WO2001014569A2

WO2001014569A2 - Increasing the polysaccharide content in plants

Info

Publication number: WO2001014569A2
Application number: PCT/EP2000/007884
Authority: WO
Inventors: Thomas Ehrhardt; Marc Stitt Nigel; Peter Ludwig Geigenberger; Irene Loef; Rita Zrenner; Michael Schroeder
Original assignee: Basf Plant Science Gmbh
Priority date: 1999-08-20
Filing date: 2000-08-12
Publication date: 2001-03-01
Also published as: AR026151A1; AU7647000A; WO2001014569A3

Abstract

The invention relates to a method of producing plants with an increased polysaccharide content that are obtained by overexpressing a gene of the pyrimidine metabolism.

Description

Increasing the polysaccharide content in plants

description

The present invention relates to the use of DNA sequences coding for a dihydroorotase for the production of plants with an increased polysaccharide or starch content, a process for the production of plants with increased polysaccharide or starch content by expressing a DNA sequence coding for a dihydroorotase , and the polysaccharide-overproducing plant itself. The invention further relates to a DNA sequence SEQ-ID No. 1 and with this hybridizing DNA sequence or homologous to the entire sequence or to partial sequences coding for a dihydroorotase from Solanum tuberosum.

Plants synthesize their cell components from carbon dioxide, water and inorganic salts using solar energy. As elementary components of the nucleic acids DNA and RNA, nucleotides are essential, particularly in rapidly growing tissues, and are therefore synthesized by multi-stage metabolic pathways. Pyrimidine nucleotides also play an important role as cofactors in vegetable carbohydrate metabolism. Up to 80% of the uridine nucleotides are present as UDP sugars, which are activated precursors for oligosaccharides or e.g. are required for cell wall synthesis (Wagner and Becker, 1992, Int. Rev. Cyt., 134, 1-84). UDP-glucose, for example, is the activated precursor for the synthesis of sucrose. Sucrose serves the plant as a transport form for glucose, the monomer of the starch, which is synthesized in the potato tubers for storage.

The enzymes involved in starch biosynthesis are largely known. In the potato tuber, the sucrose made available from the leaves via the vascular system is mainly split into UDP-glucose and fructose by the enzyme sucrose synthase in a UDP-dependent reaction. The enzyme uridine diphosphoglucose pyrophosphorylase (UGPase) converts UDP-glucose to glucose-1-phosphate and UTP in a reaction dependent on pyrophosphate. ADP-glucose is used as an activated monomer for starch - synthesis by the enzyme starch synthase. This is provided by the enzyme ADP-glucose pyrophosphorylase (AGPase) from glucose-1-phosphate and ATP.

Various attempts have been made in recent years to increase the starch content in transgenic potato plants. In view of this goal, attempts to overexpress invertase from yeast were unsuccessful (Sonnewald et al. 1997, Nature Biotechnology 15: 794-797) and the combined expression of glucokinase and invertase in potato tubers (Trethewey et al. 1995, Plant J. 15: 109-118). Overexpression of an AGPase (Stark et al. 1992, Science 258: 287-292), a pyrophosphatase from E. coli (Geigenberger et al. 1998, Planta 205: 428-434) turned out to be successful approaches to increasing starch synthesis. or an ADP / ATP translocator (Tjaden et al. 1998, Plant Journal 16: 531-540). These results reflect the diversity of the factors limiting the starch synthesis.

Little is currently known about the role of pyrimidine concentration and uridine nucleotide sales for sucrose cleavage and starch synthesis in potato tubers. Studies by Merlo et al. (1993, J. Plant Physiol. 142: 392-402) provided corellative indications for a parallel regulation of the uridine nucleotide metabolism with the sucrose and starch metabolism, however, show no way to specifically increase the starch biosynthesis in plants.

The object of the invention was to increase the polysaccharide content in plant cells.

The task was surprisingly achieved by expressing a gene coding for a dihydroorotase (DHO) in the plastids of transgenic plants.

According to the invention, polysaccharides are preferably understood to mean starch, cellulose, hemicellulose, dextrans, pectins, mannans, galactans, xylans, inulins and fructans. However, other homogeneous or heterogeneous polysaccharides composed of glycosidically linked unmodified or modified monosaccharides of glucose and fructose are also understood to be the term polysaccharide.

The transgenic polysaccharide overproducing plants are produced by transforming the plants with a construct containing a DHO gene. Tobacco, Arabidopsis thaliana, corn and potatoes were used as model plants for the production of polysaccharide overproducing plants.

