WO1997020937A2 - Modification process - Google Patents
Modification process Download PDFInfo
- Publication number
- WO1997020937A2 WO1997020937A2 PCT/EP1996/005581 EP9605581W WO9720937A2 WO 1997020937 A2 WO1997020937 A2 WO 1997020937A2 EP 9605581 W EP9605581 W EP 9605581W WO 9720937 A2 WO9720937 A2 WO 9720937A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mannose
- galactose
- nucleotide sequence
- containing compound
- organism
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0087—Glucomannans or galactomannans; Tara or tara gum, i.e. D-mannose and D-galactose units, e.g. from Cesalpinia spinosa; Tamarind gum, i.e. D-galactose, D-glucose and D-xylose units, e.g. from Tamarindus indica; Gum Arabic, i.e. L-arabinose, L-rhamnose, D-galactose and D-glucuronic acid units, e.g. from Acacia Senegal or Acacia Seyal; Derivatives thereof
- C08B37/0096—Guar, guar gum, guar flour, guaran, i.e. (beta-1,4) linked D-mannose units in the main chain branched with D-galactose units in (alpha-1,6), e.g. from Cyamopsis Tetragonolobus; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
Definitions
- the present invention relates to a modification process.
- the present invention relates to an in vivo modification process.
- Galactomannans are a heterogenous group of cell wall polysaccharides consisting of a 0-1-4 linked mannan backbone with varying numbers of a- 1-6 linked galactose side chains.
- the galactomannans of most significant industrial use are obtained from the endosperms of the legumes guar (Cyamopsis tetragonolobus) and locust bean (Ceratonia siliqua). These galactomannans differ in their galactose content, guar having a galactose to mannose ratio of approximately 1 : 1.6, whereas the ratio for locust bean gum (LBG) is approximately 1:3.4.
- LBG galactose content
- galactomannans form highly viscous solutions at low concentrations (1-2%) but LBG has the additional property of being able to form firm gels with other polysaccharides such as xanthan, carrageenan and agarose.
- LBG is extensively used by the food industry in dairy products (notably ice cream), salad dressings, sauces, low calorie products and pet foods. However, the use of LBG is restricted by the high price and irregular supply.
- guar gum with galactose contents of 10-34% was obtained (Bulpin et al 1990). Analysis of the gelation behaviour of the modified guar gum showed that a preparation with a galactose content of 24% formed mixed gels with carrageenan displaying similar rheological properties as LBG. In comparison, the galactose content of untreated guar gum was 38% and 23 % for LBG.
- the yield of gaiactomannan is reduced because a 40% reduction in galactose content corresponds to approximately 15% less modified guar gum.
- the released galactose may be undesirable in the final product and may have to be removed.
- the present invention relates to in vivo modification of a mannose/gaiactose containing compound - such as guar gum - in an organism (or part thereof) capable of synthesising that compound by a method that is not native to that organism - such as by a method that makes use of recombinant DNA techniques.
- the modification may occur to in relation to any one or more of the precursors of the compound (e.g. mannose and/or galactose) or in relation to the compound itself (i.e. modification of the mannose and/or galactose units of a compound comprising same).
- the present invention relates to an in vivo modification process that affects, preferably increases, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/gaiactose containing compound or of a mannose/galactose containing compound thereof.
- This in vivo modification process is not a naturally occurring process.
- the present invention relates to an in vivo modification process that affects, preferably increases, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, the in vivo modification process comprising expressing a nucleotide sequence coding for a gene product, which gene product has an effect on:
- the present invention relates to an in vivo modification process that affects, preferably increases, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, the in vivo modification process comprising allowing a gene product that is capable of having an effect on:
- Another broad aspect of the present invention relates to the use of a nucleotide sequence to affect in vivo, preferably to increase, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, wherein the nucleotide sequence encodes a gene product which has an effect on:
- nucleotide sequence is not a natural nucleotide sequence to the organism (or part thereof)-
- Another broad aspect of the present invention relates to the use of a gene product to affect in vivo, preferably to increase, the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof, wherein the gene product has an effect on:
- gene product is not expressed by a nucleotide sequence that is a natural nucleotide sequence to the organism (or part thereof)-
- mannose/galactose containing compound means a compound comprising at least one mannose group and at least one galactose group.
- mannose/galactose containing compound is gaiactomannan.
- the mannose/galactose containing compound is guar gum.
- the organism capable of producing a mannose/galactose containing compound is a guar plant and the mannose/galactose containing compound thereof is gaiactomannan.
- gaiactomannan producing plants are encompassed such as fenugreek and lucerne. Plants that are considered not to produce appropriate quantities of gaiactomannan belong to the family Solanacea and the species Nicotiana tabacum.
- organism (or part thereof) capable of producing a mannose/galactose containing compound also includes any suitable organism - in particular a plant - capable of producing a mannose/galactose containing compound, such that the internal in vivo ratio of mannose to galactose of that organism is altered.
- the term also includes any part of an organism that is capable of producing a mannose/galactose containing compound, such that the ratio of mannose to galactose of that part is altered.
- the term also includes a part when within an organism or in a live culture medium. Preferably, the part is when within an organism per se. An example of a part is seed.
- a natural nucleotide sequence to the organism means an entire nucleotide sequence that is in its natural environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its natural environment.
- mannose and galactose precursors includes mannose er se or derivatives thereof and/or galactose per se or derivatives thereof as precursors for the biosynthesis of a mannose/galactose containing compound, preferably gaiactomannan.
- mannose and galactose precursors includes mannose er se or derivatives thereof and/or galactose per se or derivatives thereof as precursors for the biosynthesis of a mannose/galactose containing compound, preferably gaiactomannan.
- precursors for mannose per se or derivatives thereof and/or galactose per se or derivatives thereof which in turn are used as precursors for the biosynthesis of a mannose/galactose containing compound, preferably gaiactomannan.
- the term means mannose per se or derivatives thereof (such as mannose-6-phosphate or GDP-mannose) and/or galactose per se or derivatives thereof as precursors for the biosynthesis of gaiactomannan, preferably guar gaiactomannan.
- the term "gene product” includes peptides, polypeptides, proteins, enzymes and RNA.
- the term means an enzyme.
- the in vivo mannose-to-galactose ratio of the organism (or pan thereof) or mannose/galactose containing compound thereof is higher than that of the guar plant or the gaiactomannan thereof.
- the in vivo mannose-to-galactose ratio of the organism (or part thereof) or mannose/galactose containing compound thereof is substantially similar to that of the locust bean or the gaiactomannan thereof.
- the organism (or part thereof) or mannose/galactose containing compound thereof is a guar plant or the gum thereof.
- the present invention also covers a mannose/galactose containing compound when prepared by the process of the present invention.
- This mannose/galactose containing compound will be referred to as a mannose/galactose containing compound according to the present invention.
- the present invention also covers a foodstuff comprising a mannose/galactose containing compound according to the present invention.
- the present invention also covers a composition - such as a foodstuff - comprising a mannose/galactose containing compound according to the present invention admixed with another polysaccharide.
