-4, and ¹ J was lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ⁿ C 30s, 68 ° C 2 min, 25 cycles in total. Nde I and BamH I were used to double digest the amplification product and plasmid pET-28 (+), respectively. Large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5a using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced to select the correct sequence. A positive clone (pET-1022e02) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid buckwheat base containing kanamycin (final concentration 30 μg / ml), the host strain BL21 (pET_1022e02) was cultured at 37 ° C to the logarithmic growth phase, and IPT (; to a final concentration of 1 ol) / L, continue to culture for 5 hours. Centrifuge the bacterial cells, decompose them by ultrasound, collect them on a centrifuge, and use an affinity chromatography column His. Bind Quick Cartridge (Novagen) that can bind to 6 histidines (6His-Tag). Product) was chromatographed to obtain the purified human protein mannose isomerase 16 of interest. After SDS-PAGE electrophoresis, a single band was obtained at 10 kDa (Figure 2). The band was transferred to a PVDF membrane for use. Analysis of the N-terminal amino acid sequence by the Edams hydrolysis method revealed that the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Anti-human phosphomannose isomerase 16 Production of antibodies

 The following peptides specific to human mannose isomerase 16 were synthesized using a peptide synthesizer (product of PE): NH2- Met- Thr_Thr-Val-Ser- Pro-Asp- Cys-Vai-Glu-Cys- Met- Ala -Cys-Ser-

C00H

(SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Immunize with 4mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex will not be added. Full Freund's adjuvant boosts immunity once. A titer plate coated with a 15 g / mi bovine serum albumin peptide complex was used as EL I SA to determine antibody titers in rabbit serum. Protein A-Sepha rose was used to isolate total I gG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharos e4B column, and anti-peptide antibodies were separated from total I gG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human phosphomannose isomerase 16. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

 Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes. For example, the probes can be used to hybridize to normal or pathological tissue from different genomes or c-library libraries. In order to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue Or whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable nucleotide-raising chip from the polynucleotide SEQ ID NO: 1 of the present invention and use it as a hybridization probe, and to use a membrane hybridization method to identify whether some tissues contain the multi-core of the present invention. Nucleotide sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Souter hern imprinting, Nor thern blotting, and copying methods, etc., all of which are used to fix the polynucleotide sample to be tested on the filter and then use substantially the same step of hybridization. These same steps are as follows: The sample-immobilized filter is first prehybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the probes from the hybridization are removed by a series of washing membranes *. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes selected in this embodiment include two types: the first type of probe is an oligonucleotide chip that is completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probe is partially Polynucleotide SEQ ID NO: 1 The same or complementary oligonucleotide sheet β of the invention: In this embodiment, a dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the U probe The hybridization with the sample has the strongest specificity and is retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID D NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

 2, (; C content is 30% -70%, non-specific hybridization increases;

3, there should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as preliminary selection probes, and then further analyzed by computer sequence, including the preliminary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their The complementary region is compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After the analysis of the above aspects is completed, the following two probes are selected and synthesized:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGACGACTGTCTCTCCAGACTGCGTGGAGTGCATGGCGTGT-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'-TGACGACTGTCTCTCCAGACCGCGTGGAGTGCATGGCGTGT-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: PROBES GH Keller; MMManak; Stockton Press, 1989 ( USA) and more commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrow et al., Yan Xue Press.

 Sample Preparation:

 1.Extract DN A from fresh or frozen tissue

 Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) Use cold homogenate buffer (0.25mol / L sucrose; 25mmol / L

Tris-HCl, pH 7.5; 25mmol / LnaCl; 25mmol / L Mg ₂ ) Suspended pellet (about 10ml / g). 4) At 4'C, homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 gram of the original tissue sample), and centrifuge at 1,000 g

10 minutes 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2-DNA phenol extraction

1) Wash the cells with 1-10ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 X 10 ⁸ cells / mi) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form a clump of A that is difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells.

