WO1995017413A1 - Process for the evolutive design and synthesis of functional polymers based on designer elements and codes - Google Patents

Process for the evolutive design and synthesis of functional polymers based on designer elements and codes Download PDF

Info

Publication number
WO1995017413A1
WO1995017413A1 PCT/EP1994/004240 EP9404240W WO9517413A1 WO 1995017413 A1 WO1995017413 A1 WO 1995017413A1 EP 9404240 W EP9404240 W EP 9404240W WO 9517413 A1 WO9517413 A1 WO 9517413A1
Authority
WO
WIPO (PCT)
Prior art keywords
elements
reaction
functional
synthesis
mold
Prior art date
Application number
PCT/EP1994/004240
Other languages
German (de)
French (fr)
Inventor
Andreas Schwienhorst
Björn LINDEMANN
Merle Fuchs
Karsten Henco
Original Assignee
Evotec Biosystems Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Evotec Biosystems Gmbh filed Critical Evotec Biosystems Gmbh
Publication of WO1995017413A1 publication Critical patent/WO1995017413A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/04—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length on carriers
    • C07K1/047—Simultaneous synthesis of different peptide species; Peptide libraries
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Definitions

  • the present invention relates to a method according to claim 1.
  • Rational design aims to produce an amino acid sequence that folds into a desired structure and also has the desired function. This strategy therefore obviously depends on a deep understanding of "protein folding". Advances in recent years have involved, among other things, rational design Structure domains. However, the design of larger proteins with complex or unprecedented new properties is still beyond the scope of this approach. In contrast, irrational design does not require any information about the protein structure, protein folding, etc. The only requirement here is knowledge of the desired property and a possibility of evaluating molecular populations measured by this property. Starting from a "combinatorial library" of peptides or proteins, molecules with the desired property are selected and only analyzed afterwards. Here the mechanism after a molecule has mastered the task is not determined in advance.
  • mutant formation and selection carried out in parallel can increase the chance of generating a desired multi-fault mutant; by recombination, mutated gene segments can be mixed efficiently.
  • Functionless pseudogenes as members of a functional multi-gene family can be maintained as multi-fault mutants even over longer development periods without counter-selection in order to be able to be positively selected again if a function is retained.
  • the technical problem on which the invention is based relates to the provision of a process for the production of oligomeric or polymeric functional elements such as biopolymers with functional properties, for example enzymes, ribozymes, active substances, etc.
  • a process superior to conventional screening processes is to be used here using evolutionary strategies to be provided.
  • mold elements are first built up by chemical or enzymatic linking of at least two monomers, and the mold elements obtainable in this way are then linked to form functional elements.
  • the nature of the chemical bond between the monomers corresponds to that between the respective shaped elements.
  • the functional elements obtainable in this way can then be tested for the specific potential functions.
  • the linking of the shaped elements is preferably carried out using a solid phase as a reaction carrier.
  • the linking of the form elements can take place chemically and / or enzymatically.
  • the linking of the form elements to the functional elements can either take place according to plan by adding the individual form elements in a targeted manner and subsequent linking, or else statistically by adding randomly controlled addition of the functional elements and their linking. It is possible to build the link step-by-step in a stereospecific and / or directional manner.
  • Preferred form elements are nucleic acids, double-stranded or single-stranded DNA and / or RNA and / or modified nucleic acids.
  • Peptides and / or polypeptides and / or other couplable chemical oligomer mold elements are also suitable as mold elements. This can include oligosaccharides or polysaccharides.
  • the mold elements are used as already synthesized oligomer building blocks or are produced quasi in situ in the reaction vessel.
  • FCS fluorescence correlation spectroscopy
  • one mold element is coupled as a reaction partner to the solid phase for each reaction step in the step-wise connection of the mold element.
  • Mixtures of mold elements can also be used and / or generated directly in the reaction vessel.
  • nucleic acids are used as shaped elements, it is advantageous to provide at least one reaction partner with an interface of a restriction enzyme or to use a nucleic acid shaped element which is free of start and / or stop codons.
  • the reaction interfaces are preferably those which can be recognized by class IIS restriction enzymes. The introduction of restriction sites of this enzyme class is advantageous since any sequences can be linked in a directed manner without the choice of the reaction enzyme influencing the sequence requirements of the end product.
  • any sequences can be linked in a directed manner without having to make any demands on the sequence of the desired end product.
  • This requirement can also be achieved by selective and reversible chemical and / or enzymatic modification of the 3 'and / or 5' ends of the nucleic acids, for example by phosphorylation instead of and in combination with the introduction of the single-stranded overhangs.
  • a reversible chemical modification is the coupling of a trityl protective group which can be split off by treatment with acetic acid.
  • the introduction of the trityl group at the 3 'or 5' end of the nucleotide leads to the blocking of the ligation of the form and / or function codes or elements.
  • Treatment of an oligonucleotide or polynucleotide with nuclease can modify a 3 'or 5' end, for example treatment of exonuclease III modifies the 3 'end by digestion. If nucleotide triphosphates are incorporated into the corresponding oligo- or polynucleotide (eg DNA), the exonuclease on the first thio-nucleotide stops the digestion. This results in an adjustable modification of the end of the oligonucleotide or polynucleotide.
  • the method according to the invention allows the use of shaped elements which are known from X-ray crystallographically analyzed natural functional domains of proteins and polypeptides. In this way, already known building blocks or modules of functional elements already occurring in nature can be used.
  • the shape elements to be used can also be obtained from selection experiments.
  • the use of form elements with a length of 1 to 60 amino acids or nucleotide sequences of corresponding coding length is particularly advantageous.
  • the shape elements can also be degenerate at certain positions and / or carry deletions or insertions, especially when using nucleotides as shape elements.
  • the method according to the invention is a hierarchical method for the design of proteins, nucleic acids, their derivatives or chemical oligo- or polymers with certain desired properties, starting from module libraries, hereinafter referred to as shape elements.
  • shape elements can also be gene segments which code for shape elements.
  • the mold elements functioning as modules should be able to be combined at random. Smaller proteins or subunits for larger proteins with certain properties are separated from the pool of module combinations in a subsequent selection step and can in turn serve as building blocks in a subunit library, etc.
  • the method does not open up dealing with the variance in the sequence space but with the variance in the so-called form space.
  • the mold space formed from basic elements of defined stable mold elements, reduces the complexity of the variants of the components of the sequence space;
  • the process opens up the functional space via a variation of building blocks of the mold space
  • blocks of the form code are used as blocks;
  • the subject of this evolutionary adaptation process is the use of modular components, the shape code, consisting of the shape elements.
  • the form code comprises form elements, built up from elements of the sequence space.
  • the shape code as can be derived from natural polymers such as proteins, polypeptides or functional nucleic acids, encodes stable shape elements (secondary structures, possibly containing tertiary structure elements) under specified external conditions. It is noteworthy that very different sequences (primary structures) can code for very similar form elements. In other words, elements that are very closely adjacent in the mold space can be very far apart in the sequence space (large Hamming distance). The same applies to the reverse case.
  • shape codes With the linear combination of shape codes, heterologous as well as at least partially homologous shape codes can be used, which are genotypically defined by a shape code of natural or artificial origin.
  • natural origin means that existing genetic information is used, such as that which is stored, for example, in the genome of organisms.
  • shape codes of artificial origin are understood at the nucleic acid level in particular to mean that sequences can be generated by algorithms using data processing systems in order to then be synthesized chemically according to these instructions.
  • production by de novo synthesis is also possible in that polymerases are reacted with the associated substrates such as nucleotides.
  • the polymerase reaction can be carried out as a function of the template or independently of the template.
  • the form elements and functional elements can be understood, for example, in proteins or peptides as phenotypes.
  • the corresponding genotypes for example at the nucleic acid level, are the corresponding form and function codes. If, for example, one stays at the nucleic acid level, the "phenotype" is embodied with functional elements and / or form elements, for example by a ribozyme which is reflected genotypically in a nucleic acid sequence as a form code and / or function code.
  • the terms function / form element (phenotype) are always understood to be quasi complementary to the term function / form code (genotype).
  • the shape elements and / or function elements or shape codes and / or function codes can be obtained by various methods, as indicated above, namely by using already known nucleic acid sequences, by generating artificial sequences in Data processing systems or durc de novo synthesis.
  • FIG. 8 explains the terms sequence space, form space and functional space. Analogously to the relationship between mold space and sequence space, it applies to the relationship between mold space and functional space that closely adjacent, homologous elements in the mold space in the functional space can be far removed from one another. As indicated schematically in FIG. 8, the geometry and the physicochemical topology and dynamics of the molecular surface, which interacts with a second molecule, are decisive for the function of a polymer. The underlying structure, defined from the shape code, could be of very different chemical nature. Similar functions in the functional space can be explained by similar interface topologies.
  • the variation in the mold space represents the possible variety of functions in the functional space in a much more efficient manner than, for example, the variation in the sequence space.
  • Figure 1 relates to two single-stranded DNA or RNA molecules that are ligated chemically or enzymatically (e.g. T4 RNA ligase), one of the molecules being immobilized on a solid phase via a cleavable linker (e.g. biotin-streptavidin), while the other molecule is free in solution.
  • a cleavable linker e.g. biotin-streptavidin
  • a whole series of solid phase materials for example magnetic, surface-activated plastic balls
  • This method allows the step-by-step construction of larger DNAs or RNAs. After each ligation step, unreacted RNAs are washed away and the solid phase ligation products i transferred the next ligation approach.
  • the handling, in particular the cleaning of the respective ligation products is advantageously very simple.
  • the product After completion of the last ligation, the product is used directly as an effector molecule or is first translated in an (in vitro) translation reaction into the corresponding protein structure, which then acts as an effector molecule.
  • Figure 2 relates to two completely double-stranded DNA molecules that are chemically or enzymatically (e.g. T4 DNA ligase) ligated "blunt end", one being immobilized on a solid phase via a cleavable linker, while the other is freely in solution.
  • T4 DNA ligase chemically or enzymatically
  • Module A and the last module are designed so that they each contain an interface for a restriction enzyme. This enables first the cleavage of the product from the solid phase and second the subsequent, directed cloning of the DNA (see also FIG. 5).