Genes coding for a dihydroorotase have previously been isolated from some organisms, inter alia from Saccharomyces cerevisiae (Genbank Acc. No .: X 07561), from Ustilago maydis (Genbank Acc. No.: X 63181), Arabidopis tha - liana (Genbank Acc. no .: AF 000146) and from E.coli (Genbank Acc. no .: X 04469). The invention relates to the use, for example, of a DNA sequence from E. coli (Genbank Acc. No. X04469), which codes for a DHO or its functional equivalents, for producing a plant with an increased content of polysaccharides. The nucleic acid sequence can be, for example, a DNA or cDNA sequence. Coding sequences suitable for insertion into an expression cassette are, for example, those which code for a DHO, are of homologous or heterologous origin and which preferably confer starch on the host the ability to overproduce polysaccharides.

A DNA sequence suitable for insertion into an expression cassette is, for example, a DNA sequence SEQ-ID No. 1 and DNA sequence which hybridizes with it or which is homologous to the overall sequence or to partial sequences, for a dihydroorotase from solanum tuberosum.

The expression cassettes also contain regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette comprises a polyadenylation signal upstream, ie at the 5 'end of the coding sequence, a promoter and downstream, ie at the 3' end, and optionally further regulatory elements which are associated with the coding sequence for the DHO gene are linked operatively. Operative linkage means the sequential Anord ^¬ of promoter, coding sequence, terminator and optionally other regulatory elements in such a way that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended. The preferred sequences for the operative linkage are targeting sequences to ensure subcellular localization in plastids. However, targeting sequences for ensuring subcellular localization in the mitochondrion, in the endoplasmic reticulum (ER), in the nucleus, in Olkorperchen or other compartments may if necessary, a ^¬ settable and translation enhancers such as the 5 '-Fuhrungssequenz from the tobacco mosaic virus ( Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

For example, the plant expression cassette can be incorporated into the Ta ^¬ bak transformation vector pBinAR-Hyg. Fig. 1 shows the tobacco transformation vectors pBinAR-Hyg with 35S promoter (A) or pBinAR-Hyg with seed-specific promoter Phaseolin 796 (B):

HPT: hygromycin phosphotransferase OCS: octopine synthase terminator PNOS: nopaline synthase promoter, in addition, such restriction sites are shown that cut the vector only once.

5 In principle, any promoter which can control the expression of foreign genes in plants is suitable as promoters of the expression cassette. In particular, a plant promoter or a plant virus-derived promoter is preferably used. The CaMV 35S promoter is particularly preferred

10 from the cauliflower mosaic virus (Franck et al., Cell 21 (1980), 285-294). As is known, this promoter contains different recognition sequences for transcriptional effectors, which in their entirety lead to permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989),

15 2195-2202).

The expression cassette can also contain a chemically inducible promoter, which controls the expression of the exogenous DHO gene in the plant at a specific point in time.

20 den can. Such promoters as e.g. the PRPl promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a promoter inducible by salicylic acid (WO 95/19443), one inducible by benzenesulfonamide (EP-A 388186 ), a tetracycline-inducible (Gatz et al., (1992) Plant J. 2, 397-404)

25 promoters inducible by abscisic acid (EP-A 335528) or promoters inducible by ethanol or cyclohexanone (WO 93/21334) may include be used.

Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of starch or its precursors takes place. Promoters that ensure leaf-specific expression should be mentioned in particular. The promoter of the cytosolic FBPase from potatoes or the ST-LSI 35 promoter from potatoes should be mentioned (Stockhaus et al., EMBO J. 8 (1989), 2445-245).

With the help of a seed-specific promoter, a foreign protein was stable up to a share of 0.67% of the total soluble

40 seed protein can be expressed in the seeds of transgenic tobacco plants (Fiedler and Conrad, Bio / Technology 10 (1995), 1090-1094). The expression cassette can therefore, for example, be a seed-specific promoter (preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen.

45 Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad, 1995)), the LEB4 signal peptide, the gene to be expressed and an ER retention signal.

An expression cassette is produced by fusing a suitable promoter with a suitable DHO-DNA sequence and preferably a DNA inserted between the promoter and DHO-DNA sequence, which codes for a chloroplast-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Inquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

Sequences which ensure targeting in plastids are particularly preferred. Under certain circumstances, targeting into the vacuole, into the mitochondrium, into the endoplasmic reticulum (ER) or due to the lack of corresponding operative sequences, it may be desirable to remain in the compartment of formation, the cytosol (Kermode, Crit. Rev. Plant Sci., 15: 4 (1996), 285-423).