- a composition - such as a foodstuff - comprising a mannose/galactose containing compound according to the present invention admixed with another polysaccharide.
- other saccharide is any one or more of xanthan, carrageenan and agarose.
- the present invention covers methods for preparing compositions or foodstuffs according to the present invention comprising mixing the mannose/galactose containing compound according to the present invention with another suitable ingredient.
- the broad aspects of the present invention can be achieved by one or more appropriate strategies, wherein each strategy constitutes a preferred embodiment of the present invention.
- a first strategy relates to the use of one or more gene products, or nucleotide sequences coding for same, wherein the gene products are useful in the biosynthesis of GDP-mannose.
- This strategy involves the transformation of one or more of the genes encoding enzymes that are required for the biosynthesis of GDP-mannose - namely the enzyme phosphomannose isomerase (PMI) and/or the enzyme phosphomannose mutase and/or the enzyme GDP-mannose pyrophosphorylase.
- PMI phosphomannose isomerase
- one or more of the gene products that are useful in the biosynthesis of GDP-mannose increase the levels of mannose-6-phosphate, which in turn increase the mannose-to-galactose ratio of a mannose/galactose containing compound, such as a gaiactomannan.
- a preferred aspect of the first strategy relates to at least the use of PMI and/or the nucleotide sequence coding for die same.
- the PMI gene product increases the levels of mannose-6-phosphate, which in turn increases the mannose-to-galactose ratio of a mannose/galactose containing compound, such as a gaiactomannan. It is further preferred that the PMI is a plant PMI.
- a second strategy relates to the use of a ⁇ -galactosidase enzyme and the nucleotide sequence coding for the same.
- ⁇ - galactosidase such as that from senna or from coffee beans, to alter in vivo the mannose-to-galactose ratio of a mannose/galactose containing compound, such as a gaiactomannan.
- a third strategy relates to the combination of the first strategy with the second strategy, which strategies can be used in any order or simultaneously.
- a preferred aspect of the present invention relates to a construct comprising or expressing any one or more of the nucleotide sequences of the present invention.
- Another preferred aspect of the present invention relates to a vector comprising or expressing any one or more of the constructs or nucleotide sequences of the present invention.
- Another preferred aspect of the present invention relates to a plasmid comprising or expressing any one or more of the vectors, constructs or nucleotide sequences of the present invention.
- Another preferred aspect of the present invention relates to a transgenic organism (or part thereof) comprising or expressing any one or more of the plasmids, vectors, constructs or nucleotide sequences of the present invention.
- inventions include methods of expressing or allowing expression or transforming any one or more of the nucleotide sequences, the constructs, the plasmids, the vectors, the cells, the tissues, the organs or the organisms, as well as the products thereof.
- Further preferred aspects of the present invention include uses of the gene products for preparing or treating foodstuffs, including animal feed.
- the present invention also relates to isolating a guar gum prepared by the method of the present invention.
- the present invention also relates to a guar gum prepared by the method of the present invention.
- an enzyme comprising the amino acid sequence shown in Figure 1 , or a variant, homologue or fragment thereof.
- nucleotide sequence coding for the enzyme of the first aspect or a sequence that is complementary thereto is provided.
- nucleotide sequence comprising the sequence shown in Figure 1 , or a variant, homologue or fragment thereof or a sequence that is complementary thereto.
- a vector comprising or expressing the invention of any one of the earlier aspects.
- a plasmid comprising or expressing the invention of any one of the earlier aspects.
- transgenic organism or part thereof comprising or expressing the invention according to any one of the earlier aspects.
- nucleotide sequence or the enzyme is that as defined in or is contained within or is expressed by the above-mentioned aspects of the present invention.
- Other preferred aspects of this aspect of the present invention include methods of expressing or allowing expression or transforming any one of the nucleotide sequence, the construct, the plasmid, the vector, the cell, the tissue, the organ or the organism, as well as the products thereof.
- Further preferred aspects of this aspect of the present invention include uses of the enzyme for preparing or treating foodstuffs, including animal feed.
- a preferred aspect of this aspect of the present invention thus relates to the enzyme phosphomannose isomerase ("PMI") and a nucleotide sequence coding for that enzyme.
- the preferred aspect of the present invention relates to recombinant PMI.
- the preferred aspect of the present invention relates to the use of that recombinant PMI to alter the mannose-to-galactose ratio of either an organism (or part thereof) and/or a mannose/galactose containing compound thereof, especially the mannose-to-galactose ratio of gaiactomannan.
- One of the key advantages of the present invention is that by using the recombinant PMI it is possible to increase the mannose-to-galactose ratio of an organism (or part thereof) and/or a mannose/galactose containing compound thereof, in particular in vivo modified guar gum.
- This advantageous aspect is achieved by the insertion of a gene or genes encoding a gene product or products which are involved in the biosynthesis of mannose/galactose containing compounds such as mannose-6- phosphate, which gene is most preferably the nucleotide sequence of the present invention.
- the recombinant enzyme can be prepared easily and in large quantities.
- the nucleotide sequence can be used to change the in vivo ratio of mannose to galactose levels when inserted (preferably stably inserted) into the genome of an organism (or part thereof)-
- the nucleotide sequence is a DNA sequence.
- the nucleotide sequence is a recombinant DNA sequence.
- nucleotide sequence is obtainable from deposit NCIMB 40774.
- the enzyme is expressed by use of recombinant DNA techniques.
- the enzyme is expressed by a nucleotide sequence obtainable from deposit NCIMB 40774.
- the organism is a plant.
- the plant is a guar plant.
- mannose/galactose containing compound is guar gum.
- the enzyme or nucleotide sequence(s) coding for same may be used in vivo in combination with one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques.
- the PMI enzyme or nucleotide sequence(s) coding for same may also be used in vitro.
- the PMI enzyme or nucleotide sequence(s) coding for same may also be used with one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques.
- variant in relation to the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acid from or to the sequence providing the resultant amino acid sequence has PMI activity, preferably having at least the same activity of the enzyme shown in Figure 1
- homologue covers homology with respect to structure and/or function providing the resultant enzyme has PMI activity.
- sequence homology preferably there is at least 75 % , more preferably at least 85 % , more preferably at least 90% homology to the sequence shown m Figure 1 More preferably there is at least 95 % , more preferably at least 98% , homology to the sequence shown in the attached Figure 1
- variants in relation to the nucleotide sequence coding for the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant nucleotide sequence codes for an enzyme having PMI activity, preferably having at least the same activity of the enzyme shown in Figure 1.
- homologue covers homology with respect to structure and/or function providing the resultant nucleotide sequence codes for an enzyme having PMI activity With respect to sequence homology, preferably there is at least 75%, more preferably at least 85%, more preferably at least 90% homology to the sequence shown in Figure 1. More preferably there is at least 95 % , more preferably at least 98%, homology to the sequence shown in Figure 1.