  • DNA molecules can be ligated just case according to when the molecule in solution a one side of a single-stranded end has, that is' Not present fully double-stranded. In this way, this end is not available for double-strand-specific ligation, for example with T4 DNA ligase.
  • the DNA molecule in solution can be designed so that from its single-stranded end it still has the interface of a restriction enzyme, preferably that of a Class IIS enzyme (for example Alwl) with a recognition site in the partially single-stranded DNA piece to be cut off.
  • a restriction enzyme preferably that of a Class IIS enzyme (for example Alwl) with a recognition site in the partially single-stranded DNA piece to be cut off.
  • the solid phase ligation product can be cut with the restriction enzyme. In this way, a completely double-stranded DNA molecule is formed on the solid phase.
  • the single-stranded end can be filled up to the double strand with a polymerase or digested with an exonuclease.
  • Restriction interfaces can also arise (overlapping) by ligating two double-stranded DNA molecules together.
  • Completely or partially double-stranded DNA molecules can be ligated according to FIGS. 1-4, even if mixtures of molecules (eg B, C, D) are used. In this way, mixtures of immobilized molecules are formed, each of which corresponds to different combinations of the building blocks used.
  • all or part of the DNA can be cleaved from the solid phase using restriction enzymes that cut within the construct and, if necessary, cloned into a phage or bacterial display system, but the DNA can also be expressed in a combined in vitro transcription and translation system.
  • peptides, protein domains and small proteins can be generated by random combination of individual modules. According to a hierarchical method for protein design, protein domains can then also be combined as building blocks in a further stage. At any level of complexity, mutations can be inserted which - without changing the global structure - allow fine-tuning of the three-dimensional arrangement of chemical groups.
  • FIG. 7 schematically explains that different proteins, despite different, catalytically active amino acids in the active center, have homologous functions with respect to the substrate possess (chymotrypsin / trypsin) or, despite a similar spatial arrangement of the amino acids in the active center, can catalyze completely different reactions (trypsin / elastase).
  • FIG. 8 explains the relationship between the terms sequence space, form space and functional space.
  • Oligomers or polymers are produced by matrix-dependent, enzymatic or chemical synthesis by extending stochastic (randomized) or selected (designed) primer molecules.
  • the primers can be complementary to 1.) discrete sequences exclusively at the end of the original template molecule (FIG. 9/10).
  • Discrete sequences anywhere in the original template molecule consist of a mixture of random sequences which consist of the Depending on the (partial) complementarity, let the synthesis start randomly at many places (Fig. 10).
  • Either the primers or, as shown in the figure, also the template DNA can be biotinylated to simplify later purification procedures. This would be particularly advantageous for strand separation (e.g. on streptavidin-Dynabeads) for the purification of the extended primers.
  • thio-NTPs in particular are used. Chain termination molecules can then be, for example, normal ddNTPs (dideoxy nucleoside triphosphates). It is known that phosphodiester bonds can easily be cleaved specifically in minutes by exonuclease III in 50 mM Tris / HCl, 5 mM MgCl 2 , at pH 10.0. In contrast, thiophosphate bonds are not cleaved (Labeit et al., DNA 5: 173, 1986). In this way, the ends of the "Deprotect the resulting polymers by enzymatic removal of the ddNTPs.
  • ddNTPs deoxy nucleoside triphosphates
  • the resulting and deprotected polymers can be either thermally or chemically, e.g. B. with NaOH, separated, the biotin-coupled molecules z. B. on streptavidin-Dynabeads. After physiological conditions have been set, the deprotected polymers hybridize to partially overlapping duplexes.
  • PCR without a primer leads to the actual (re) combination of the polymers and to a further extension of the same.
  • another PCR with (terminal) primers finds state, which again produces products of the original length. These include sequences in which several markers are combined and newly combined.
  • the sequence space is defined by the linear neighborhood relationships of the polymer components of a polymer structure. Homologies describe similarities (in%) in the sequence of the components of a chemical substance class. The higher the degree of relationship between two sequences, the smaller the distance in the sequence space.
  • sequences a) and b) show considerable homology, while sequence c) shows no similarities with a) and b).
  • the mold space is defined by the "spatial" neighboring relationships of the polymers represented by it. The distance between two sequences is determined by the degree of relationship between their structures. Homology here means similarity of the overall structures of polymers, which in turn consist of chemically linked components. Molecules adjacent in the mold space can be far apart in the sequence space and vice versa. [Analogous to this: structure a) 3 alpha helices, structure b) 2 alpha helices plus unstructured area with terminal, short helix, c) antiparallel beta sheet from 4 sheets]
  • the functional space is defined by the geometric, dynamic and physical / chemical surface structure that can interact with another molecule. Homologies describe similarities in the surface structure and the associated interaction properties.
  • heterologous as well as at least partially homologous shape codes can be used.
  • Sequence homologs for encodes can be randomly present in a mixture to be recombined or can be deliberately selected. This mixture can, for example, as described in Eigen & Henco WO 92/18645, contain mutually collective mutant groups of an initial sequence, or homologous genes of related or different organisms. Similar sequences, e.g. B. be very different in terms of their function codes.
  • Penicillin acylase is an example of this. This enzyme is for that industrial application in the field of synthesis of central importance. Before a synthesis of semi-synthetic derivatives of the basic penicillin body, synthetic penicillin must first be gently subjected to an acylase reaction before it can be reactivated with artificial derivatives in a process reversal. Penicillin acylase can be used for both reactions. Certain reaction conditions and substrates are desired for this reaction. However, these conditions differ from the in vivo situation of the microorganism from which penicillin acylases were isolated in each case. This applies, for example, to the optimal position of the equilibrium for the acylated synthesis product or for the hydrolytic cleavage. It is desirable to optimize the enzyme based on the number of sales under the industrially most suitable conditions.
  • the variants mixing in this way can be obtained as described in WO 92/18645.
  • Recombination can be a generally undesirable by-product of an amplification reaction in the sense of a PCR reaction. If, in the saturation phase of a PCR reaction, after many cycles have been run through, the solution becomes depleted of reagents or enzyme and the reaction is below the Km value for certain nucleotide triphosphates, unfinished synthesis products inevitably result. Such events have already been discussed by Simon Wain-Hobson as undesirable artifacts in order to describe HIV variants as possible artifacts after PCR amplification. However, this effect is used and controlled according to the invention, in particular further intensified, that products which are incompletely synthesized as desired become dominant.
  • the recombination can be controlled during a further specific procedure and not only after a PCR reaction.
  • Short oligomers are added to the standard PCR reaction, which only act as PCR primers when the synthesis is initiated by means of thermostable polymerase at comparatively low temperatures. Whenever the correct PCR reaction should dominate, a normal temperature cycle is carried out. If internal start reactions are to occur, a few cycles are initiated at low temperature, possibly with the addition of polymerases such as DNA polymerase I, as is used in oligomer-started labeling reactions (Sambrook, Fritsch, Maniatis, "Molecular cloning ").
  • the resulting incomplete sequences can aggregate in further rounds of amplification, the overhanging ends being able to be filled in at the 3 'end.
  • care must be taken to ensure that those for recombination
  • Certain sequences are available in sufficient concentration to form the incompletely paired duplexes in a few seconds to minutes ⁇ induce displacement or have no 5 '-3' exonuclease activity, instead thermostable ligases can be used instead, so that recombination events are fixed by covalently linking the fragments.
  • elements with at least partial sequence homologies as described above are used.
  • a large number of fragments of at least one original sequence are generated with the aid of template-dependent chemical or enzymatic DNA or RNA synthesis by extending generated (randomized) primers or selected (constructed) primers (see FIGS. 9-11).
  • Selected primers with a defined sequence can be positioned so that certain areas of the DNA or rRNA molecules to be processed, eg. B. active centers, endonuclease-specific cleavage sites or gene regulatory elements are excluded from the recombination process and thus remain unchanged.
  • the use of partially randomized primers in areas of (partial) complementarity analogous to mutaganization primers can also be used to introduce an increased mutation rate.
  • a small, sub-inhibitory amount of chain termination monomers in the DNA synthesis of preferably dideoxynucleotides we randomly terminate the extension reaction and thus achieved a variance in length of the synthesized polymers.
  • the ratio of the concentration of the termination reagent to the concentrations of the nucleotide monomers, as in a sequencing reaction the average chain length of the synthesis product can be controlled.
  • the terminal protective group ie the chain termination monomer
  • the terminal protective group can be split off in whole or in part so that the resulting polymers are again good substrates for the extension reaction (FIG. 12).
  • the DNA or RNA polymers deprotected in this way are then subjected to at least one cycle of denaturation / hybridization of partially complementary strands, followed by a replenishment reaction.
  • the resulting mixture of extended polymers is subjected to a polymerase chain reaction, the primers should preferably be complementary to the ends of the originally used sequence. In this way, products of the original length are created.

Abstract

A process for the production of oligomeric or polymeric functional elements from designer elements in which the functional elements are obtainable by the linking of at least two designer elements, at least one of which is itself made up of at least two monomers which are linked by at least one chemical bond which corresponds to the chemical bond between two designer elements.

Description

Verfahren zum evolutiven Design und Synthese funktionaler Polymere auf der Basis von Formenelementen und FormencodesProcess for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes
Gegenstand der vorliegenden Erfindung ist ein Verfahren gemäß Anspruch 1.The present invention relates to a method according to claim 1.
Die rasante Entwicklung der letzten Jahre im Bereich der Bio¬ wissenschaften hat nicht nur die Grundlagenforschung, sondern gerade auch die angewandte Forschung in diesem Feld stimu¬ liert. Proteine spielen hier aufgrund ihres breiten Wirkungs- spektrums eine herausragende Rolle. Ein ganzer Zweig der modernen Biotechnologie beschäftigt sich heute mit dem sog. "Protein Engineering", d.h. der Herstellung von Designer- Proteinen, die entweder auf der Grundlage bekannter Proteine durch graduelles Abändern oder durch vollständige Neusynthese entwickelt werden. Man unterscheidet hier vor allem zwei Ansätze, das rationale und das irrationale Design.The rapid development in the field of life sciences in recent years has stimulated not only basic research, but also applied research in this field. Proteins play an outstanding role here due to their broad spectrum of activity. A whole branch of modern biotechnology today deals with so-called "protein engineering", i.e. the production of designer proteins, which are developed either on the basis of known proteins by gradual modification or by completely new synthesis. A distinction is made between two approaches, the rational and the irrational design.