Expression cassettes whose DNA sequence codes for a DHO fusion protein can also be used, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chloroplasts, which are cleaved enzymatically from the DHO part after translocation of the DHO gene into the chloroplasts. Particularly preferred is the transit peptide derived from the plastic DHO or a functional equivalent of this transit peptide (e.g. the transit peptide of the Rubisco small subunit or the ferredoxin NADP oxidoreductase).

DNA sequences from three cassettes of the plastid transit peptide of potato plastid transketolase in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC

CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGA TCC_BamHI

pTPlO KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG GATCC_BamHI

pTPll

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGG ATCC_BamHI

The inserted nucleotide sequence coding for a DHO can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural DNA components, as well as consist of different heterologous DHO gene sections of different organisms. In general, synthetic nucleotide sequences with codons are generated which are preferred by plants. These codons preferred by plants can be determined from codons with the highest protein frequency, which are expressed in most interesting plant species. When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp within the regulatory areas, often less than 60 bp, but at least 5 bp. The promoter can be native or homologous as well as foreign or heterologous to the host plant. The expression cassette contains in the 5 '-3' transcription direction the promoter, a DNA sequence which codes for a DHO gene and a region for the transcriptional termination. Different termination areas are interchangeable.

Manipulations which provide suitable restriction sites or which remove unnecessary DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as Transitions and trans versions can be used in vitro mutagenesis, "primer pair", restriction or ligation. With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be provided for the ligation.

Of importance for the success according to the invention can i.a. the attachment of the specific ER retention signal SEKDEL (Schouten, A. et al., Plant Mol. Biol. 30 (1996), 781-792), the average expression level is tripled to quadrupled. Other retention signals, which occur naturally in plant and animal proteins located in the ER, can also be used to construct the cassette.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

An expression cassette can contain, for example, a constitutive promoter (preferably the CaMV 35 S promoter), the LeB4 signal peptide, the gene to be expressed and the ER retention signal. The amino acid sequence KDEL (lysine, aspartic acid, glutamic acid, leucine) is preferably used as the ER retention signal.

The fused expression cassette which codes for a DHO gene is preferably cloned into a vector, for example pBin19, which is suitable for transforming Agrobacterium tumefaciens. Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, such as, for example, tobacco plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media. The transformation of plants by agrobacteria is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press, 1993, pp. 15-38. From the transformed cells of the wounded leaves or leaf pieces, transgenic plants can be regenerated in a known manner which contain a gene integrated in the expression cassette for the expression of a DHO gene included.

To transform a host plant with a DNA coding for a DHO, an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulatory signals, for example sequences for replication or integration. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

Using the recombination and

Cloning techniques allow the expression cassettes to be cloned into suitable vectors that allow them to multiply, for example in E. coli. Suitable cloning vectors include pBR332, pUC series, M13mp series and pACYC184. Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.

The invention further relates to the use of an expression cassette containing DNA sequences coding for a DHO gene or DNA sequences hybridizing therewith for the transformation of plants, cells, tissues or parts of plants. The aim of the use is to increase the content of polysaccharides, preferably starch, in plants.

Depending on the choice of the promoter, the expression of the DHO gene can take place specifically in the leaves, in the seeds, in the tubers or in other parts of the plant. Such polysaccharide-overproducing transgenic plants, their reproductive material, and their plant cells, tissue or parts are a further subject of the present invention.

The expression cassette containing a DHO gene sequence according to the invention can also be used to transform bacteria, cyanobacteria, yeasts, filamentous fungi and algae with the aim of increasing the content of polysaccharides, preferably starch.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants are used

Plant tissues or plant cells used for transient or stable transformation. Suitable methods are the protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called particle bombardment method, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).

The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711).

Agrobacteria transformed with an expression cassette can also be used in a known manner to transform plants, in particular crop plants, such as cereals, maize, oats, rye, barley, wheat, soybeans, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potatoes, Tobacco, tomato, rapeseed, tapioca, cassava, arrowroot, alfalfa, lettuce and the various tree, nut and wine species can be used, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

Functionally equivalent sequences which code for a DHO gene are those sequences which, despite a different nucleotide sequence, still have the desired functions. Functional equivalents thus include naturally occurring variants of the sequences described herein as well as artificial, e.g. Artificial nucleotide sequences obtained by chemical synthesis and adapted to the codon use of a plant.