- an enzyme comprising the amino acid sequence shown in Figure 4, or a variant, homologue or fragment thereof.
- nucleotide sequence coding for the enzyme of the first aspect or a sequence that is complementary thereto is provided.
- nucleotide sequence comprising the sequence shown in Figure 4, or a variant, homologue or fragment thereof or a sequence that is complementary thereto.
- a vector comprising or expressing the invention of any one of the earlier aspects.
- a plasmid comprising or expressing the invention of any one of the earlier aspects.
- transgenic organism or part thereof comprising or expressing the invention according to any one of the earlier aspects.
- nucleotide sequence or the enzyme is that as defined in or is contained within or is expressed by the above-mentioned aspects of the present invention.
- Other preferred aspects of this aspect of the present invention include methods of expressing or allowing expression or transforming any one of the nucleotide sequence, the construct, the plasmid, the vector, the cell, the tissue, the organ or the orgamsm, as well as the products thereof
- a preferred aspect of this aspect of the present invention thus relates to the enzyme ⁇ -galactosidase and a nucleotide sequence coding for that enzyme
- the preferred aspect of the present invention relates to recombinant ⁇ - galactosidase
- the preferred aspect of the present invention relates to the use of that recombinant ⁇ -galactosidase to alter the mannose-to-galactose ratio of either an orgamsm (or part thereof) and/or a mannose/galactose containing compound thereof, especially the mannose-to-galactose ratio of gaiactomannan
- One of the key advantages of the present invention is that by using the recombinant ⁇ -galactosidase it is possible to increase the mannose-to-galactose ratio of an orgamsm (or part thereof) and/or a mannose/galactose contaimng compound thereof, in particular in vivo modified guar gum
- the recombinant enzyme can be prepared easily and in large quantities
- the nucleotide sequence can be used to change the in vivo ratio of mannose to galactose levels when inserted (preferably stably inserted) into the genome of an organism (or part thereof)
- the nucleotide sequence is a DNA sequence
- the nucleotide sequence is a recombinant DNA sequence
- the nucleotide sequence is obtainable from deposit NCIMB 40831.
- the enzyme is expressed by use of recombinant DNA techniques.
- the enzyme is expressed by a nucleotide sequence obtainable from deposit NCIMB 40831.
- the organism is a plant.
- the plant is a guar plant.
- mannose/galactose containing compound is guar gum.
- the enzyme or nucleotide sequence(s) coding for same may be used in vivo in combination with one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques.
- the ⁇ -galactosidase enzyme or nucleotide sequence(s) coding for same may also be used in vitro.
- the ⁇ - galactosidase enzyme or nucleotide sequence(s) coding for same may also be used w h one or more other enzymes or nucleotide sequence(s) coding for same, which enzymes or nucleotide sequence(s) coding for same are preferably prepared by use of recombinant DNA techniques.
- variant in relation to the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acid from or to the sequence providing the resultant amino acid sequence has ⁇ -galactosidase activity, preferably having at least the same activity of the enzyme shown in Figure 4.
- homologue covers homology with respect to structure and/or function providing the resultant enzyme has ⁇ -galactosidase activity.
- sequence homology preferably there is at least 75 %, more preferably at least 85 % , more preferably at least 90% homology to the sequence shown in Figure 4. More preferably there is at least 95% , more preferably at least 98%, homology to the sequence shown in the attached Figure 4.
- variant in relation to the nucleotide sequence coding for the enzyme include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant nucleotide sequence codes for an enzyme having ⁇ -galactosidase activity, preferably having at least the same activity of the enzyme shown in Figure 4.
- homologue covers homology with respect to structure and/or function providing the resultant nucleotide sequence codes for an enzyme having ⁇ -galactosidase activity.
- sequence homology preferably there is at least 75%, more preferably at least 85% , more preferably at least 90% homology to the sequence shown in Figure 4. More preferably there is at least 95% , more preferably at least 98%, homology to the sequence shown in Figure 4.
- nucleotide sequences that can hybridise to the nucleotide sequence of the present invention.
- nucleotide in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it means DNA, more preferably cDNA for the coding sequence of the present invention.
- construct which is synonymous with terms such as “conjugate” , “cassette” and “hybrid” - includes the nucleotide sequence directly or indirectly attached or fused to a promoter.
- An example of an indirect attachment is the provision of a suitable spacer group such as an intron sequence, such as the Shl- intron or the ADH intron, intermediate the promoter and the nucleotide sequence.
- the terms do not cover the natural combination of the wild type gene coding for the enzyme ordinarily associated with the wild type gene promoter and when they are both in their natural environment.
- One highly preferred embodiment of the present invention therefore relates to the nucleotide sequence of the present invention operatively linked to a heterologous promoter.
- the construct may even contain or express a marker which allows for the selection of the genetic construct in, for example, a plant, such as guar, into which it has been transferred.
- a marker which allows for the selection of the genetic construct in, for example, a plant, such as guar, into which it has been transferred.
- markers exist which may be used, such as for example those encoding mannose-6-phosphate isomerase (especially for plants) or those markers that provide for herbicide or antibiotic resistance - e.g. resistance to G418, hygromycin, bleomycin, kanamycin and gentamycin.
- vector includes expression vectors and transformation vectors.
- expression vector means a construct capable of in vivo or in vitro expression.
- transformation vector means a construct capable of being transferred from one species to another - such as from an E. coli plasmid to an Agrobacterium to a plant.
- tissue includes tissue per se and organ.
- organism in relation to the present invention includes any organism that could comprise the nucleotide sequence coding for the enzyme according to the present invention and/or products obtained therefrom, and/or wherein the nucleotide sequence according to the present invention can be expressed when present in the organism.
- the organism is a guar plant.
- transgenic organism in relation to the present invention includes any organism that comprises the nucleotide sequence coding for the enzyme according to the present invention and/or products obtained therefrom, and/or wherein the nucleotide sequence according to the present invention can be expressed within the organism.
- the nucleotide sequence is incorporated in the genome of the organism.
- the transgenic organism is a plant, more preferably a guar plant.
- the transgenic organism of the present invention includes an organism comprising any one or more of the nucleotide sequences coding for the enzymes according to the present invention, constructs according to the present invention, vectors according to the present invention, plasmids according to the present invention, cells according to the present invention, tissues according to the present invention, or the products thereof, including combinations thereof.
- the transgenic organism can also comprise any one or more of the nucleotide sequences coding for the enzymes of the present invention under the control of one or more heterologous promoters.
- the transgenic organism does not comprise the combination of a promoter and the nucleotide sequence coding for the enzyme according to the present invention, wherein both the promoter and the nucleotide sequence are native to that organism (or part thereof) and are in their namral environment.
- the present invention does not cover the native nucleotide coding sequence according to the present invention in its namral environment when it is under the control of its native promoter which is also in its namral environment.
- the present invention does not cover the native enzyme according to the present invention when it is in its natural environment and when it has been expressed by its native nucleotide coding sequence which is also in its namral environment and when that nucleotide sequence is under the control of its native promoter which is also in its namral environment.