Rationales Design ist darauf aus, eine Aminosäuresequenz zu produzieren, die sich in eine gewünschte Struktur faltet, und zusätzlich die erhoffte Funktion aufweist. Damit hängt diese Strategie ganz offensichtlich von einem tiefen Ver¬ ständnis des "Protein folding" ab. Fortschritte in de letzten Jahren betrafen u.a. das rationale Design einfache Struktur-Domänen. Das Design größerer Proteine mit komplexen oder gar beispiellos neuen Eigenschaften liegt jedoch immer noch außerhalb der Möglichkeiten dieses Ansatzes. Dem¬ gegenüber setzt irrationales Design keine Informationen über die Proteinstruktur, Proteinfaltung etc. voraus. Einzig die Kenntnis der gewünschten Eigenschaft und eine Möglichkeit, Molekülpopulationen gemessen an dieser Eigenschaft zu be¬ werten, sind hier Voraussetzung. Ausgehend von einer "com- binatorial library" aus Peptiden oder Proteinen werden Moleküle mit der gewünschten Eigenschaft selektiert und erst im Nachhinein analysiert. Hier wird also der Mechanismus, nachdem ein Molekül die gestellte Aufgabe meistert, nicht im voraus determiniert .Rational design aims to produce an amino acid sequence that folds into a desired structure and also has the desired function. This strategy therefore obviously depends on a deep understanding of "protein folding". Advances in recent years have involved, among other things, rational design Structure domains. However, the design of larger proteins with complex or unprecedented new properties is still beyond the scope of this approach. In contrast, irrational design does not require any information about the protein structure, protein folding, etc. The only requirement here is knowledge of the desired property and a possibility of evaluating molecular populations measured by this property. Starting from a "combinatorial library" of peptides or proteins, molecules with the desired property are selected and only analyzed afterwards. Here the mechanism after a molecule has mastered the task is not determined in advance.
Obwohl dieser Ansatz in sehr eleganter Weise gerade auch in jüngster Zeit Peptide mit einfachen und z. T. neuen Eigen¬ schaften hervorgebracht hat, stellt sich auch hier das Problem, wie man zu größeren Proteinen mit komplexeren Funktionen kommen kann. Schon eine vollständige Bank eines 20mers liefert mit 2020 = 1026 verschiedenen Sequenzen eine astronomisch hohe Zahl zu untersuchender Moleküle. Soll die Peptidsequenz auch noch durch eine Nucleinsäure codiert werden, stellt sich das Problem in noch gravierender Weise. Da der genetische Code degeneriert ist, d.h. eine Aminosäure u.U. durch mehrere verschiedene Codons repräsentiert wird, ergibt sich hier eine Zahl von mindestens 460 = 103S Mole¬ külen, die synthetisiert werden. Normalerweise wird an der dritten Codonposition nur G oder C zugelassen, um Stopcodons weitgehend zu vermeiden. Die verbleibende Zahl von 1030 Molekülen übersteigt noch immer die Standardausbeute eine kommerziellen DNA-Synthese um 12 Größenordnungen. Eine weitere Reduktion der pro Position zugelassenen Codons wurd von Youvan vorgeschlagen. Ob diese Methode den meßbaren Se¬ quenzraum nicht in unzulänglicher Weise einschränkt, gerad bei der Suche nach neuen Funktionen, bleibt abzuwarten. Zum Aufbau funktionaler Strukturen arbeitet die Natur mit modularen Systemen. Bekannt sind die Nucleotidbausteine, die Aminosäure-Bausteine (als Nucleotidtripletts kodiert) und Exon-Domänen (aus Aminosäurebausteinen aufgebaut) . Die evo- lutive Optimierung funktionaler Biopolymere entsprechend der Patentanmeldung WO 92/18645 geht von der Vorstellung aus, durch kontinuierliche Verbesserung bestehender Basiseigen¬ schaften, z. B. eines Enzyms, bei der kontinuierlichen Anpassung an erwünschte Reaktionsbedingungen wie Ionenstärke, Temperatur, pH-Wert eine optimale Struktur zu finden. Sind vorteilhafte oder mindestens neutrale Mutationen möglich, so sind durch mehrmalige Wiederholungen von Selektion und Mutation auch entfernte Bereiche des Sequenzraumes zugäng¬ lich, die durch die Ausgangspopulation nicht abgedeckt waren. Von der ursprünglichen, bereits funktionsfähigen Struktur entfernt man sich jedoch bei diesem Vorgehen in keinem Schritt. Optimiert wird eine Eigenschaft des Aus¬ gangsmoleküls, die bereits - wenn auch in bescheidenem Maße - im ursprünglichen Molekül inhärent ist. Der "Pfad", den eine solche Evolution durch den Sequenzraum nimmt, ist bestimmt durch die zugänglichen, in Richtung der Optima führenden Grate in der unterliegenden Wertelandschaft. Wie bei allen Methoden, die den Sequenzraum nicht vollständig erschließen, besteht bei diesem Vorgehen die nur schwer einzuschätzende Gefahr, in einem lokalen Optimum stecken¬ zubleiben. Für die Praxis bedeutet dies, daß bestimmte Regionen des Sequenzraumes einschließlich der dort befind¬ lichen Optima, durch breite und tiefe "Täler" abgetrennt sind. Bei der begrenzten Populationsgröße von Molekülspezies in Experimenten (P 43 22 147, WO 92/18645) ist aber die Wahr¬ scheinlichkeit zu niedrig, entfernte Vielfehlermutanten zu erzeugen, die sich jenseits dieser Schranke befinden und den Weg zu diesen neuen Optima anzeigen.Although this approach has been used very elegantly, especially recently, peptides with simple and z. T. has brought new properties, the problem arises how to get larger proteins with more complex functions. Even a complete bank of a 20m with 20 20 = 10 26 different sequences provides an astronomically high number of molecules to be examined. If the peptide sequence is also to be encoded by a nucleic acid, the problem is even more serious. Since the genetic code is degenerate, ie an amino acid may be represented by several different codons, this results in a number of at least 4 60 = 10 3S molecules that are synthesized. Usually only G or C is permitted at the third codon position in order to largely avoid stop codons. The remaining number of 10 30 molecules still exceeds the standard yield of commercial DNA synthesis by 12 orders of magnitude. Youvan proposed a further reduction in codons allowed per position. It remains to be seen whether this method does not inadequately restrict the measurable sequence space, especially when searching for new functions. Nature works with modular systems to build functional structures. Known are the nucleotide building blocks, the amino acid building blocks (encoded as nucleotide triplets) and exon domains (composed of amino acid building blocks). The evolutionary optimization of functional biopolymers according to patent application WO 92/18645 is based on the idea of continuously improving existing basic properties, e.g. B. an enzyme to find an optimal structure in the continuous adaptation to desired reaction conditions such as ionic strength, temperature, pH. If advantageous or at least neutral mutations are possible, repeated repetitions of the selection and mutation also make it possible to access distant regions of the sequence space that were not covered by the starting population. With this procedure, however, one step does not move away from the original, already functional structure. A property of the starting molecule is optimized which is already inherent - albeit to a modest degree - in the original molecule. The "path" that such an evolution takes through the sequence space is determined by the accessible ridges leading in the direction of the optima in the underlying value landscape. As with all methods that do not fully open up the sequence space, there is a risk of getting stuck in a local optimum with this procedure that is difficult to assess. In practice, this means that certain regions of the sequence space, including the optima located there, are separated by wide and deep "valleys". Given the limited population size of molecular species in experiments (P 43 22 147, WO 92/18645), however, the probability is too low to generate distant multi-error mutants that are beyond this barrier and indicate the path to these new optima.
Die Natur hat eine Anzahl von Mechanismen entwickelt, mit dieser Problematik umzugehen: lange Entwicklungszeiträume, Rekombinationsverfahren (horizontaler Gentransfer, Crossing- over, Genkonversion, Exon-Rekombination (exon-shuffling) , Virusshuttles, mobile Elemente (Transposons) , Untereinheiten- Struktur von komplexen Proteinen) ) sowie Multigenfamilien mit Pseudogenen.Nature has developed a number of mechanisms to deal with this problem: long development periods, recombination processes (horizontal gene transfer, crossing over, gene conversion, exon recombination (exon shuffling), virus shuttles, mobile elements (transposons), subunit structure of complex proteins)) and multi-gene families with pseudogenes.
Mit der Anzahl der parallel geführten Mutantenbildung und Selektion läßt sich die Chance auf Erzeugung einer ge¬ wünschten Vielfehlermutante erhöhen; durch Rekombination lassen sich mutierte Gensegmente effizient mischen. Funktionslose Pseudogene als Mitglieder einer funktions¬ fähigen Multigenfamilie lassen sich als Vielfehlermutanten auch über längere Entwicklungszeiträume ohne Gegenselektion in ihrer Existenz erhalten, um eventuell bei Rückerhaltung einer Funktion wieder positiv selektierbar zu werden.The number of mutant formation and selection carried out in parallel can increase the chance of generating a desired multi-fault mutant; by recombination, mutated gene segments can be mixed efficiently. Functionless pseudogenes as members of a functional multi-gene family can be maintained as multi-fault mutants even over longer development periods without counter-selection in order to be able to be positively selected again if a function is retained.
Die Übertragung dieser Mechanismen auf eine effiziente in vitro Optimierung ist offensichtlich nicht ohne weiteres möglich. Die Schwierigkeiten müssen jedoch in jedem Falle für solche Aufgabenstellungen gelöst werden, bei denen eine kontinuierliche Optimierung nicht erwartet werden kann. Dies trifft insbesondere für solche -Anpassungsprozesse zu, bei denen eine Funktion vollständig neu etabliert werden muß.The transfer of these mechanisms to an efficient in vitro optimization is obviously not easily possible. In any case, the difficulties must be solved for tasks in which continuous optimization cannot be expected. This is especially true for those adaptation processes in which a function has to be completely re-established.