A functional equivalent is understood to mean, in particular, natural or artificial mutations of an originally isolated sequence coding for a DHO, which furthermore show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. Thus, for example, the present invention also encompasses those nucleotide sequences which are obtained by modifying the DHO nucleotide sequence. The aim of such a modification can, for example, be to further narrow down the coding sequence contained therein or, for example, also to insert further restriction enzyme interfaces. Functional equivalents are also those variants whose function is weakened or enhanced compared to the original gene or gene fragment.

5 In addition, artificial DNA sequences are suitable as long as, as described above, they impart the desired property, for example increasing the starch content in the plant by overexpressing the DHO gene in crop plants. Such artificial DNA sequences can be, for example, by Ruckuber

10 Setting of proteins constructed by means of molecular modeling which have DHO activity or are determined by in vitro selection. Possible techniques for the in vitro evolution of DNA to change or improve the DNA sequences are described in Patten, P.A. et al., Current Opinion in Biotechnology 8,

15 724-733 (1997) or Moore, J.C. et al. , Journal of Molecular Biology 272, 336-347 (1997). Coding DNA sequences which are obtained by back-translating a polypeptide sequence according to the codon usage specific for the host plant are particularly suitable. The specific codon usage can be

A person skilled in the art can easily determine 20 genetic methods by means of computer evaluations of other known genes of the plant to be transformed.

Other suitable equivalent nucleic acid sequences include 25 sequences which code for fusion proteins, part of the fusion protein being a DHO polypeptide or a functionally equivalent part thereof. The second part of the fusion protein can e.g. be another polypeptide with enzymatic activity or an antigenic polypeptide sequence that can be used to detect DHO expression (e.g. myc-tag or his-tag). However, this is preferably a regulatory protein sequence, such as e.g. a signal or transit peptide that directs the DHO protein to the desired site of action.

In the context of the present invention, increasing the polysaccharide content means, for example, the artificially acquired ability of an increased starch biosynthesis performance by functional overexpression of the DHO gene in the plant compared to the non-genetically modified plant for at least one period

40 generation of plants.

Starke's biosynthesis site, for example, is generally leaf tissue, so that leaf-specific expression of the DHO gene makes sense. However, it is obvious that the starch bio-synthesis must not be restricted to the leaf tissue, but also in all other parts of the plant - for example in fatty seeds or in the tubers - tissue-specific.

In addition, constitutive expression of the exogenous DHO gene is advantageous. On the other hand, inducible expression may also appear desirable.

The effectiveness of the expression of the transgenically expressed DHO gene can be determined, for example, in vitro by propagation of the shoot meristem. In addition, a change in the type and level of expression of the DHO gene and its effect on the polysaccharide biosynthesis performance on test plants can be tested in greenhouse experiments.

The invention also relates to transgenic plants transformed with an expression cassette containing a DHO gene sequence or DNA sequences hybridizing therewith, and transgenic cells, tissues, parts and propagation material of such plants. Transgenic crop plants, such as e.g. Barley, wheat, rye, oats, corn, soybeans, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, tapioca, cassava, arrowroot, alfalfa, lettuce and the various tree nuts - and wine species.

Plants in the sense of the invention are mono- and dicotyledonous plants or algae.

Further objects of the invention are:

- Process for transforming a plant, characterized in that expression cassettes containing a DHO gene sequence or DNA sequences hybridizing therewith are introduced into a plant cell, into callus tissue, an entire plant or protoplasts of plants.

Use of a DHO DNA gene sequence or DNA sequences hybridizing therewith for the production of plants with an increased polysaccharide content by expression of this DHO DNA sequence in plants.

The invention is illustrated by the following examples, but is not limited to these:

General cloning procedures: Cloning methods such as restriction cleavage, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of Escherichia coli cells, cultivation of bacteria and sequence analysis of recombinant DNA were carried out as in Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

Sequence analysis of recombinant DNA:

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467). Fragments resulting from a polymerase chain reaction were sequenced and checked in order to avoid polymerase errors in constructs to be expressed.

Total RNA from plant tissues was, as in Logemann et al. (1987, Anal. Biochem. 163, 21). For the analysis, 20 μg RNA was separated in a 1.5% agarose gel containing formaldehyde and transferred to nylon membranes (Hybond, Amersham). The detection of specific transcripts was carried out as described in Aminos (1986, Anal. Biochem. 152, 304). The cDNA fragments used as a probe were radioactively labeled with a random primed DNA labeling kit (Boehringer, Mannheim) and hybridized according to standard methods (see Hybon user references, Amersham). Hyridization signals were visualized by autoradiography using X-OMAT AR films from Kodak.

example 1

Increase in pyrimidine nucleotide concentration in potato tuber slices by feeding with orotate or uridine.