- promoter is used in the normal sense of the art, e.g an RNA polymerase binding site in the Jacob-Mond theory of gene expression.
- the promoter could additionally include one or more features to ensure or to increase expression in a suitable host.
- the features can be conserved regions such as a Pribnow Box or a TATA box.
- the promoters may even contain other sequences to affect (such as to maintain, enhance, decrease) the levels of expression of the nucleotide sequence of the present invention
- suitable other sequences include the S ⁇ i-intron or an ADH intron
- suitable sequences include inducible elements - such as temperamre, chemical, light or stress inducible elements.
- TMV 5' signal sequence see Sleat Gene 217 [1987] 217-225; and Dawson Plant Mol. Biol. 23 [1993] 97).
- the nucleotide sequence according to the present invention is under the control of a promoter that allows expression of the nucleotide sequence.
- the promoter may be a cell or tissue specific promoter. If, for example, the organism is a plant then the promoter can be one that affects expression of the nucleotide sequence in any one or more of seed, stem, sprout, root and leaf tissues
- the promoter for the nucleotide sequence of the present invention can be the ⁇ -Amy 1 promoter (otherwise known as the Amy 1 promoter, the Amy 637 promoter or the ⁇ -Amy 637 promoter) as described in PCT/EP95/02195
- the promoter for the nucleotide sequence of the present invention can be the ⁇ -Amy 3 promoter (otherwise known as the Amy 3 promoter, the Amy 351 promoter or the ⁇ -Amy 351 promoter) as described in PCT/EP95/02196
- the Amy 351 promoter it is possible to inactivate a part of it so that the partially inactivated promoter expresses the nucleotide sequence in a more specific manner such as in just one specific tissue type or organ.
- inactivated means partial inactivation in the sense that the expression pattern of the promoter is modified but wherein the partially inactivated promoter still functions as a promoter
- the modified promoter is capable of expressing the nucleotide sequence in at least one (but not all) specific tissue of the original promoter
- other partial inactivation of a promoter sequence include altering the folding pattern of the promoter sequence, or binding species to parts of the nucleotide sequence, so that a part of the nucleotide sequence is not recogmsed by, for example, RNA polymerase
- Another, and preferable, way of partially inactivating the Amy 351 promoter is to truncate it to form fragments thereof Another way would be to mutate at least a part of the sequence so that the RNA poiymerase can not bind to that part or another pan
- Another modification is to mutate the binding sites for regulatory proteins for example the CreA protein known from filamentous fungi to exert carbon catabohte repression, and thus abolish the catabolite repression of the native promoter
- the basic principle in the construction of genetically modified plants is to insert genetic information in the plant genome so as to obtain a stable maintenance of the inserted genetic material.
- Several techniques exist for inserting the genetic information the two main principles being direct introduction of the genetic information and introduction of the genetic information by use of a vector system. A review of the general techniques may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205- 225) and Christou (Agro-Food-Industry Hi-Tech March April 1994 17-27).
- the present invention relates to a vector system which carries the nucleotide sequence or construct according to the present invention and which is capable of introducing the nucleotide sequence or construct into the genome of an organism, such as a plant.
- the vector system may comprise one vector, but it can comprise two vectors. In the case of two vectors, the vector system is normally referred to as a binary vector system.
- Binary vector systems are described in further detail in Gynheung An et al. (1980), Binary Vectors, Plant Molecular Biology Manual A3, 1-19.
- One extensively employed system for transformation of plant cells with a given promoter or nucleotide sequence or construct is based on the use of a Ti plasmid from Agrobacterium tumefaciens or a Ri plasmid from Agrobacte ⁇ um rhizogenes An et al. (1986), Plant Physiol. 81, 301-305 and Butcher D.N. et al. (1980), Tissue Culture Methods for Plant Pathologists, eds. : D.S. Ingrams and J.P. Helgeson, 203-208.
- Ti and Ri plasmids have been constructed which are suitable for the construction of the plant or plant cell constructs described above.
- a non-limiting example of such a Ti plasmid is pGV3850.
- the nucleotide sequence or construct of the present invention should preferably be inserted into the Ti-plasmid between the terminal sequences of the T-DNA or adjacent a T-DNA sequence so as to avoid disruption of the sequences immediately surrounding the T-DNA borders, as at least one of these regions appear to be essential for insertion of modified T-DNA into the plant genome.
- the vector system of the present invention is preferably one which contains the sequences necessary to infect the plant (e.g. the vir region) and at least one border part of a T- DNA sequence, the border part being located on the same vector as the genetic construct.
- the vector system is preferably an Agrobacterium tumefaciens Ti- plasmid or an Agrobacte ⁇ um rhizogenes Ri-plasmid or a derivative thereof, as these plasmids are well-known and widely employed in the construction of transgemc plants, many vector systems exist which are based on these plasmids or derivatives thereof.
- the nucleotide sequence or construct of the present invention may be first constructed in a microorganism in which the vector can replicate and which is easy to manipulate before insertion into the plant.
- An example of a useful microorganism is E. coli, but other microorganisms having the above properties may be used.
- a vector of a vector system as defined above has been constructed in E. coli, it is transferred, if necessary, into a suitable Agrobacterium strain, e.g. Agrobacterium tumefaciens.
- the Ti-plasmid harbouring the nucleotide sequence or construct of the invention is thus preferably transferred into a suitable Agrobacterium strain, e.g. A. tumefaciens, so as to obtain an Agrobacterium cell harbouring the nucleotide sequence or construct of the invention, which DNA is subsequently transferred into the plant cell to be modified.
- cloning vectors which contain a replication system in E. coli and a marker which allows a selection of the transformed cells.
- the vectors contain for example pBR 322, pUC series, M13 mp series, pACYC 184 etc.
- the nucleotide or construct of the present invention can be introduced into a suitable restriction position in the vector.
- the contained plasmid is used for the transformation in E. coli.
- the E. coli cells are cultivated in a suitable nutrient medium and then harvested and lysed.
- the plasmid is then recovered.
- sequence analysis there is generally used sequence analysis, restriction analysis, electrophoresis and further biochemical-molecular biological methods. After each manipulation, the used DNA sequence can be restricted and connected with the next DNA sequence. Each sequence can be cloned in the same or different plasmid.
- the presence and/or insertion of further DNA sequences may be necessary. If, for example, for the transformation the Ti- or Ri- plasmid of the plant cells is used, at least the right boundary and often however the right and the left boundary of the Ti- and Ri-plasmid T-DNA, as flanking areas of the introduced genes, can be connected.
- T-DNA for the transformation of plant cells has been intensively studied and is described in EP-A-120516; Hoekema, in: The Binary Plant Vector System Offset-drukkerij Kanters B.B. , Alblasserdam, 1985, Chapter V; Fraley, et al. , Crit. Rev. Plant Sci., 4: 1-46; and An et al., EMBO J. (1985) 4:277-284.
- a plant to be infected is wounded, e.g. by cutting the plant with a razor or puncturing the plant with a needle or rubbing the plant with an abrasive.