Das der Erfindung zugrundeliegende technische Problem be¬ trifft die Bereitstellung eines Verfahrens zur Herstellung oligomerer oder polymerer Funktionselemente wie Biopolymere mit funktionalen Eigenschaften, beispielsweise Enzymen, Ribozymen, Wirkstoffen, etc. Dabei soll unter Ausnutzung evolutiver Strategien ein den herkömmlichen Screening-Ver- fahren überlegenes Verfahren bereitgestellt werden.The technical problem on which the invention is based relates to the provision of a process for the production of oligomeric or polymeric functional elements such as biopolymers with functional properties, for example enzymes, ribozymes, active substances, etc. A process superior to conventional screening processes is to be used here using evolutionary strategies to be provided.
Gelöst wird dieses Problem durch ein Verfahren mit den Merkmalen des Anspruchs 1. Die sich daran anschließenden Unteransprüche betreffen bevorzugte Ausführungsformen des erfindungsgemäßen Verfahrens. Erfindungsgemäß werden zur Herstellung oligomerer oder polymerer Funktionselemente aus Formenelementen zunächst Formenelemente durch chemische oder enzymatische Verknüpfung von mindestens zwei Monomeren aufgebaut und die so erhält¬ lichen Formenelemente dann zu Funktionselementen verknüpft. Dabei entspricht die Natur der chemischen Bindung zwischen den Monomeren derjenigen zwischen den jeweiligen Formen¬ elementen. Die so erhältlichen Funktionselemente können dann auf die bestimmten potentiellen Funktionen getestet werden. Die Vorteile der erfindungsgemäßen Vorgehensweise werden durch die nachfolgende Beschreibung weiter verdeutlicht.This problem is solved by a method with the features of claim 1. The subsequent subclaims relate to preferred embodiments of the method according to the invention. According to the invention, for the production of oligomeric or polymeric functional elements from mold elements, mold elements are first built up by chemical or enzymatic linking of at least two monomers, and the mold elements obtainable in this way are then linked to form functional elements. The nature of the chemical bond between the monomers corresponds to that between the respective shaped elements. The functional elements obtainable in this way can then be tested for the specific potential functions. The advantages of the procedure according to the invention are further illustrated by the following description.
Bevorzugt wird die Verknüpfung der Formenelemente unter Einsatz einer festen Phase als Reaktionsträger durchgeführt . Die Verknüpfung der Formenelemente kann chemisch und/oder enzymatisch erfolgen. Die Verknüpfung der Formenelemente zu den Funktionselementen kann entweder planmäßig durch gezielte Zugabe der einzelnen Formenelemente und nachfolgender Ver¬ knüpfung oder auch statistisch durch zufällig gesteuerte Zugabe der Funktionselemente und deren Verknüpfung erfolgen. Es ist dabei möglich, die Verknüpfung schrittweise aufbauend stereospezifisch und/oder gerichtet durchzuführen.The linking of the shaped elements is preferably carried out using a solid phase as a reaction carrier. The linking of the form elements can take place chemically and / or enzymatically. The linking of the form elements to the functional elements can either take place according to plan by adding the individual form elements in a targeted manner and subsequent linking, or else statistically by adding randomly controlled addition of the functional elements and their linking. It is possible to build the link step-by-step in a stereospecific and / or directional manner.
Als Formenelemente kommen vorzugsweise Nucleinsäuren, doppel- strängige oder einzelsträngige DNA und/oder RNA und/oder modifizierte Nucleinsäuren in Frage. Als Formenelemente kommen auch Peptide und/oder Polypeptide und/oder sonstige kopplungsfähige chemische Oligomer-Formenelemente in Frage. Dazu können auch Oligo- oder Polysaccharide gehören.Preferred form elements are nucleic acids, double-stranded or single-stranded DNA and / or RNA and / or modified nucleic acids. Peptides and / or polypeptides and / or other couplable chemical oligomer mold elements are also suitable as mold elements. This can include oligosaccharides or polysaccharides.
In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens werden die Formenelemente als bereits syntheti¬ sierte Oligomerbausteine eingesetzt oder im Reaktionsgefäß quasi in situ hergestellt.In a preferred embodiment of the process according to the invention, the mold elements are used as already synthesized oligomer building blocks or are produced quasi in situ in the reaction vessel.
Es ist vorteilhaft, die Reaktion der Formenelemente in parallel geführten Mikroreaktionsansätzen (wie in P 43 22 147.5 vorgeschlagen) durchzuführen, bei denen die Formen¬ elemente in vorbestimmter Reihenfolge verknüpft werden. Insbesondere werden nach erfolgter Synthese die Reaktions- produkte wie Funktionselemente oder Vorstufen davon an der festen Phase gebunden bleiben und nach Abtrennung der Reaktionspartner weiter verarbeitet oder von der Festphase entkoppelt. Es ist jedoch ebenfalls möglich, die Reaktion in geeigneten, dem Fachmann bekannten Reaktionsbedingungen in Lösung durchzuführen oder die festphasengekoppelte oder in homogener Lösung durchgeführte Reaktion miteinander zu kombinieren.It is advantageous to react the mold elements in parallel microreaction approaches (as in P 43 22 147.5 proposed) in which the shaped elements are linked in a predetermined order. In particular, after the synthesis has taken place, the reaction products, such as functional elements or precursors thereof, remain bound to the solid phase and, after the reaction partners have been separated off, are further processed or decoupled from the solid phase. However, it is also possible to carry out the reaction in suitable reaction conditions known to those skilled in the art or to combine the solid-phase-coupled reaction or a reaction carried out in homogeneous solution.
Durch Einsatz der Fluoreszenzkorrelationsspektroskopie (FCS) (PCT/EP 93/01291) wird es ermöglicht, die Funktionsweise der Funktionselemente im gleichen Volumenelement direkt zu bewerten, in dem auch die Synthese abläuft. Dies bedeutet eine sehr direkte Möglichkeit, das Ergebnis einer aufbauenden Funktionselementsynthese zu kontrollieren.The use of fluorescence correlation spectroscopy (FCS) (PCT / EP 93/01291) makes it possible to directly evaluate the functioning of the functional elements in the same volume element in which the synthesis also takes place. This means a very direct way to control the result of a functional element synthesis.
Vorzugsweise wird pro Reaktionsschritt, bei der schrittweisen Verknüpfung der Formenelement, jeweils ein Formenelement als Reaktionspartner an fester Phase gekoppelt. Es können auch Mischungen von Formenelementen eingesetzt werden und/oder im Reaktionsgefäß direkt generiert werden. Werden als Formen¬ elemente Nucleinsäuren verwendet, so ist es vorteilhaft, wenigstens einen Reaktionspartner mit einer Schnittstelle eines Restriktionsenzym zu versehen oder ein Nucleinsäure- formenelement zu verwenden, welches frei von Start- und/oder Stopcodons ist . Vorzugsweise sind die Reaktionsschnittstellen solche, die von Restriktionsenzymen der Klasse IIS erkannt werden können. Die Einführung von Restriktionsschnittstellen dieser Enzymklasse ist vorteilhaft, da beliebige Sequenzen gerichtet verknüpft werden können, ohne daß die Wahl des Reaktionsenzyτns die Sequenzerfordernisse des Endproduktes beeinfluß . Sind in den zu verknüpfenden Formenelemente einzelsträngige Überhänge eingeführt, so können darüber beliebige Sequenzen gerichtet verknüpft werden, ohne daß dabei irgendwelche Anforderungen an die Sequenz des gewünschten Endproduktes gestellt werden müssen. Dieses Erfordernis kann auch durch selektive und reversible chemische und/oder enzymatische Modifkation der 3'- und/oder 5'-Enden der Nucleinsäuren, zum Beispiel durch Phosphorylierung anstelle und in Kombination mit der Einführung der einzelsträngigen Überhänge erzielt werden.Preferably, one mold element is coupled as a reaction partner to the solid phase for each reaction step in the step-wise connection of the mold element. Mixtures of mold elements can also be used and / or generated directly in the reaction vessel. If nucleic acids are used as shaped elements, it is advantageous to provide at least one reaction partner with an interface of a restriction enzyme or to use a nucleic acid shaped element which is free of start and / or stop codons. The reaction interfaces are preferably those which can be recognized by class IIS restriction enzymes. The introduction of restriction sites of this enzyme class is advantageous since any sequences can be linked in a directed manner without the choice of the reaction enzyme influencing the sequence requirements of the end product. If single-stranded overhangs have been introduced into the shaped elements to be linked, any sequences can be linked in a directed manner without having to make any demands on the sequence of the desired end product. This requirement can also be achieved by selective and reversible chemical and / or enzymatic modification of the 3 'and / or 5' ends of the nucleic acids, for example by phosphorylation instead of and in combination with the introduction of the single-stranded overhangs.
Als Beispiel für eine reversible chemische Modifikation ist das Ankoppeln einer Trityl-Schutzgruppe, die durch Behandlung mit Essigsäure abspaltbar ist, zu nennen. Die Einführung der Tritylgruppe am 3 ' - oder 5'-Ende des Nucleotids führt zur Blockade der Ligation der Formen- und/oder Funktionscodes bzw. -elemente.An example of a reversible chemical modification is the coupling of a trityl protective group which can be split off by treatment with acetic acid. The introduction of the trityl group at the 3 'or 5' end of the nucleotide leads to the blocking of the ligation of the form and / or function codes or elements.
Durch Behandlung eines Oligo- oder Polynucleotids mit Nuclease kann ein 3'- oder 5'-Ende modifiziert werden, zum Beispiel wird durch Behandlung mit Exonuclease III das 3'- Ende durch Abdauung modifiziert. Wenn in das entsprechende Oligo- oder Polynucleotid (z. B. DNA) Nucleotidtriphosphate eingebaut werden, so stoppt die Exonuclease am ersten Thio- Nucleotid die Abdauung. Damit ergibt sich eine regulierbare Modifizierung des Endes des Oligo- oder Polynucleotids.Treatment of an oligonucleotide or polynucleotide with nuclease can modify a 3 'or 5' end, for example treatment of exonuclease III modifies the 3 'end by digestion. If nucleotide triphosphates are incorporated into the corresponding oligo- or polynucleotide (eg DNA), the exonuclease on the first thio-nucleotide stops the digestion. This results in an adjustable modification of the end of the oligonucleotide or polynucleotide.