Potato plants (Solanum tuberosu L. cv.Desiree, Saatzucht Fritz Lange, Bad Schwartau) were grown in growth chambers (irradiance: 350 μmol photons ιrτ s ^-1 , 14 h / 10 h day / night rhythm, temperature: 20 ° C, 50 % relative humidity) in 3 1 pots on earth (with 100 g "Hakaphos green" [BASF-AG,

Ludwigshafen] per 230 1) or in a greenhouse with additional light (150 μmol photons m- ² s ^-1 ). Growing tubers from plants watered daily were used for the experiments.

Tuber disks with a thickness of 2 mm and a diameter of 8 mm (approx. 0.1 g) were prepared as described in Geigenberger et al. (1997, Planta 201, 502-518). After washing three times with 10 mM 2- (N- morpholino) -ethane-sulfonic acid (Mes) (pH 6.5; KOH) the disks were incubated in 100 ml Erlenmeyer flasks at 90 rpm in the appropriate medium (8 disks in 4 ml). After 90 minutes, [U- ¹ C] glucose or fU- ¹ C] sucrose (1.1 kBq μmol- ¹ ; Amersham-Buchler) were added and incubated for a further 2 h. The slices were washed 3 times in buffer and snap frozen in liquid nitrogen.

The tuber slices were extracted with 80% (v / v) ethanol (1 ml for 2 slices) and re-extracted in three subsequent steps (80% (v / v) ethanol, 50% (v / v) ethanol, H ₂ 0). The combined supernatants were dried in a stream of air at 47 ° C. and taken up in 1 ml of H0. This soluble fraction was, as in Quick et al. (1989, Planta 177, 536-546) separated into neutral, basic and acidic fractions by ion exchange chromatography. After freeze-drying, the neutral fraction was taken up in 100 μl of H ₂ O and analyzed by means of thin layer chromatography (Geigenberger et al. 1997, Planta 201, 502-518). To measure the phosphate esters, 150 μl of the soluble fraction in 50 μl buffer (10 mM Mes, pH 6.5; KOH) with or without 1 U acidic phosphatase from potato (grade II, Boehringer, Mannheim) were incubated for 3 h at 37 ° C. and after boiling for 2 minutes, analyzed by ion exchange chromatography (Geigenberger et al., 1997). Nucleotide concentrations were determined as in Geigenberger et al. described from trichloroacetic acid extracts determined by HPLC analysis using a Partisil-SAX anion exchange column. From the insoluble residue after ethanol extraction, starch, protein and cell wall components as in Merlo et al. (1993, J. Plant Physiol. 142: 392-402).

Orotate and Uridm are precursors to uridine nucleotides. In the following, the question should be examined whether feeding with orotate or uridine has an influence on the nucleotide content in tuber disks. For this purpose, tuber slices of 10-week-old potato plants were incubated for 3 hours in the presence of 1 mM glucose and the corresponding uridine nucleotide precursors. The nucleotide contents were then measured.

Figure 2 shows the nucleotide concentration in freshly prepared potato tuber slices from growing tubers of 10-week-old plants with or without feeding various nucleotide precursors (incubation for 3 hours in the presence of 10 mM Mes-KOH (pH 6.5), 300 mM mannitol) and 1 mM glucose Compared to non-incubated samples, the total uridine nucleotide content (UDPGlc + UTP + UDP; UMP was negligible) decreased by 30-40% after incubation with 1 mM glucose (Fig. 2A) Incubation in the same buffer, additionally containing 10 mM Uridine or 10 mM orotate prevented the effect and moreover led to an increase in the total uridine nucleotide content of 15-25%, which was attributable to all uridine nucleotides examined (Fig. 2B, C, D). In all experiments, the increase by administration of orotate was slightly larger than by administration of uridine. Incubation with lower concentrations of orotate or uridine (5 mM) resulted in a smaller increase in the total uridine nucleotide concentration (not shown).

In contrast to the uridine nucleotide pool, the concentration of adenylates and guanylates (Fig. 2E, F) in control-incubated disks (without uridine or orotate) increased slightly compared to non-incubated disks. This increase was independent of incubation with orotate or uridine, which is consistent with the assumption that orotate and uridine are specific precursors for the uridine nucleotides and not for the purine nucleotides. On the other hand, incubation with 5 mM adenine did not cause an increase in the uridine nucleotides but an approximately 2-fold increase in the total adenylates and guanylates (Fig. 2E, F).

These results show that it is possible to increase the concentration of uridine nucleotides in plant cells by feeding uridine nucleotide precursors such as orotate or uridine.