- the wound is then inoculated with the Agrobacterium.
- the inoculated plant or plant part is then grown on a suitable culture medium and allowed to develop into mature plants.
- tissue culturing methods such as by culturing the cells in a suitable culture medium supplied with the necessary growth factors such as amino acids, plant hormones, vitamins, etc.
- Regeneration of the transformed cells into genetically modified plants may be accomplished using known methods for the regeneration of plants from cell or tissue cultures, for example by selecting transformed shoots using an antibiotic and by subculturing the shoots on a medium containing the appropriate nutrients, plant hormones, etc.
- the present invention relates to the use of a gene product (e.g. the PMI enzyme which is involved in the biosynthesis of mannose) to increase the mannose-to- galactose ratio of an organism (or part thereof) or mannose/galactose containing compound thereof.
- a gene product e.g. the PMI enzyme which is involved in the biosynthesis of mannose
- the present invention relates to that nucleotide sequence and the gene product it encodes.
- the present invention is based on the surprising finding that it is possible to increase the mannose-to-galactose ratio of guar gum by the insertion of a gene or genes encoding a gene product or products which are involved in the biosynthesis of mannose/galactose containing compounds such as mannose-6-phosphate, namely PMI.
- this preferred aspect of the present invention relates to the insertion of a phosphomannose isomerase gene into a plant, preferably guar
- the present invention is also based on the surprising finding that it is possible to increase the mannose-to-galactose ratio of guar gum by the insertion of a gene or genes encoding a gene product or products which are involved in the biosynthesis of guar or precursors therefor
- the gene codes for PMI
- the gene codes for ⁇ -galactosidase, preferably coffee bean ⁇ -galactosidase or senna ⁇ -galactosidase, more preferably senna ⁇ -galactosidase
- NCIMB National Collections of Industrial and Marine Bacteria Limited
- E.coli K12 containing plasmid pPMI-60 E.coli K12 containing plasmid pPMI-60.
- the deposit number is NCIMB 40774.
- the present invention also covers nucleotide sequences obtainable from that deposit and the products encoded thereby.
- the deposit number is NCIMB 40831.
- the present invention also covers nucleotide sequences obtainable from that deposit and the products encoded thereby.
- Figure 1 shows the amino acid sequence of one enzyme according to die present invention and the sequence of one nucleotide sequence according to the present invention
- Figure 2 is a plasmid map of pcDNAII
- Figure 3 is a plasmid map of pSG-Man5
- Figure 4 shows the amino acid sequence of another enzyme according to the present invention and the sequence of another nucleotide sequence according to the present invention
- Figure 5 is a plasmid map of pPS48
- Figure 6 is a plasmid map of pPS48SEGAL
- Figure 7 is a plasmid map of pBKL4
- Figure 8 is a plasmid map of pBKL4SEGAL
- Figure 9 is a plasmid map of pPS48-GALIII.
- Figure 10 is a plasmid map of pBKL4GALIII.
- a cDNA expression library represent mRNA from immamre guar endosperm was constructed in the plasmid pcDNAII (Invitrogen Corporation) and transformed into the E coli strain ToplOF - (Invitrogen Corporation).
- the quality of the cDNA library was controlled by purification of plasmids from a number of separate colonies picked at random. Restriction enzyme digestion of the plasmids showed that all contained an insert of at least 500 bp.
- the E coli strain CDl man- contains an inactive PMI gene and is thus unable to metabolise mannose (Darzins et al 1985). This strain was used for the following complementation studies.
- CDl man- cells were made competent by the method of Hanahan (1985). A titer of 3-4 x 10" transformed cells/ ⁇ g library plasmid cDNA was obtained. A similar titer was found when the cells were transformed with a Bluescript control plasmid.
- CDl man- competent cells were transformed with the E coli PMI gene under control of its native promoter (Mills and Guest 1984) and in another experiment the cells were transformed with the E coli PMI gene under the control of the plant promoter CaMV 35S (pSGMANl , see Bojsen et al 1993).
- plating of the transformed cells on M9-SGP resulted in large numbers of large colonies.
- competent CDl man- cells were not transformed or transformed with a Bluescript control plasmid, no large colonies were obtained but a number of very small hardly visible colonies were observed.
- the M9-SGP selective medium is suitable for selecting cells which contain an active PMI gene.
- Competent CDl man- cells were transformed with plasmid DNA isolated from the guar endosperm cDNA library. Transformed CDl man- cells were plated onto the selective substrate M9-SGP. After incubation for two days at 37 °C the majority of the plated cells appeared as very small colonies whereas less than 0.1 % of the colonies were remarkably larger.
- genomic guar DNA was purified from leaves according to Dellaporta et al (1983), restriction enzyme digested. Southern blotted and probed with plasmid DNA derived from PMI- 60 labelled with P-32 according to Feinberg and Vogelstein (1983) Hybridisation and washing were performed at 68°C, 6 x SSC and 68°C, 0 2 x SSC (Maniatis et al 1982), respectively The PMI-60 probe hybridised to a number of fragments of the digested guar genomic DNA
- pPMI-60 The insert in the plasmid of PMI-60 (called pPMI-60) was sequenced by dideoxy sequencing applying primer walking (Sanger and Coulson 1977), first by fluorescein labelled primers (reverse and universal) and subsequently by internal labelling using fluorescein-dATP
- the size of the cDNA clone was 1.66 kb of which the PMI gene covered 1.29 kb.
- the PMI start and stop codon was located at 0 09 kb and 1 38 kb, respectively
- the insert contained a putative polyadenylation signal at 0 11 kb downstream from the stop codon and is poly-A terminated
- Transgenic guar plants were obtained by Agrobacterium tumefaciens mediated gene transfer as described by J ⁇ rsboe and Okkels (1994) - the contents of which are incorporated herein by reference.
- the preferred Agrobacterium tumefaciens strain was in these studies LB A 4404.
- the insert in the T-DNA in the plasmid called pDO18 contained 3 genes (right border to left border): a /3-glucuronidase (GUS) gene, a phosphomannose isomerase (PMI) gene and a neomycin phosphotransferase (NPTII) gene.
- GUS /3-glucuronidase
- PMI phosphomannose isomerase
- NPTII neomycin phosphotransferase
- guar endosperms devoid of embryo and seed coat were prepared by hand and treated repeatedly with 70% ethanol during homogenization according to Edwards et al (1992).
- the ethanol precipitate was added 2 ml 2 N trifluor acetic acid (TFA) and hydrolysis was performed at 120°C for 2 hours.
- the TFA was removed by evaporation at 50°C.
- the dried precipitate was dissolved in 500 ⁇ l HPLC grade H 2 O and 25 ⁇ l sample was applied onto an Aminex HPX-87P column (300 x 7.8 mm). The column was heated to 80° C in a column oven and eluted with H 2 O. Elution of saccharides was followed with an Rl-detector.