Das erfindungsgemäße Verfahren erlaubt den Einsatz von Formenelementen, die nach röntgen-kristallographisch analy¬ sierten natürlichen Funktionsdomänen von Proteinen und Polypeptiden bekannt sind. Es können so bereits bekannte Bausteine bzw. Module von in der Natur bereits vorkommenden Funktionselementen benutzt werden.The method according to the invention allows the use of shaped elements which are known from X-ray crystallographically analyzed natural functional domains of proteins and polypeptides. In this way, already known building blocks or modules of functional elements already occurring in nature can be used.
Die zu verwendenden Formenelemente können auch aus Selektionsexperimenten gewonnen werden. Insbesondere vorteilhaft ist die Verwendung von Formenelemen¬ ten in einer Länge von 1 bis 60 Aminosäuren oder Nucleotid- sequenzen entsprechender Kodierungslänge. Die Formenelemente können auch an bestimmten Positionen degeneriert sein und/oder Deletionen oder Insertionen tragen, insbesondere bei Verwendung von Nucleotiden als Formenelemente.The shape elements to be used can also be obtained from selection experiments. The use of form elements with a length of 1 to 60 amino acids or nucleotide sequences of corresponding coding length is particularly advantageous. The shape elements can also be degenerate at certain positions and / or carry deletions or insertions, especially when using nucleotides as shape elements.
Es wird auch die Verwendung des erfindungsgemäßen Verfahrens wie oben beschrieben zur Synthese parallel aufgebauter Formen-Bibliotheken funktionaler Oligomere oder Polymere beansprucht .The use of the method according to the invention as described above for the synthesis of parallel form libraries of functional oligomers or polymers is also claimed.
Die ursprüngliche Aufgabe von "combinatorial libraries" ist eher das Angebot einer Funktionen-Vielfalt als einer Sequenz¬ vielfalt . Es ist heute eine Tatsache, daß die drei¬ dimensionale Struktur von Proteinen relativ stabil gegen Substitutionen einzelner Aminosäuren ist. Durch die große Zahl aufgeklärter Proteinstrukturen gewann man die Er¬ kenntnis, daß Proteine zwar keine oder nur sehr geringe Sequenzhomologie aufweisen können, aber trotzdem die gleiche oder sehr ähnliche 3D-Struktur einnehmen können. Dies beruht möglicherweise darauf, daß nur eine begrenzte Anzahl mög¬ licher Faltungsweisen von Aminosäureketten unter biologischen Bedingungen stabil ist . Strukturelle Verwandtschaft spiegelt aber auch die Evolution rezenter Proteine aus einer relati begrenzten Zahl von Ur-Strukturen, -Modulen heraus wieder. Diese Module können als kleine, funktionelle Domänen ode kompakte Struktureinheiten verstanden werden und können auc in heutigen Genen leicht aufgespürt werden. In der Hypothese des "Exon-shuffling" wird vermutet, daß die Evolution z komplexeren Proteinen gerade durch die Kombination von Exons, also Modulen im oben beschriebenen Sinn enorm beschleunig wurde. Wenn man annimmt, daß die Zahl der Exons, die di Konstruktion aller heute bekannten Proteine erlauben würde, zwischen 1000 und 7000 zu suchen ist, eröffnet eine hier¬ archische Strategie des "Protein Design" mit Bausteine zunehmender Komplexität die Möglichkeit der viel schnellere Durchmessung eines "shape space" mit zugehörigerer "fitness landscape" als es die Suche in einer traditionellen "combinatorial library" gestatten würde. Ein Protein aus 150 Aminosäuren (die Größe einer klassischen Nucleotid- bindungsstelle, der sog. "Rossman fold") müßte nach herkömm¬ lichem Verfahren aus einer Bibliothek von 20150 = 10195 ver¬ schiedenen Aminosäuresequenzen selektiert werden. Kombi¬ nationen von 1000 verschiedenen Modulen der Länge 30 Amino¬ säuren ergeben hingegen nur eine Komplexität von 10005 = 1015 Molekülen.The original task of "combinatorial libraries" is to offer a variety of functions rather than a variety of sequences. It is a fact today that the three-dimensional structure of proteins is relatively stable against substitutions of individual amino acids. The large number of elucidated protein structures gave rise to the knowledge that proteins may have little or no sequence homology, but can still have the same or very similar 3D structure. This may be due to the fact that only a limited number of possible ways of folding amino acid chains is stable under biological conditions. Structural relationships also reflect the evolution of recent proteins from a relatively limited number of original structures and modules. These modules can be understood as small, functional domains or compact structural units and can also be easily found in today's genes. In the hypothesis of "exon shuffling" it is assumed that the evolution of more complex proteins was accelerated enormously by the combination of exons, ie modules in the sense described above. If one assumes that the number of exons that would allow the construction of all proteins known today should be sought between 1000 and 7000, a hierarchical strategy of "protein design" with building blocks of increasing complexity opens up the possibility of much faster Dimensioning of a "shape space" with a corresponding "fitness landscape" than the search in a traditional "combinatorial library" would allow. A protein of 150 amino acids (the size of a classic nucleotide binding site, the so-called "Rossman fold") would have to be selected from a library of 20 150 = 10 195 different amino acid sequences by conventional methods. Combinations of 1000 different modules with a length of 30 amino acids, on the other hand, only result in a complexity of 1000 5 = 10 15 molecules.
Das erfindungsgemäße Verfahren ist ein hierarchisches Ver¬ fahren zum Design von Proteinen, Nucleinsäuren deren Derivaten oder chemischer Oligo- oder Polymere mit bestimmten gewünschten Eigenschaften, ausgehend von Modul-Bibliotheken, im folgenden als Formenelemente bezeichnet. Erfindungsgemäß können die Formenelemente auch Gensegmente sein, die für Formenelemente kodieren. Die als Module fungierenden Formen¬ elemente sollen zufällig kombinierbar sein. Kleinere Proteine oder Untereinheiten für größere Proteine mit bestimmten Eigenschaften werden in einem anschließenden Selektions- schritt aus dem Pool von Modulkombinationen herausgesondert und können ihrerseits wieder als Bausteine in einer Unterein¬ heits-Bibliothek dienen, u.s.w.The method according to the invention is a hierarchical method for the design of proteins, nucleic acids, their derivatives or chemical oligo- or polymers with certain desired properties, starting from module libraries, hereinafter referred to as shape elements. According to the invention, the shape elements can also be gene segments which code for shape elements. The mold elements functioning as modules should be able to be combined at random. Smaller proteins or subunits for larger proteins with certain properties are separated from the pool of module combinations in a subsequent selection step and can in turn serve as building blocks in a subunit library, etc.
Auf jeder Konstruktionsstufe kann durch fehlerhafte Kopierung einzelner Bausteine zusätzlich ein "Rauschen" auf Aminosäure- sequenzebene eingeführt werden. Dies ermöglicht die Modu¬ lierung der dreidimensionalen Anordnung chemischer Gruppen und somit eine weitere funktioneile Optimierung selektierter Moleküle. Die vorgeschlagene Strategie erfordert eine neue Art von "Artificial Gene Assembly" .At each design stage, faulty copying of individual components can also introduce "noise" at the amino acid sequence level. This enables the three-dimensional arrangement of chemical groups to be modulated and thus a further functional optimization of selected molecules. The proposed strategy requires a new type of artificial gene assembly.
Bisher werden vor allem zwei Methoden angewandt, denen gemeinsam ist, daß die DNA in einer bestimmten Orientierung ligiert wird, um damit auch die Abfolge der Aminosäuren festzulegen. Die wohl älteste Methode - von Khorana und seinen Mitarbeitern entwickelt - arbeitet mit überlappend komplementären einzelsträngigen DNA Molekülen, die vor der Ligation miteinander hybridisiert werden. Die zweite Methode nutzt Schnittstellen von Restriktionsenzymen im zu konstruierenden Gen, um an diesen Stellen das Gen in Blöcke zu unterteilen, die dann in mehreren aufeinanderfolgenden Schritten zusammengesetzt werden. Durch beide Methoden wird die Sequenz an den Übergängen der verwendeten Oligo-DNAs bzw. Blöcke methodisch bedingt festgelegt. Dies aber entspricht gerade nicht der Anforderung nach beliebiger Austauschbarkeit der einzelnen Module schon in der Konstruktionsphase des Gens. Bestandteil der vorliegenden Erfindung ist also not¬ wendigerweise auch eine neue Art des "Artificial Gene Assembly" . Erfindungsgemäß wird in allgemeiner Form wie folgt verfahren:So far, two methods have mainly been used, which have in common that the DNA is ligated in a certain orientation in order to determine the sequence of the amino acids. Probably the oldest method - from Khorana and developed by his team - works with overlapping complementary single-stranded DNA molecules that are hybridized with each other before ligation. The second method uses interfaces of restriction enzymes in the gene to be constructed in order to divide the gene into blocks at these locations, which are then assembled in several successive steps. Both methods determine the sequence at the transitions of the oligo-DNAs or blocks used, depending on the method. However, this does not meet the requirement for any interchangeability of the individual modules already in the design phase of the gene. A new type of "artificial gene assembly" is therefore necessarily part of the present invention. The general procedure according to the invention is as follows:
Das Verfahren des "Artificial Gene Assembly" arbeitet analog des in der WO 92/18645 beschriebenen Verfahrens;The "artificial gene assembly" method works analogously to the method described in WO 92/18645;
das Verfahren erschließt nicht den Umgang mit der Varianz im Sequenzraum sondern mit der Varianz im sogenannten Formenraum. Der Formenraum, gebildet aus Basiselementen definierter stabiler Formenelemente, reduziert die Komplexität der Varianten der Bauelemente des Sequenzraumes;the method does not open up dealing with the variance in the sequence space but with the variance in the so-called form space. The mold space, formed from basic elements of defined stable mold elements, reduces the complexity of the variants of the components of the sequence space;
das Verfahren erschließt den Funktionsraum über eine Variation von Bausteinen des Formenraumes;the process opens up the functional space via a variation of building blocks of the mold space;
als Bausteine werden Bausteine des Form-Codes (siehe unten) eingesetzt;blocks of the form code (see below) are used as blocks;
für die Auswahl der Bausteine werden bestimmte Aus¬ wahlkriterien zur Vorselektion eingesetzt, die theoretischen Annahmen entsprechen oder natürlichen Formen-Analoga entsprechen. Als Module zur parallel geführten Variation (Mutation) und Selektion stehen bislang nur die Nucleotide oder Aminosäuren als synthetisch oder enzymatisch handhabbare Bausteine eines Polymers für gerichtete Kopplungsprozesse zur Verfügung. Der direkte Zugang zu einer funktionalen Oberflächenstruktur eines Polymers scheitert wie oben angeführt in vielen Fällen am Problem der großen Zahlen der Varianten des Sequenzraumes .For the selection of the building blocks, certain selection criteria for preselection are used which correspond to theoretical assumptions or correspond to natural form analogues. So far, only the nucleotides or amino acids as synthetically or enzymatically manageable building blocks of a polymer for directed coupling processes are available as modules for parallel variation (mutation) and selection. In many cases, the direct access to a functional surface structure of a polymer fails because of the problem of the large number of variants of the sequence space.