Example 2

Increase in starch synthesis in potato tuber slices by feeding with orotate or uridine.

To answer the question whether increased concentrations of uridine nucleotides have an effect on sucrose breakdown and starch content, tuber slices were incubated with 100 mM ¹⁴ C-sucrose in the presence and in the absence of 10 mM orotate. As in the presence of glucose, feeding with orotate led to an increase in uridine nucleotide concentrations without affecting adenylate and guanylate concentrations. Fig. 3 shows the nucleotide concentration in freshly prepared potato slices of growing tubers of 10-week-old plants without or with feeding 10 mM orotate (incubation for 3 hours in the presence of 10 mM Mes-KOH (pH 6.5) and 100 mM sucrose) Figure 4 shows the metabolism of ¹ C - sucrose freshly prepared potato tuber slices from growing tubers of plants 10 weeks old without or with feeding of 10 mM orotate (incubation for 90 minutes in the presence of 100 mM sucrose. Subsequent addition of ¹ C - sucrose ( 1.1 kBq μmol " ¹ ) and incubation for a further 2 hours). Orotat led to a slight increase in the intake of ¹⁴ C-sucrose (Fig. 4A) and a 2-fold increase in the ¹⁴ C-sucrose degradation (from 8% of the absorbed radioactivity in the absence of orotate to 15% - 18% in the presence of orotate, Fig. 4B). Orotate feeding led to an increase in the incorporation of radioactivity in starch (Fig. 4C), as well as a decrease in incorporation in phosphate ester (Fig. 4E), organic acids (Fig. 4F) and free amino acids (Fig. 4G). The incorporation into cell wall components and proteins remained essentially unchanged (Fig. 4D, H).

Overall, orotate led to a 2.4-fold increase in the absolute flux of sucrose in starch (Table 1).

Calculation of the absolute starch synthesis rate in the presence and absence of orotate via the specific activity of the hexose phosphate pool. The specific activity was calculated by dividing the measured radioactivity in phosphate esters by the sum of the carbon in the hexosephosphate pool (glucose-6-phosphate + fructose-6-phosphate + glucose-1-phosphate; data not shown). Mean +/- standard deviation (n = 4)

Table 1

0 Example 3

Generation of transgenic tobacco plants

To generate transgenic tobacco plants, binary vectors were transformed into ₅ Agrobacterium tumefaciens C58Cl: pGV2260 (Deblaere et al, 1984, Nucl. Acids. Res. 13, 4777-4788). For the transformation of tobacco plants (Nicotiana tabacum cv. Samsun NN), a 1:50 dilution of an overnight culture of a positively transformed agrobacterial colony in Murashige-Skoog medium (Murashige and ₀ Skoog 1962 Physiol. Plant. 15, 473) with 2% sucrose (2MS -Medium) is used. Leaf disks of sterile plants (each about 1 cm ² ) were incubated in a Petri dish with a 1:50 agrobacterial dilution for 5-10 minutes. This was followed by a 2-day incubation in the dark at 25 ° C. on 2MS medium with 0.8% Bacto agar. e The cultivation was continued after 2 days with 16 hours of light / 8 hours of darkness and in a weekly rhythm on MS medium with 500 mg / 1 claforan (cefotaxime sodium), 50 mg / 1 Kanamycin, 1 mg / 1 benzylaminopurine (BAP), 0.2 mg / 1 naphthylacetic acid and 1.6 g / 1 glucose. Growing shoots were transferred to MS medium with 2% sucrose, 250 mg / 1 Claforan and 0.8% Bacto agar.

Example 4

Sequence analysis of the cDNA clones coding for a protein with dihydroorotase activity.

The resulting 36 cDNA clones code for a polypeptide with homology to dihydroorotases from other organisms. The homology was obtained with the BLASTP program. (Altschul et al., Nucleic Acids Res. (1997) 25, 3389-3402). Accordingly, the protein is 78% identical to Arabidopsis thaliana dihydroorotase,

58% to Synechocystis, 55% to E. coli and Pseudomonas putida. The longest clone was called pyrCSt5. The plasmid is called pBSSK-pyrCSt5. The cDNA (see SEQ ID No. 1) has an open reading frame of 1046 base pairs with a stop codon in position 1047-1049. The amino acid sequence begins with the third base in the reading frame and can be translated into a 348 amino acid polypeptide (see SEQ-ID No. 2). This corresponds to the length of prokaryotic dihydroorotase coding sequences.