- mannose and galactose was baseline separated. The respective peak areas were determined and die mannose-to-galactose ratios were calculated. Guar gum and LBG from Sigma were used as standards along with endosperm samples from non-transgenic guar plants. The mannose-to-galactose ratios obtained were 1.6: 1 for both Sigma guar gum and non-transgenic endosperms, and 3.5: 1 for Sigma LBG. These ratios are in excellent agreement with those generally accepted (Reid and Edwards 1995).
- Each of the transformants increased the mannose-to-galactose ratio of guar gum.
- cDNA clones of ⁇ -galactosidase from senna endosperm were isolated by PCR as follows.
- the PCR conditions were: 1 min at 94°C, 2 min at 55°C, 2 min at 72°C for 35 cycles followed by 10 min at 72°C.
- the PCR product was analysed by agarose gel electrophoresis, and a single product of 850 bp was obtained.
- the DNA product designated SEGAL, was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).
- 3' and 5' ends of the senna ⁇ -galactosidase cDNA were obtained by the method called 3' and 5' RACE as previously described (Nielsen et al. Plant Mol. Biol 31 (1996) 539-552. Briefly, for 3' RACE, approximately lmg of the above total RNA and 2.5 pmol of the primer:
- the cDNA was amplified by two rounds of PCR.
- the downstream primer was:
- the downstream primer was: Q, (5'-GAGGACTCGAGCTCAAGC)
- 3'GSP2 (5'-GGTGTTGTGGAATAGAAGTTCATC),
- the PCR conditions for the first PCR were: 1 min at 94°C, 2 min at 60°C, 2 min at 72°C for 35 cycles followed by 10 min at 72°C.
- the conditions were: 1 min at 94°C, 2 min at 50°C, 2 min at 72°C for 35 cycles followed by 10 min at 72 °C.
- the PCR product after the second PCR was analysed by agarose gel electrophoresis, and a single product of 530 bp was obtained.
- the DNA product designated 3 'SEGAL, was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).
- 5'GSP1 (5'-TTGCACCTTGGTCTTCATGTCC),
- the cDNA was dC-tailed according to the protocol of Gibco BRL.
- the tailed cDNA was subjected to two rounds of PCR.
- 5 'GSP2 (5-C ATAGCTTTACTGCATGTTTGGTTTCC) .
- 5'GSP3 (5'-CAGCCAGAGCCTTAATTCCTGAAGG),
- the PCR conditions for the first PCR were: 1 min at 94°C, 2 mm at 51 °C, 2 min at 72°C for 10 cycles followed by 1 min at 94°C, 2 min at 59°C, 2 mm at 72°C for 25 cycles followed by 10 min at 72 °C.
- the PCR product after the second PCR was analysed by agarose gel electrophoresis, and a single product of 480 bp was obtained.
- the DNA product designated 5' SEGAL, was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).
- An expression vector comprising the coding sequence for senna ⁇ -galactosidase was constructed as follows.
- the vector pPS48 ( Figure 5) was constructed by inserting the 0.75 kb cauliflower mosaic virus (CaMV) 35S RNA promoter (E35S) containing a duplication of the -90 to -420 region (Kay et al. Science 236 (1987) 1299-1302), the 0.21 kb fragment containing the CaMV 35S RNA polyadenylation sequence (Odell et al. Nature 313 (1985) 810-812) and a synthetic oligonucleotide linker (Pstl-BamHl-Smal-Sacl-Sall- Sphl) into ⁇ UC8 (Vieira and Messing, Gene 19 (1982) 259-268).
- the three DNA fragments, 5'SEGAL, SEGAL and 3'SEGAL, were linked together by PCR to reconstitute a clone of senna ⁇ -galactosidase cDNA, containing the coding sequence and most of the non translated 5' end.
- the fragment 5' SEGAL was re-amplified using the primers 5'GSP3 and B255, ( '- ATTGGATCCACTCACAC-GTATACACTACAC)
- the fragment 3'SEGAL was re-amplified using the primers 3'GSP2 and B254,
- the PCR conditions were: For 5'SEGAL, 1 min at 94°C, 2 min at 57°C, 2 min at 72°C for 35 cycles followed by 10 min at 72°C.
- For 3'SEGAL 1 min at 94°C, 2 min at 48° C, 2 min at 72 °C for 35 cycles followed by 10 min at 72 °C.
- For the last PCR to link the three fragments 1 min at 94°C, 2 min at 58°C, 2 min at 72°C for 35 cycles followed by 10 min at 72 °C.
- the PCR product of the last PCR was analysed by agarose gel electrophoresis, and a single product of 1380 bp was obtained.
- the DNA product was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).
- a plant transformation vector comprising the expression cassette for senna ⁇ - galactosidase was constructed as follows.
- the vector pBKL4 ( Figure 7) was constructed from pBI121 (Clontec Laboratories) by deletion of the NPTII cassette and by insertion of a synthetic oligonucieotide linker (EcoRl-Clal-Sall-Hind l-Spel-Kpn-BamHl) and a new NPTII cassette containing the NPTII gene flanked by a CaMV 35S RNA promoter (Odell et al. Na re 313 (1985) 810-812) and a polyadenylation sequence from the octopine synthase gene (Caplan et al. Science 222 (1983) 815-821) between the GUS cassette and the left border.
- a synthetic oligonucieotide linker (EcoRl-Clal-Sall-Hind l-Spel-Kpn-BamHl)
- a new NPTII cassette containing the NPTII gene flanked
- the senna ⁇ -galactosidase expression cassette was excised from pPS48SEGAL and inserted into pBKL4.
- the resulting plasmid pBKL4SEGAL ( Figure 8) was transformed into Agrobacterium tumefaciens strain LBA4404 (Hockema et al. Namre 303 (1983) 179-180) for plant transformation.
- the ⁇ -galactosidase gene from senna was transformed into guar using Agrobacterium tumefaciens transformation, as described in detail by J ⁇ rsboe and Okkels (1994) - the contents of which are incorporated herein by reference.
- results are derived from the analysis of endosperms from 4 independent guar transformants harbouring the senna ⁇ - galactosidase gene. The results are given as % increases of the mannose-to-galactose ratios relative to un- transformed control endosperms.
- An expression vector comprising the coding sequence for coffee bean ⁇ -galactosidase was constructed as follows.
- the vector pPS48 ( Figure 5) was constructed by inserting the 0.75 kb cauliflower mosaic virus (CaMV) 35S RNA promoter (E35S) containing a duplication of the -90 to -420 region (Kay et al. Science 236 (1987) 1299-1302), the 0.21 kb fragment containing the CaMV 35S RNA polyadenylation sequence (Odell et al. Namre 313 (1985) 810-812) and a synthetic oligonucleotide linker (Pstl-BamHl-Smal-Sac ⁇ -Sal - Sphl) into pUC8 (Vieira and Messing, Gene 19 (1982) 259-268).