Gegenstand dieses evolutiven Anpassungsprozesses ist der Einsatz modularer Bausteine, dem Formencode, bestehend aus den Formenelementen. Der Formencode umfaßt Formenelemente, aufgebaut aus Elementen des Sequenzraumes. Der Formencode, wie er beispielsweise aus natürlichen Polymeren wie Proteinen, Polypeptiden oder funktionalen Nucleinsäuren abgeleitet werden kann, kodiert unter festgesetzten äußeren Bedingungen stabile Formenelemente (Sekundärstrukturen, eventuell Tertiärstrukturelemente enthaltend) . Dabei ist bemerkenswert, daß sehr unterschiedliche Sequenzen (Primär¬ strukturen) für sehr ähnliche Formenelemente kodieren können. Mit anderen Worten, im Formenraum sehr eng benachbarte Elemente können im Sequenzraum sehr weit voneinander entfernt liegen (große Hamming Distanz) . Das gleiche gilt für den umgekehrten Fall. Im erfindungsgemäßen Sinne erklärt eben diese Eigenschaft, daß bereits der Austausch formenmäßig gleicher Sequenzen im Sequenzraum einen großen Schritt im Sinne einer Vielfehlermutante bedeuten kann. Mit Hilfe der erfindungsgemäßen angesprochenen Syntheseverfahren ist diese Anforderung technisch umsetzbar. Die Erstellung der ent¬ sprechenden Verteilungen gelingt durch programmierte Synthese. Sie ist nicht, wie in WO 92/18645 beschrieben, durch fehlerhafte Replikation im Sinne fehlerbehaftete PCR-Verfahren zu erreichen.The subject of this evolutionary adaptation process is the use of modular components, the shape code, consisting of the shape elements. The form code comprises form elements, built up from elements of the sequence space. The shape code, as can be derived from natural polymers such as proteins, polypeptides or functional nucleic acids, encodes stable shape elements (secondary structures, possibly containing tertiary structure elements) under specified external conditions. It is noteworthy that very different sequences (primary structures) can code for very similar form elements. In other words, elements that are very closely adjacent in the mold space can be very far apart in the sequence space (large Hamming distance). The same applies to the reverse case. In the sense of the invention, this property explains that the exchange of identical sequences in the sequence space can mean a major step in the sense of a multi-fault mutant. This requirement can be implemented technically with the aid of the synthesis methods addressed according to the invention. The corresponding distributions can be created by programmed synthesis. As described in WO 92/18645, it cannot be achieved by faulty replication in the sense of faulty PCR methods.
Bei der linearen Kombination von Formencodes können hetereo- loge wie auch zumindest teilweise homologe Formencode verwendet werden, die genotypisch durch einen Formencod natürlichen oder künstlichen Ursprungs definiert werden. Unter natürlichem Ursprung wird erfindungsgemäß verstanden, daß auf schon vorhandene genetische Informationen zurückge¬ griffen wird, wie sie beispielsweise im Genom von Organismen niedergelegt ist. Unter Formcodes künstlichen Ursprungs wir auf Nucleinsäureebene erfindungsgemäß insbesondere ver¬ standen, daß Sequenzen durch Algorithmen mittels Datenver¬ arbeitungsanlagen generiert werden können, um anschließen nach diesen Anweisungen chemisch synthetisiert zu werden. Schließlich ist auch eine Herstellung durch de novo-Synthese möglich, indem Polymeraεen mit den dazugehörigen Substraten wie Nucleotiden umgesetzt werden. Dabei kann die Polymerase- reaktion matrizenabhängig oder -unabhängig durchgeführt werden.With the linear combination of shape codes, heterologous as well as at least partially homologous shape codes can be used, which are genotypically defined by a shape code of natural or artificial origin. According to the invention, natural origin means that existing genetic information is used, such as that which is stored, for example, in the genome of organisms. According to the invention, shape codes of artificial origin are understood at the nucleic acid level in particular to mean that sequences can be generated by algorithms using data processing systems in order to then be synthesized chemically according to these instructions. Finally, production by de novo synthesis is also possible in that polymerases are reacted with the associated substrates such as nucleotides. The polymerase reaction can be carried out as a function of the template or independently of the template.
Die Formenelemente und Funktionselemente, wie sie gemäß de Erfindung insbesondere verstanden werden, sind beispielsweise in Proteinen oder Peptiden als Phänotypen auffaßbar. Die entsprechenden Genotypen, beispielsweise auf Nucleinsäure¬ ebene, sind dazu die entsprechenden Formen- und Funktions¬ codes. Bleibt man zum Beispiel auf der Nucleinsäureebene so wird der "Phänotyp" mit Funktionselementen und/oder Formen¬ elementen, zum Beispiel durch ein Ribozym verkörpert, welches genotypisch in einer Nucleinsäuresequenz als Formencode und/oder Funktionscode entsprechend reflektiert wird. Dies bedeutet, daß erfindungsgemäß die Begriffe Funktions-/Formen¬ element (Phänotyp) stets quasi als komplementär mit de Begriff Funktions-/Formencode (Genotyp) verstanden werden.The form elements and functional elements, as they are understood in particular according to the invention, can be understood, for example, in proteins or peptides as phenotypes. The corresponding genotypes, for example at the nucleic acid level, are the corresponding form and function codes. If, for example, one stays at the nucleic acid level, the "phenotype" is embodied with functional elements and / or form elements, for example by a ribozyme which is reflected genotypically in a nucleic acid sequence as a form code and / or function code. This means that, according to the invention, the terms function / form element (phenotype) are always understood to be quasi complementary to the term function / form code (genotype).
Die Formenelemente und/oder Funktionselemente bzw. Formen- codes und/oder Funktionscodes können, sofern sie Nuclein¬ säuren sind, durch verschiedene Verfahren gewonnen werden, wie dies weiter oben angegebenen ist, nämlich durch Rückgrif auf schon bekannte Nucleinsäuresequenzen, durch Generierun künstlicher Sequenzen in Datenverarbeitungsanlagen oder durc de novo-Synthese. Die Figur 8 erläutert die Begriff Sequenzraum, Formenraum und Funktionsraum. Analog der betrachteten Beziehung von Formenraum und Sequenzraum gilt für die Beziehung von Formen¬ raum und Funktionsraum, daß eng benachbarte, homologe Ele¬ mente im Formenraum im Funktionsraum weit voneinander ent¬ fernt sein können. Wie in Figur 8 schematisch angedeutet, ist für die Funktion eines Polymers die Geometrie und die physicochemische Topologie und Dynamik der Moleküloberfläche maßgebend, die mit einem zweiten Molekül in Wechselwirkung tritt. Die darunterliegende Struktur, definiert aus dem Formencode, könnte sehr unterschiedlicher chemischer Natur sein. Ähnliche Funktionen im Funktionenraum erklären sich durch ähnliche Grenzflächen-Topologien.The shape elements and / or function elements or shape codes and / or function codes, provided they are nucleic acids, can be obtained by various methods, as indicated above, namely by using already known nucleic acid sequences, by generating artificial sequences in Data processing systems or durc de novo synthesis. FIG. 8 explains the terms sequence space, form space and functional space. Analogously to the relationship between mold space and sequence space, it applies to the relationship between mold space and functional space that closely adjacent, homologous elements in the mold space in the functional space can be far removed from one another. As indicated schematically in FIG. 8, the geometry and the physicochemical topology and dynamics of the molecular surface, which interacts with a second molecule, are decisive for the function of a polymer. The underlying structure, defined from the shape code, could be of very different chemical nature. Similar functions in the functional space can be explained by similar interface topologies.
Gerade im Hinblick auf die in Experimenten realisierbaren relativ kleinen Molekülpopulationen, ist es von ent¬ scheidender Bedeutung, daß die erzeugte Variation im Formen¬ raum in viel effizienterer Weise als etwa die Variation im Sequenzraum die mögliche Funktionenvielfalt im Funktionsraum repräsentiert .With regard to the relatively small molecular populations that can be realized in experiments, it is of crucial importance that the variation in the mold space represents the possible variety of functions in the functional space in a much more efficient manner than, for example, the variation in the sequence space.
Die folgenden Figurenbeschreibungen erläutern an Beispielen schematisch die Erfindung näher.The following description of the figures schematically explains the invention in more detail using examples.
Die Figur 1 betrifft zwei einzelsträngige DNA bzw. RNA- Moleküle, die chemisch oder enzymatisch (z.B. T4 RNA Ligase) ligiert werden, wobei eines der Moleküle über einen spalt¬ baren Linker (z.B. Biotin-Streptavidin) an fester Phase immobilisiert ist, während das andere Molekül frei in Lösung vorliegt .Figure 1 relates to two single-stranded DNA or RNA molecules that are ligated chemically or enzymatically (e.g. T4 RNA ligase), one of the molecules being immobilized on a solid phase via a cleavable linker (e.g. biotin-streptavidin), while the other molecule is free in solution.