Example 5

Isolation of a cDNA coding for a functional plant dihydroorotase

A clone coding for dihydroorotase was obtained from potato via the functional complementation of an E. coli mutant. The mutant CGSC5152 (CS101-2U5) of the E. coli Genetic Stock Center was used, which carries a mutation in the pyrC gene locus coding for a dihydroorotase. The complementation was carried out by electrotransformation of competent cells of the CGSC5152 strain with a cDNA bank in the vector plasmid pBS SK-. The underlying Lambda ZAPII bank (Stratagene) was cloned undirected using EcoRI / Notl linkers according to standard regulations. The RNA template for the cDNA was isolated from sink leaves of potato (small 1 cm leaflet from 10 week old potato plants harvested in a greenhouse).

The transformed E. coli cells were plated on minimal medium M9 (Sambrook et al., 1989 see above), which additionally contained methionine (20 mg / 1), ampicillin (100 mg / 1) and IPTG (2.5 mM). A total of 4 micrograms of the bank were transformed in 8 approaches miert and 36 clones could be obtained, which follow

Examination by restriction cleavage proved to be the same.

Example 6

Generation of transgenic plants which overexpress an enzyme with dihydroorotase activity from potatoes.

A cDNA was produced which codes for an enzyme with dihydroorotase activity from potato which was fused to a signal sequence leading to the import of the protein into the plastids (taken from an enzyme with tranketolase activity from tobacco). For this purpose, the oligonucleotides 5 '-GTCGACATGGAGCTCTCAATCACACAACC-3' and... Were first of all determined using the pBSSK-pyrCSt5 cDNA

5'-GTCGACACACCTACAGTCTATATCTTTGG-3 'derived for a polymerase chain reaction (PCR). PCR with pBSSK-pyrCSt5 as a template introduced Sall restriction sites before the start codon and after the stop codon of the dihydroorotase cDNA. The reaction mixtures contained approx. 1 ng / microl template DNA, 0.5 microM of the oligonucleotides and, 200 microM deoxy nucleotides (Pharmacia), 50 mM KC1, 10 mM Tris-HCl (pH 8.3 at 25 ° C., 1.1 5 mM MgCl ₂ ) and 0.02 U / microl Pwo polymerase (Boehringer Mannheim) and were incubated in a PCR machine from Perkin Elmer with the following temperature program:

Annealing temperature: 50 ° C, 45 sec

Denaturation temperature: 95 ° C, 45 sec. Elongation temperature: 72 ° C, 120 sec

Number of cycles: 30

The fragment of approximately 1.1 kbp obtained was ligated into the vector pBluescript SK- (Stratagene) which had been cleaved with EcoRV. A clone K4 was identified by control cleavage, the insert of which can be excised in full length by Sall (1118 bp). The insert K4 was completely sequenced to rule out polymerase errors.

A transfer vector was generated for the transformation of plants by ligating the 1118 bp Sall fragment from K4 into the vector pTK-TP-BinAR9 cleaved with Sall (R. Badur, 1998 doctoral thesis, University of Göttingen). The orientation of the insert was checked by cleavage with Kpnl (a fragment of approx. 980 bp resulted). In this way, the reading frame of the potato dihydroorotase was fused to a plastid transit peptide consisting of the N-terminal 60 amino acids achieved the tobacco transketolase (Genbank Acc. # CAA03393) (construct K5). The fused cDNA sequence is under the control of the cauliflower mosaic virus 35S promoter and the octopine synthase terminator from Agrobacterium tumefaciens.

The construct K5 was used to transform tobacco, Arabidopsis thaliana and potato plants.

Example 7

Generation of transgenic Arabidopsis thaliana plants

Arabidopsis thaliana was transformed as in Bechtold, N., Ellis, J. and Pelletier, G. in Planta, Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants, C.R. Acad. Be. Paris, Life Sciences 316 (1993), 1194-1199.

Example 8

The transformation of potato plants (Solanum tuberosum, cv. Desiree) was carried out as in Dietze et al. , in Gene Transfer to Plants, 1995, Potrykus and Spangenberg (editors), Springer, Berlin.

Example 9

The transformation of maize plants was carried out as in Pareddy, D., Petolino, J., Skokut, T., Hopkins, N., Miller, M., Welter, M., Smith, K., Clayton, D., Pescitelli, S ., Gould, A., Maize Transformation via helium blasting. Maydica. 42 (2): 143-154, 1997.

Example 10

Generation of transgenic plants which overexpress an enzyme with dihydroorotase activity.