4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 "C overnight. Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1), and centrifuge in a small centrifuge tube for 1ϋminutes for two Separate them clearly, otherwise re-centrifuge. 7) Transfer the aqueous phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase To a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

* Steps: 1) Add 1/10 volume of 2moi / L sodium acetate and 2 times volume of cold 100% ethanol to the DNA solution, mix well and let them stand at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol; centrifuge and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water and vortex at low speed or suck with a pipette while gradually increasing TE, mix until the DNA is fully dissolved, and add approximately 1 ul per 1- 5 x 1ϋ "of cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully scoop out the aqueous phase and add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol. , Mix and set -20 ⁽ 'C 1 hour 13) wash the precipitate with 70% ethanol and 100% ethanol, air dry, resuspend the nucleic acid, the process is the same as step 3-6 step 14) to determine A ₂₆ . And A ₂₈ . To check the purity and yield of DM. 15) Store at -20 "C after dispensing. Sample film preparation:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film was washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl 5 minutes (twice), dry

 4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

 Labeling of probes

1) 3 μl Probe (0. 10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi _y - ⁱ² P-dATP + 2II Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection solution of the first peak is combined, it is ³² P-Probe (the second peak is free γ- "P-dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-lOmg pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml) was added.

CT DNA (calf thymus DNA). ), After sealing the bag, shake at 68 ° C for 2 hours. Cross

 Cut the corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2 x SSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1 x SSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1 x SSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2 x SSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1 xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) 0.1 x SSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature,

X-ray auto-development:

 -70 "C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Industrial applicability

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

 Phosphate mannose isomerase is mainly responsible for catalyzing the mutual conversion between 6-phosphate fructose and 6-phosphate mannose, and it also provides sufficient D-mannose for the glycosylation reaction.

 Studies have found that mannose phosphate isomerase can play an important role in the composition of the cytoskeleton. The reduction or disappearance of mannose phosphate isomerase activity is closely related to leukemia, lymphoma, and immune diseases

The polypeptide of the present invention and the known human phosphomannose isomerase are homologous proteins and contain characteristic sequences of the human phosphomannose isomerase family, and both have similar biological functions. It is responsible for catalyzing the interrelationship between fructose 6-phosphate and mannose 6-phosphate in the body, which is very close to the metabolism of matter and energy, and also affects the stock price of cells; it also provides sufficient D-mannose for the glycosylation reaction, which Abnormal expression is usually closely related to the occurrence of some related metabolic disorders, tumors of related tissues, and cancer. Health-related diseases.

 It can be seen that the abnormal expression of human mannose isomerase 12 of the present invention will produce various diseases, especially leukemia, lymphoma, immune diseases, disorders of material metabolism: other tumors, disorders of embryonic development, growth Developmental disorders, inflammation, these diseases include but are not limited to:

 Tumors of various tissues: leukemia, lymphoma, stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipocarcinoma, liposarcoma, metabolic disorders of materials Sexual diseases: isovaleric acidemia, propionic acidemia, glutaric acid type I, fructose-specific deficiency, glycogen storage disease

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, measles, atopic dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, general

¾Variable immunodeficiency disease, primary B-lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome, embryonic developmental disorders: congenital abortion, jaw cracking, limb absentness, limb differentiation disorder, atrial septal defect, flushing duct Defects, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

 Growth disorders: mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic diseases, stunting, dwarfism, Cushing syndrome, sexual Stunting

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, cerebral sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, various infections Sexual inflammation

 The abnormal expression of the human phosphomannose isomerase 16 of the present invention will also cause certain hereditary and hematological diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially leukemia, lymphoma, immune diseases, disorders of material metabolism disorders, other tumors, Embryonic disorders, growth disorders, inflammation, certain hereditary, hematological diseases, etc.

 The present invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist human human mannose isomerase 16). Agonists increase human mannose isomerase 16 to stimulate cell proliferation and the like Biological functions, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human phosphomannose isomerase 16 can be labeled with labeled cells in the presence of drugs. Human phosphomannose isomerase 16 was cultured together. The ability of the drug to increase or suppress this interaction was then determined.

Antagonists of human phosphomannose isomerase 16 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human phosphomannose isomerase 16 can bind to human phosphomannose isomerase 16 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that The polypeptide cannot perform biological functions.

 When screening compounds as antagonists, human phosphomannose isomerase 16 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human mannose isomerase 16 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human phosphomannose isomerase 16 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. Generally, human phosphomannose isomerase 16 molecules should be treated Mark it.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human phosphomannose isomerase 16 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments from Fab expression libraries.

 The production of cloned antibodies can be obtained by injecting human phosphomannose isomerase 16 directly into immunized animals (such as Jia ¾, Xiao ^, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including, but not limited to, adjuvants. . Techniques for preparing monoclonal antibodies to human phosphomannose isomerase 16 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851), and existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human phosphomannose isomerase 16.

 Antibodies against human phosphomannose isomerase 16 can be used in immunohistochemistry to detect human phosphomannose isomerase 16 in biopsy specimens.