Es stehen dazu heute eine ganze Reihe von Festphasen¬ materialien (z.B. magnetische, oberflächenaktivierte Kunst¬ stoffkugeln) zur Verfügung. Dieses Verfahren gestattet de schrittweisen Aufbau von größeren DNAs bzw. RNAs. Nach jede Ligationsschritt werden nicht umgesetzte RNAs weggewasche und die an fester Phase befindlichen Ligationsprodukte i den nächsten Ligationsansatz transferiert. Vorteilhafterweis ist die Handhabung, insbesondere die Reinigung der jeweilige Ligationsprodukte sehr einfach.A whole series of solid phase materials (for example magnetic, surface-activated plastic balls) are available today for this purpose. This method allows the step-by-step construction of larger DNAs or RNAs. After each ligation step, unreacted RNAs are washed away and the solid phase ligation products i transferred the next ligation approach. The handling, in particular the cleaning of the respective ligation products is advantageously very simple.
Nach Abschluß der letzten Ligation wird das Produkt direk als Effektormolekül eingesetzt oder in einer (in vitro) Translationsreaktion zunächst in die entsprechende Protein¬ struktur übersetzt, welche dann als Effektormolekül fungiert.After completion of the last ligation, the product is used directly as an effector molecule or is first translated in an (in vitro) translation reaction into the corresponding protein structure, which then acts as an effector molecule.
Die Figur 2 betrifft zwei vollständig doppelsträngige DNA- Moleküle, die chemisch oder enzymatisch (z.B. T4 DNA Ligase) "blunt end" ligiert werden, wobei eines über einen spaltbare Linker an fester Phase immobilisiert ist, während das ander frei in Lösung vorliegt. Auf diese Weise können schrittweis größere doppelsträngige DNA Moleküle aufgebaut werden. Di gerichtete Ligation wird durch unterschiedliche Phosphory- lierung der Reaktionspartner erreicht. Modul A und das letzt Modul sind so entworfen, daß sie jeweils eine Schnittstell für ein Restriktionsenzym enthalten. Dies ermöglicht ersten die Abspaltung des Produktes von der festen Phase und zweit¬ ens die anschließende, gerichtete Klonierung der DNA (sieh auch Figur 5) .Figure 2 relates to two completely double-stranded DNA molecules that are chemically or enzymatically (e.g. T4 DNA ligase) ligated "blunt end", one being immobilized on a solid phase via a cleavable linker, while the other is freely in solution. In this way, larger double-stranded DNA molecules can be built up step by step. The directed ligation is achieved by different phosphorylation of the reactants. Module A and the last module are designed so that they each contain an interface for a restriction enzyme. This enables first the cleavage of the product from the solid phase and second the subsequent, directed cloning of the DNA (see also FIG. 5).
Zu Figur 3 : DNA-Moleküle können gemäß Figur 2 ebenfall ligiert werden, wenn das in Lösung befindliche Molekül a einer Seite ein einzelsträngiges Ende besitzt, d.h. 'nich vollständig doppelsträngig vorliegt. Dieses Ende steht au diese Weise nicht für die Doppelstrang-spezifische Ligation, z.B. mit T4 DNA Ligase zur Verfügung. In Kombination mit de schon erwähnten Phosphorylierungsstrategien (Figur 2, insbe sondere Variante 1) ergibt sich die Möglichkeit, die Ligatio ohne unerwünschte Nebenprodukte durchzuführen. Das in Lösun befindliche DNA-Molekül kann so entworfen sein, daß es vo seinem einzelsträngigen Ende noch die Schnittstelle eine Restriktionsenzyms vorzugsweise die eines Class IIS Enzym (z.B. Alwl) mit Erkennungsstelle in dem abzuschneidenden teilweise einzelsträngigen DNA-Stück) besitzt. Nach de Ligation kann das Ligationsprodukt an fester Phase mit dem Restriktionsenzym geschnitten werden. Auf diese Weise entsteht wieder ein vollständig doppelsträngiges DNA-Molekül an fester Phase. Alternativ kann das einzelsträngige Ende mit einer Polymerase zum Doppelstrang aufgefüllt oder mit einer Exonuclease abverdaut werden.To 3: 2 DNA molecules can be ligated just case according to when the molecule in solution a one side of a single-stranded end has, that is' Not present fully double-stranded. In this way, this end is not available for double-strand-specific ligation, for example with T4 DNA ligase. In combination with the phosphorylation strategies already mentioned (FIG. 2, in particular variant 1) there is the possibility of performing the ligatio without undesired by-products. The DNA molecule in solution can be designed so that from its single-stranded end it still has the interface of a restriction enzyme, preferably that of a Class IIS enzyme (for example Alwl) with a recognition site in the partially single-stranded DNA piece to be cut off. According to de In ligation, the solid phase ligation product can be cut with the restriction enzyme. In this way, a completely double-stranded DNA molecule is formed on the solid phase. Alternatively, the single-stranded end can be filled up to the double strand with a polymerase or digested with an exonuclease.
Zu Figur 4 : Restriktionsschnittstellen können (überlappend) auch entstehen, indem zwei doppelsträngige DNA-Moleküle miteinander ligiert werden.Regarding Figure 4: Restriction interfaces can also arise (overlapping) by ligating two double-stranded DNA molecules together.
Zu Figur 5: Vollständig oder teilweise doppelsträngige DNA-Moleküle können gemäß Figuren 1 - 4 ligiert werden, auch wenn Mischungen von Molekülen (z. B. B, C, D) verwendet werden. Auf diese Weise entstehen Mischungen von immobi¬ lisierten Molekülen, die jeweils verschiedenen Kombinationen der eingesetzten Bausteine entsprechen. Am Ende des letzten Ligationsschrittes kann die Gesamt-DNA oder ein Teil davon mit Hilfe von Restriktionsenzymen, die innerhalb des Kon- struktes schneiden, von der festen Phase abgespalten und ggf. in ein Phagen- oder Bakteriendisplay-System kloniert werden, die DNA kann aber auch in einem kombinierten in vitro Trans¬ kriptions- und Translationssystem exprimiert werden.Regarding FIG. 5: Completely or partially double-stranded DNA molecules can be ligated according to FIGS. 1-4, even if mixtures of molecules (eg B, C, D) are used. In this way, mixtures of immobilized molecules are formed, each of which corresponds to different combinations of the building blocks used. At the end of the last ligation step, all or part of the DNA can be cleaved from the solid phase using restriction enzymes that cut within the construct and, if necessary, cloned into a phage or bacterial display system, but the DNA can can also be expressed in a combined in vitro transcription and translation system.
Zu Figur 6: Ausgehend von Modul-Bibliotheken können Peptide, Proteindomänen und kleine Proteine durch zufällige Kom¬ bination von einzelnen Modulen erzeugt werden. Entsprechend einem hierarchischen Verfahren zum Proteindesign können in einer weiteren Stufe dann auch Proteindomänen als Bausteine kombiniert werden. Auf jeder Komplexitätsstufe können Mutationen eingefügt werden, die - ohne die globale Struktur zu verändern - eine Feinabstimmung der dreidimensionalen An¬ ordnung chemischer Gruppen erlauben.6: Starting from module libraries, peptides, protein domains and small proteins can be generated by random combination of individual modules. According to a hierarchical method for protein design, protein domains can then also be combined as building blocks in a further stage. At any level of complexity, mutations can be inserted which - without changing the global structure - allow fine-tuning of the three-dimensional arrangement of chemical groups.
Figur 7 erläutert schematisch, daß verschiedene Proteine trotz unterschiedlicher, katalytisch aktiver Aminosäuren im aktiven Zentrum in Bezug auf das Substrat homologe Funktionen besitzen (Chymotrypsin/Trypsin) oder trotz ähnlicher räum¬ licher Anordnung der Aminosäuren im aktiven Zentrum gänzlich unterschiedliche Reaktionen katalysieren (Trypsin/Elastase) können.FIG. 7 schematically explains that different proteins, despite different, catalytically active amino acids in the active center, have homologous functions with respect to the substrate possess (chymotrypsin / trypsin) or, despite a similar spatial arrangement of the amino acids in the active center, can catalyze completely different reactions (trypsin / elastase).
Figur 8 erläutert den Zusammenhang der Begriffe Sequenzraum- Formenraum-Funktionsraum.FIG. 8 explains the relationship between the terms sequence space, form space and functional space.
Fig. 9 - 11Figures 9-11
Oligomere oder Polymere werden durch matrizenabhängige, enzymatische oder chemische Synthese durch Verlängerung von stochastischen (randomisierten) oder ausgewählten (kon¬ struierten) Primer-Molekülen hergestellt. Die Primer können komplementär zu 1.) diskreten Sequenzen ausschließlich am Ende des ursprünglichen Matrizen-Moleküls (Figur 9/10) diskreten Sequenzen überall im ursprünglichen Matrizen- Molekül sein (Figur 10/11) aus einer Mischung von Zufalls¬ sequenzen bestehen, die die Synthese je nach (teilweiser) Komplementarität zufällig an vielen Stellen beginnen lassen (Fig. 10) .Oligomers or polymers are produced by matrix-dependent, enzymatic or chemical synthesis by extending stochastic (randomized) or selected (designed) primer molecules. The primers can be complementary to 1.) discrete sequences exclusively at the end of the original template molecule (FIG. 9/10). Discrete sequences anywhere in the original template molecule (FIG. 10/11) consist of a mixture of random sequences which consist of the Depending on the (partial) complementarity, let the synthesis start randomly at many places (Fig. 10).
Entweder die Primer oder, wie in der Figur gezeigt, auch die Matrizen-DNA können zur Vereinfachung späterer Aufreinigungs- prozeduren biotinyliert sein. Dies würde insbesondere bei der Strangtrennung (z. B. an Streptavidin-Dynabeads) zur Aufreinigung der verlängerten Primer günstig sein.Either the primers or, as shown in the figure, also the template DNA can be biotinylated to simplify later purification procedures. This would be particularly advantageous for strand separation (e.g. on streptavidin-Dynabeads) for the purification of the extended primers.