- a DNA fragment containing the coffee bean ⁇ -galactosidase coding sequence was isolated from the plasmid pCR-BZ (Zhu and Goldstein Gene 140 (1994) 227-231) by polymerase chain reaction (PCR) employing an upstream primer:
- the DNA fragment was cloned into the pT7Blue vector (Novagen) and the nucleotide sequence was determined using a Termo sequenase fluorescent cycle sequencing kit (Amersham) and an ALF DNA sequencer (Pharmacia).
- a plant transformation vector comprising the expression cassette for coffee bean ⁇ - galactosidase was constructed as follows.
- the vector pBKL4 ( Figure 7) was constructed from pBI121 (Clontec Laboratories) by deletion of the NP ⁇ I cassette and by insertion of a synthetic oligonucleotide linker (EcoRl-Clal-Sall-Hindll-Spel-Kpn-BamH ⁇ ) and a new NPTII cassette containing the NPTII gene flanked by a CaMV 35S RNA promoter (Odell et al. Namre 313 (1985) 810-812) and a polyadenylation sequence from the octopine synthase gene (Caplan et al. Science 222 (1983) 815-821) between the GUS cassette and the left border.
- a synthetic oligonucleotide linker (EcoRl-Clal-Sall-Hindll-Spel-Kpn-BamH ⁇ )
- a new NPTII cassette containing the NPTII gene flanked by a
- the coffee bean ⁇ -galactosidase expression cassette was excised from pPS48-GALIII by digestion with Xb ⁇ l and inserted into Spel digested pBKLA.
- the ⁇ -galactosidase gene from coffee bean was transformed into guar using Agrobacterium tumefaciens transformation, as described in detail by J ⁇ rsboe and Okkels (1994).
- the PMI transformed lines, the coffee bean ⁇ -galactosidase transformed lines, and the senna ⁇ -gaiactosidase transformed lines yielded a higher ratio of mannose to galactose than the non-transformed lines.
- the coffee bean ⁇ -galactosidase transformants had a ratio of mannose to galactose of up to 1.75 - compared to 1.65 for the non-transformed lines - and that some of the senna ⁇ - galactosidase transformants had a ratio of mannose to galactose of even up to 2.
- the extent to which the in vivo modification occurs depend on the activity of the gaiactomannan related enzymes encoded by the genes transformed into guar. Thus, substimtion or modification of the promoters or other regulatory nucleotide or amino acid sequences may lead to in vivo modifications of galactomannans different from those described in the above examples.
- Figure 1 presents bom a nucleotide sequence coding for a PMI enzyme and the amino acid sequence of that PMI enzyme.
- SEQ ID No. 1 nucleotide sequence coding for a PMI enzyme
- amino acid sequence of that PMI enzyme amino acid sequence of that PMI enzyme.
- Figure 4 presents both a nucleotide sequence coding for an ⁇ - galactosidase enzyme and the amino acid sequence of that ⁇ -galactosidase enzyme.
- that nucleotide sequence can be referred to as SEQ ID No. 3 and that amino acid sequence can be referred to as SEQ ID No. 4.
- NCIKB National Collections of Industrial and Marine Bacteria Limited
- Mari with a cross the applicable box Mari with a cross the applicable box.
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP96943105A EP0866869A2 (en) | 1995-12-04 | 1996-12-02 | Modification process |
AU11939/97A AU1193997A (en) | 1995-12-04 | 1996-12-02 | Modification process |
JP9521002A JP2000502252A (en) | 1995-12-04 | 1996-12-02 | Modification process |
BR9612773-2A BR9612773A (en) | 1995-12-04 | 1996-12-02 | Modification process. |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9524752.4 | 1995-12-04 | ||
GBGB9524752.4A GB9524752D0 (en) | 1995-12-04 | 1995-12-04 | Modification process |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1997020937A2 true WO1997020937A2 (en) | 1997-06-12 |
WO1997020937A3 WO1997020937A3 (en) | 1997-11-27 |
Family
ID=10784871
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP1996/005581 WO1997020937A2 (en) | 1995-12-04 | 1996-12-02 | Modification process |
Country Status (8)
Country | Link |
---|---|
EP (1) | EP0866869A2 (en) |
JP (1) | JP2000502252A (en) |
CN (1) | CN1207772A (en) |
AU (1) | AU1193997A (en) |
BR (1) | BR9612773A (en) |
GB (1) | GB9524752D0 (en) |
MX (1) | MX9804483A (en) |
WO (1) | WO1997020937A2 (en) |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998054335A1 (en) * | 1997-05-28 | 1998-12-03 | Danisco A/S | In vivo modification of galactomannans in guar by expression of udp-galactose epimerase antisense rna |
WO1999060103A2 (en) * | 1998-05-21 | 1999-11-25 | Unilever Plc | Galactosyltransferase from plants involved in galactomannan biosynthrsis |
US6311808B1 (en) | 1996-02-09 | 2001-11-06 | Continental Teves Ag & Co., Ohg | Combined service and parking brake system |
US6841662B2 (en) * | 1998-11-11 | 2005-01-11 | Nestec S.A. | Coffee mannanase |
US7148399B2 (en) * | 2000-03-30 | 2006-12-12 | Nestec S.A. | Coffee mannanase |
US7265265B2 (en) | 2002-11-14 | 2007-09-04 | Pioneer Hi-Bred International, Inc. | Genes for galactomannan production in plants and methods of use |
US7462466B2 (en) * | 1998-04-09 | 2008-12-09 | University Of Wales College Of Medicine | Porcine CD59 nucleic acids and cells containing the same |
US7670818B1 (en) | 2006-11-21 | 2010-03-02 | Cornell Research Foundation, Inc. | β-mannanase from coffee berry borer, hypothenemus hampei, and uses thereof |
US8080418B2 (en) | 2007-03-09 | 2011-12-20 | Corning Incorporated | Method of making a three dimensional cell culture matrix |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
HUP0401860A3 (en) * | 2001-11-06 | 2010-01-28 | Univ British Columbia | Modulating urea degradation in wine yeast |
JP4960591B2 (en) * | 2004-12-14 | 2012-06-27 | 味の素ゼネラルフーヅ株式会社 | Anti-allergen composition containing mannooligosaccharides |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0192401A2 (en) * | 1985-02-12 | 1986-08-27 | Novo Nordisk A/S | Polypeptide product |
EP0255153A1 (en) * | 1986-06-03 | 1988-02-03 | Unilever N.V. | Production of guar alpha-galactosidase by hosts transformed by recombinant DNA methods |
WO1995007088A1 (en) * | 1993-09-08 | 1995-03-16 | New York Blood Center, Inc. | RECOMBINANT α-GALACTOSIDASE ENZYME AND cDNA ENCODING SAID ENZYME |
-
1995
- 1995-12-04 GB GBGB9524752.4A patent/GB9524752D0/en active Pending
-
1996
- 1996-12-02 EP EP96943105A patent/EP0866869A2/en not_active Withdrawn