A cDNA was produced which codes for an enzyme with dihydroorotase activity from E. coli which was fused to a signal sequence leading to the import of the protein into the plastids (taken from an enzyme with tranketolase activity from tobacco). For this purpose, the oligonucleotides 5'-GTCGACAT-GACTGCACCATCCCAGG-3 'and 5' -CGATTTTTATTGTTTAACGGACC-3 'for a polymerase chain reaction (PCR) were first derived using the cDNA for the dihydroorotase from E. coli (Genbank Acc. No. X04469). A Sall- was identified by PCR with genomic DNA from E.coli XL-1 blue as a template. Restriction site introduced before the start codon of the dihydroorotase cDNA. The reaction mixtures contained approx. 1 ng / μl of template DNA, 0.5 μM of the oligonucleotides and, 200 μM deoxy nucleotides (Pharmacia), 50 mM KCl, 10 mM Tris-HCl (pH 8.3 at 25 ° C. 1.5 mM MgCl) and 0.02 U / μl Pwo polymerase (Boehringer Mannheim) and were incubated in a PCR machine from Perkin Elmer with the following temperature program:

Annealing temperature: 50 ° C, 45 sec. Denaturation temperature: 95 ° C, 45 sec

Elongation temperature: 72 ° C, 120 sec

Number of cycles: 30

The 1059 bp fragment obtained was ligated into the vector pBluescript SK- (Stratagene), which had been split with EcoRV. A clone was identified by control cleavage, the insert of which can be excised in full length by Sall (1059 bp + 18 bp of the "multiple cloning site" of the vector).

To check the functionality of the encoded enzyme, the 1077 bp Sall fragment from Kl was ligated into the expression vector pQE-9 (Quiagen). The correct orientation of the fragment was checked by restriction cleavage with BamHI. The pyrC E. coli mutant CGSC # 5152 (E. coli genetic stock center, York) was transformed with the construct K2 obtained. The transformants grew on M9 minimal media with 20 mg / l methionine without uridine, while mutants transformed with the empty pQE-9 vector showed no growth under these conditions.

A transfer vector was generated for the transformation of plants by ligating the 1077 bp Sall fragment from Kl into the vector pTK-TP-BinAR9 cleaved with Sall (R. Badur, 1998 doctoral thesis, University of Göttingen). In this way a fusion of the reading frame of the dihydroorotase from E. coli to a plastid transit peptide, consisting of the N-terminal 60 amino acids of the transketolase from tobacco (Genbank Acc. # CAA03393) was achieved (construct K3, Fig. 5). The fused cDNA sequence is under the control of the cauliflower mosaic virus 35S promoter and the octopine synthase terminator from Agrobacterium tumefaciens.

The construct K3 was used to transform tobacco, Arabidopsis thaliana and potato plants.

Regenerated shoots were obtained on 2MS medium with kanamycin and claforan, transferred to soil after rooting and after cultivation for two weeks in a climatic chamber or in the greenhouse (as described above) for dihydroorotase expression Northern blot analysis examined. Lines with increased RNA levels of dihydroorotase were examined for altered metabolite and starch contents in leaf tissues or tubers. An increased uridine nucleotide content and an increased starch content were found in the transgenic lines compared to untransformed control plants.

0

5

0

5

0

5

Claims

claims

1. Use of a DNA sequence coding for a dihydroorotase for the production of plants with an increased polysaccharide content.

2. Use of a DNA sequence according to claim 1 for the production of plants with an increased starch content.

3. Use of a DNA sequence SEQ-ID No. 1 and with this hybridizing or homologous to the overall sequence or to partial sequences coding DNA sequence for a dihydroorotase from Solanum tuberosu according to claim 1 or 2.

4. DNA sequence SEQ-ID No. 1 and with this hybridizing or homologous to the overall sequence or partial sequences coding for a dihydroorotase from Solanum tuberosum.

5. A process for the production of plants with an increased polysaccharide content, characterized in that a DNA sequence coding for a dihydroorotase is expressed in plants.

6. A method for transforming a plant, characterized in that an expression cassette containing a promoter, a signal sequence and a DNA sequence coding for a dihydroorotase in a plant cell, in callus tissue, an entire plant or protoplasts of plant cells is introduced.

7. The method for transforming plants with a DNA sequence according to claim 4, characterized in that the transformation is carried out with the help of the strain Agrobacterium tumefaciens, the electroporation or the particle bombardment method.

8. Plant with an increased content of polysaccharides containing a DNA sequence coding for a dihydroorotase according to claim 4.

9. Plant according to claim 8, selected from the group tomato, tobacco, potato, tapioca, cassava, rice, barley, oats, rye, wheat and corn.

Sign.