 Monoclonal antibodies that bind to human phosphomannose isomerase 16 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive method of locating tumor cells to determine tumor metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human mannose isomerase W high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to use a thiol crosslinking agent. For example, SPDP attacks the amino group of an antibody and binds the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human phosphomannose isomerase 16-positive cells.

The antibodies in the present invention can be used to treat or prevent diseases related to human phosphomannose isomerase 16. Antibodies at appropriate doses can stimulate or block the production or activity of human phosphomannose isomerase 16. The present invention also relates to deterministic test methods for quantitative and localized detection of human phosphomannose isomerase 10 levels. These tests are It is well known in the art and includes FISH measurement and radioimmunoassay. The level of human phosphomannose isomerase 16 detected in the test can be used to explain the importance of human phosphomannose isomerase 16 in various diseases. And for the diagnosis of diseases where human mannose isomerase 16 functions. The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding human phosphomannose isomerase 16 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human phosphomannose isomerase 16. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human phosphomannose isomerase 16 to inhibit endogenous human phosphomannose isomerase 16 activity. For example, a mutated human mannose isomerase 16 Glycoisomerase 16 can be a shortened human phosphomannose isomerase 16 lacking the signaling domain. Although it can bind to downstream substrates, it lacks signaling activity, so recombinant gene therapy vectors can be used for treatment. Disease caused by abnormal expression or activity of human phosphomannose isomerase 16. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human phosphomannose isomerase 16 into a cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human phosphomannose isomerase 16 can be found in existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human mannose phosphate isomerase 16 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human phosphomannose isomerase 16 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis for oligonucleotide synthesis. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human phosphomannose isomerase 16 can be used for the diagnosis of diseases related to human phosphomannose isomerase 16. The polynucleotide encoding human phosphomannose isomerase 16 can be used to detect the expression of human phosphomannose isomerase 16 or the abnormal expression of human phosphomannose isomerase 16 in a disease state. For example, a DNA sequence encoding human phosphomannose isomerase 16 can be used to hybridize biopsy specimens to determine the expression status of human phosphomannose isomerase 16. Hybridization techniques include Southeni blotting, Norhern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Micr oar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis. Performed with human phosphomannose isomerase 16 specific primers RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human phosphomannose isomerase 10 transcripts

 Detection of mutations in the human phosphomannose isomerase 16 gene can also be used to diagnose human phosphomannose isomerase 16-related diseases. Human phosphomannose isomerase 16 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human phosphomannose isomerase 16 DNA sequence. Existing techniques can be used. Such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization to detect mutations. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, there is a need to identify the specific loci of each gene on the chromosome. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to dry-mark chromosome positions. According to the present invention, in order to correlate these sequences with disease-related genes, the first step of its weight f is to locate these D N A sequences on the chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers are then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those that contain corresponding primers Hybrid cells of the human gene will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, sublocalization can be achieved by using a set of slides from a specific chromosome or a large number of genomic clones. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries,

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: Manua 1 of Basic Techniques, Pergamon Press, New York (1988)

 Once the sequence is located at the exact chromosomal location, the physical position a of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendeliiin Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Coincidentally, differences in cDNA or genomic sequences need to be determined between diseased and oncoming individuals. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in the chromosome, such as deletions visible at the chromosomal level or detectable with cDNA sequence-based PCR! / Bit. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Ability and every 2 Okb correspond to one gene). The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human phosphomannose isomerase 16 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human phosphomannose isomerase 16 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Rights

 1. An isolated polypeptide-human mannose isomerase 16, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least identical to (a) or (b).

 The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 799-1245 in SEQ II) NO: 1 or the sequence of positions 1-1741 in SEQ ID NO: 1 sequence.

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to a plasmid, virus, or vector expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide of any of claims 4-6.

9. A method for preparing a polypeptide having human phosphomannose isomerase 16 activity, characterized in that the method comprises:

 ω expressing human phosphomannose isomerase 16 and culturing the engineered host cell according to claim 8;

 (b) A polypeptide having human phosphomannose isomerase 16 activity is isolated from the culture.

 1. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to human phosphomannose isomerase 16.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human phosphomannose isomerase 16.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of a compound according to claim 11, characterized in that said compound is used for regulating human Method for Phosphatose Isomerase 16 Activity in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide. 15. Use of a polypeptide according to any one of claims 1 to 3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human phosphomannose isomerase 16; or Used for peptide fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human phosphomannose isomerase 16 abnormality.

18. Use of the polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor Drugs for blood diseases, HIV infection and immune diseases and various types of inflammation.