- 1996-12-02 WO PCT/EP1996/005581 patent/WO1997020937A2/en not_active Application Discontinuation
- 1996-12-02 JP JP9521002A patent/JP2000502252A/en active Pending
- 1996-12-02 BR BR9612773-2A patent/BR9612773A/en not_active Application Discontinuation
- 1996-12-02 AU AU11939/97A patent/AU1193997A/en not_active Abandoned
- 1996-12-02 CN CN 96199781 patent/CN1207772A/en active Pending
-
1998
- 1998-06-04 MX MX9804483A patent/MX9804483A/en unknown
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0192401A2 (en) * | 1985-02-12 | 1986-08-27 | Novo Nordisk A/S | Polypeptide product |
EP0255153A1 (en) * | 1986-06-03 | 1988-02-03 | Unilever N.V. | Production of guar alpha-galactosidase by hosts transformed by recombinant DNA methods |
WO1995007088A1 (en) * | 1993-09-08 | 1995-03-16 | New York Blood Center, Inc. | RECOMBINANT α-GALACTOSIDASE ENZYME AND cDNA ENCODING SAID ENZYME |
Non-Patent Citations (4)
Title |
---|
EDWARDS M ET AL: "CONTROL OF MANNOSE TO GALACTOSE RATIO DURING GALACTOMANNAN FORMATION IN DEVELOPING LEGUME SEEDS" PLANTA (HEIDELB), 187 (1). 1992. 67-74., XP000654833 * |
OVERBEEKE N ET AL: "CLONING AND NUCLEOTIDE SEQUENCE OF THE ALPHA-GALACTOSIDASE CDNA FROM CYAMOPSIS TETRAGONOLOBA (GUAR)" PLANT MOLECULAR BIOLOGY, vol. 13, no. 5, 1 November 1989, pages 541-550, XP000095140 * |
PROUDFOOT A E I ET AL: "PURIFICATION, CDNA CLONING AND HETEROLOGOUS EXPRESSION OF HUMAN PHOSPHOMANNOSE ISOMERASE" EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 219, 1994, pages 415-423, XP000652337 * |
SMITH D J ET AL: "CLONING AND HETEROLOGOUS EXPRESSION OF THE CANDIDA ALBICANS GENE PMI 1 ENCODING PHOSPHOMANNOSE ISOMERASE" YEAST, vol. 11, 1995, pages 301-310, XP000655073 * |
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6311808B1 (en) | 1996-02-09 | 2001-11-06 | Continental Teves Ag & Co., Ohg | Combined service and parking brake system |
GB2342920B (en) * | 1997-05-28 | 2001-08-15 | Danisco | In vivo modification of galactomannans in guar by expression of udp-galactose epimerase antisense rna |
WO1998054335A1 (en) * | 1997-05-28 | 1998-12-03 | Danisco A/S | In vivo modification of galactomannans in guar by expression of udp-galactose epimerase antisense rna |
GB2342920A (en) * | 1997-05-28 | 2000-04-26 | Danisco | In vivo modification of galactomannans in guar by expression of udp-galactose epimerase antisense rna |
US7462466B2 (en) * | 1998-04-09 | 2008-12-09 | University Of Wales College Of Medicine | Porcine CD59 nucleic acids and cells containing the same |
WO1999060103A3 (en) * | 1998-05-21 | 2000-03-02 | Unilever Plc | Galactosyltransferase from plants involved in galactomannan biosynthrsis |
WO1999060103A2 (en) * | 1998-05-21 | 1999-11-25 | Unilever Plc | Galactosyltransferase from plants involved in galactomannan biosynthrsis |
US6841662B2 (en) * | 1998-11-11 | 2005-01-11 | Nestec S.A. | Coffee mannanase |
US7148399B2 (en) * | 2000-03-30 | 2006-12-12 | Nestec S.A. | Coffee mannanase |
US7265265B2 (en) | 2002-11-14 | 2007-09-04 | Pioneer Hi-Bred International, Inc. | Genes for galactomannan production in plants and methods of use |
US7670818B1 (en) | 2006-11-21 | 2010-03-02 | Cornell Research Foundation, Inc. | β-mannanase from coffee berry borer, hypothenemus hampei, and uses thereof |
US7678556B2 (en) | 2006-11-21 | 2010-03-16 | Cornell Research Foundation, Inc. | Beta-mannanase from coffee berry borer, Hypothenemus hampei, and uses thereof |
US8080418B2 (en) | 2007-03-09 | 2011-12-20 | Corning Incorporated | Method of making a three dimensional cell culture matrix |
Also Published As
Publication number | Publication date |
---|---|
AU1193997A (en) | 1997-06-27 |
GB9524752D0 (en) | 1996-02-07 |
WO1997020937A3 (en) | 1997-11-27 |
BR9612773A (en) | 2001-01-02 |
CN1207772A (en) | 1999-02-10 |
JP2000502252A (en) | 2000-02-29 |
MX9804483A (en) | 1998-09-30 |
EP0866869A2 (en) | 1998-09-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE69836267T2 (en) | NUCLEIC ACIDS FROM THE ARTICHOKE (CYNARA SCOLYMUS), WHICH CODE FOR AN ENZYME WITH FRUCTOSYL POLYMERASE ACTIVITY | |
US8173866B1 (en) | Modulation of plant xylan synthases | |
CA2142308C (en) | Dna sequences which lead to the formation of polyfructans (levans), plasmids containing these sequences as well as a process for preparing transgenic plants | |
WO1997004113A2 (en) | Inhibition of gene expression | |
CA2136828A1 (en) | Dna sequences and plasmids for the preparation of plants with changed sucrose concentration | |
EP0839202A2 (en) | Inhibition of gene expression | |
US8399738B2 (en) | Fructan biosynthetic enzymes | |
WO1997020937A2 (en) | Modification process | |
JP2002527056A (en) | Materials and methods for modification of plant cell wall polysaccharides | |
AU733483B2 (en) | In vivo modification of galactomannans in guar by expression of UDP-galactose epimerase antisense RNA | |
JP2001512972A (en) | Sense intron inhibition of starch branching enzyme expression | |
CA2284688C (en) | Corn pullulanase | |
WO1998055596A1 (en) | Use of genes encoding xylan synthase to modify plant cell wall composition | |
EP1272645A1 (en) | Production of non-cariogenic sugars in transgenic plants | |
EP0973919A1 (en) | Plant 4-alpha-glucanotransferases | |
CA2235619A1 (en) | Modified plants and plant products | |
CN101277610B (en) | Improved methods and means for producing hyaluronan | |
NZ523032A (en) | Modification of fructan biosynthesis | |
NZ575554A (en) | Manipulation of soluble carbohydrates (5) with fructan metabolism enzymes | |
US20030150021A1 (en) | Maize 4-alpha-glucanotransferase | |
CH | OH y—CHACONINE | |
MXPA99010181A (en) | Corn pullulanase |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 96199781.8 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG |
|
WR | Later publication of a revised version of an international search report | ||
ENP | Entry into the national phase in: |
Ref document number: 1997 521002 Country of ref document: JP Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/1998/004483 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1996943105 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1996943105 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1996943105 Country of ref document: EP |