Fig. 12Fig. 12
Statt normaler dNTPs (Desoxy-Nucleosidtriphosphate) werden insbesondere thio-NTPs eingesetzt. Kettenabbruchmoleküle können dann zum Beispiel normale ddNTPs (Didesoxy-Nucleosid- triphosphate) sein. Es ist bekannt, daß Phosphodiester- bindungen leicht durch Exonuclease III in 50 mM Tris/HCl, 5 mM MgCl2, bei pH 10,0 spezifisch in Minuten gespalten werden können. Thiophosphat-Bindungen werden dagegen nicht gespalten (Labeit et al . , DNA 5:173, 1986) . Auf diese Weise kann man nach Inaktivierung der Polymerase die Enden der entstandenen Polymere durch enzymatisches Entfernen der ddNTPs "entschützen" .Instead of normal dNTPs (deoxy-nucleoside triphosphates), thio-NTPs in particular are used. Chain termination molecules can then be, for example, normal ddNTPs (dideoxy nucleoside triphosphates). It is known that phosphodiester bonds can easily be cleaved specifically in minutes by exonuclease III in 50 mM Tris / HCl, 5 mM MgCl 2 , at pH 10.0. In contrast, thiophosphate bonds are not cleaved (Labeit et al., DNA 5: 173, 1986). In this way, the ends of the "Deprotect the resulting polymers by enzymatic removal of the ddNTPs.
Fig. 13Fig. 13
Die entstandenen und entschützten Polymere können entweder thermisch oder chemisch, z. B. mit NaOH, getrennt werden, wobei sich die Biotin-gekoppelten Moleküle z. B. an Streptavidin-Dynabeads abtrennen lassen. Nach Einstellen physiologischer Bedingungen hybridisieren die entschützten Polymere zu teilweise überlappenden Duplices.The resulting and deprotected polymers can be either thermally or chemically, e.g. B. with NaOH, separated, the biotin-coupled molecules z. B. on streptavidin-Dynabeads. After physiological conditions have been set, the deprotected polymers hybridize to partially overlapping duplexes.
Fig. 14Fig. 14
PCR ohne Primer führt zur eigentlichen (Re-) Kombination der Polymere und zur weiteren Verlängerung derselben. Nachdem die teilweise überlappenden Duplices vervollständigt wurden, findet eine weitere PCR mit (endständigen) Primern Staat, die wieder Produkte der ursprünglichen Länge erzeugt. Darunter befinden sich auch solche Sequenzen, in denen mehrere Marker vereinigt, neu kombiniert sind.PCR without a primer leads to the actual (re) combination of the polymers and to a further extension of the same. After the partially overlapping duplexes have been completed, another PCR with (terminal) primers finds state, which again produces products of the original length. These include sequences in which several markers are combined and newly combined.
Der Sequenzraum ist durch die linearen Nachbarschafts¬ beziehungen der Polymer-Bauelemente einer Polymerstruktur definiert. Homologien beschreiben Ähnlichkeiten (in %) in der Abfolge der Bauelemente einer chemischen Stoffklasse. Je höher der Verwandtschaftsgrad zweier Sequenzen desto geringer der Abstand im Sequenzraum.The sequence space is defined by the linear neighborhood relationships of the polymer components of a polymer structure. Homologies describe similarities (in%) in the sequence of the components of a chemical substance class. The higher the degree of relationship between two sequences, the smaller the distance in the sequence space.
a) ... AATAATGCGCAATATTAGGCCT... b) ... AATAAAAAGCAATATTAAGCCT... c) ... TTAGCTAGCGATGCGCGCCGGG ...a) ... AATAATGCGCAATATTAGGCCT ... b) ... AATAAAAAGCAATATTAAGCCT ... c) ... TTAGCTAGCGATGCGCGCCGGG ...
Zum Beispiel weisen die Sequenzen a) und b) eine erhebliche Homologie auf, während Sequenz c) keinerlei Ähnlichkeiten mit a) und b) zeigt.For example, sequences a) and b) show considerable homology, while sequence c) shows no similarities with a) and b).
Der Formenraum ist definiert durch die "räumlichen" Nach¬ bai rhaftsbeziehungen der durch ihn repräsentierten Polymere. Der Abstand zweier Sequenzen ist durch den Verwandtschafts¬ grad ihrer Strukturen bestimmt. Homologie bedeutet hier Ähnlichkeit der Gesamtstrukturen von Polymeren, die wiederum aus chemisch verknüpften Bauelementen bestehen. Im Formenraum benachbarte Moleküle können im Sequenzraum durchaus weit voneinander entfernt liegen und umgekehrt. [Analog s. o. : Struktur a) 3 alpha-Helices, Struktur b) 2 Alpha-Helices plus unstrukturierter Bereich mit endständiger, kurzer Helix, c) antiparalleles beta-Faltblatt aus 4 Blättern] Der Funktionen¬ raum ist definiert durch die geometrische, dynamische und physikalisch/chemische Oberflächenstruktur, die mit einem weiteren Molekül in spezifische Wechselwirkung treten kann. Homologien beschreiben Ähnlichkeiten der Oberflächenstruktur und den damit verbundenen Wechselwirkungseigenschaften.The mold space is defined by the "spatial" neighboring relationships of the polymers represented by it. The distance between two sequences is determined by the degree of relationship between their structures. Homology here means similarity of the overall structures of polymers, which in turn consist of chemically linked components. Molecules adjacent in the mold space can be far apart in the sequence space and vice versa. [Analogous to this: structure a) 3 alpha helices, structure b) 2 alpha helices plus unstructured area with terminal, short helix, c) antiparallel beta sheet from 4 sheets] The functional space is defined by the geometric, dynamic and physical / chemical surface structure that can interact with another molecule. Homologies describe similarities in the surface structure and the associated interaction properties.
Im folgenden werden lineare Kombinationen von Formencodes über in vitro Rekombination von Formencodes aus natürlichen oder in vitro hergestellten Muteinen beschrieben.Linear combinations of shape codes via in vitro recombination of shape codes from natural or in vitro produced muteins are described below.
Bei der linearen Kombination von Formencodes können hetero- loge wie auch zumindest teilweise homologe Formencodes verwendet werden. Sequenzhomologe For encodes können zufällig in einer zu rekombinierenden Mischung vorhanden sein oder bewußt ausgewählt werden. Diese Mischung kann beispielsweise, wie bei Eigen & Henco WO 92/18645 beschrieben, homolog auseinander hervorgegangene Mutantenkollektive einer Aus- gangssequenz, oder homologe Gene verwandter oder unterschied¬ licher Organismen enthalten. Dabei können ähnliche Sequenzen, z. B. bezüglich ihrer Funktionscodes, sehr unterschiedlich sein.With the linear combination of shape codes, heterologous as well as at least partially homologous shape codes can be used. Sequence homologs for encodes can be randomly present in a mixture to be recombined or can be deliberately selected. This mixture can, for example, as described in Eigen & Henco WO 92/18645, contain mutually collective mutant groups of an initial sequence, or homologous genes of related or different organisms. Similar sequences, e.g. B. be very different in terms of their function codes.
Die Natur hat für ein und dieselbe oder sehr ähnliche Reaktionen, für verschiedene Wirtssystem ähnliche oder mole¬ kular unterschiedliche Enzyme evolviert, von denen angenommen werden kann, daß sie für die jeweilige Umgebung, für die sie angepaßt wurden, optimale Lösungen bieten. Dafür ist die Penicillinacylase beispielhaft. Dieses Enzym ist für die industrielle Anwendung im Bereich der Synthese von zentrale Bedeutung. Vor einer Synthese halbsynthetischer Derivate de Penicillin-Grundköpers muß in natürlicher Weise synthe tisiertes Penicillin zunächst schonend einer Acylase-Reaktio unterworfen werden, bevor es in einer Umkehrung des Prozesse wiederum mit künstlichen Derivaten reacyliert werden kann. Für beide Reaktionen kann die Penicillinacylase eingesetz werden. Für diese Reaktion sind bestimmte Reaktions bedingungen und Substrate erwünscht . Diese Bedingunge unterscheiden sich jedoch von der in vivo Situation de Mikroorganismus, aus dem jeweils Penicillinacylasen isolier wurden. Dies trifft zum Beispiel auf die optimale Lage de Gleichgewichtes für das acylierte Syntheseprodukt oder fü die hydrolytische Spaltung zu. Es ist gewünscht, das Enzy bezogen auf die Umsatzzahl unter den industriell am beste geeigneten Bedingungen zu optimieren.Nature has developed similar or molecularly different enzymes for one and the same or very similar reactions, for different host systems, which enzymes can be assumed to offer optimal solutions for the particular environment for which they were adapted. Penicillin acylase is an example of this. This enzyme is for that industrial application in the field of synthesis of central importance. Before a synthesis of semi-synthetic derivatives of the basic penicillin body, synthetic penicillin must first be gently subjected to an acylase reaction before it can be reactivated with artificial derivatives in a process reversal. Penicillin acylase can be used for both reactions. Certain reaction conditions and substrates are desired for this reaction. However, these conditions differ from the in vivo situation of the microorganism from which penicillin acylases were isolated in each case. This applies, for example, to the optimal position of the equilibrium for the acylated synthesis product or for the hydrolytic cleavage. It is desirable to optimize the enzyme based on the number of sales under the industrially most suitable conditions.
Insbesondere kann von einem Gen einer bestimmten natürlic vorkommenden Acylase ausgegangen und diese konsekutive Mutations- und Selektionszyklen unterworfen werden. Wen verschiedene, aktive Mutanten gefunden sind, lassen sich di als positiv selektierten unterschiedlichen Varianten bezoge auf die jeweils selektierten Punktmutationen über Re kombination ein weiteres Mal durchmischen. Die so z mischenden Varianten können wie in WO 92/18645 beschriebe gewonnen werden. Die Natur verfügt häufig bereits über ein Kollektion von positiv selektierten Muteinen in Form de Enzymgene aus verschiedenen Mikroorganismen, die beispiels weise den gewünschten Reaktionstyp katalysieren. Von diese Kollektionen ausgehend, lassen sich bereits Spektren rekombi nierter Formencodes und Funktionscodes erzeugen, bevo eventuell wieder im weiteren Verlauf Mutations- oder ein Kombination von Mutations-/Rekombinationszyklen durchlaufe werden. Es ist durchaus vorteilhaft, am Anfang eines solche Prozesses von möglichst umfangreichen Formencodes auszugehen deren Mutationen sich in einem bestimmten Kontext des je weiligen Gens als positiv oder neutral erwiesen haben. Die in vitro-Rekombination wird dabei vorzugsweise nach zwei unterschiedlichen Strategien durchgeführt.In particular, one can start from a gene of a certain naturally occurring acylase and subject it to consecutive mutation and selection cycles. Whom different active mutants are found can be mixed again as positive selected different variants related to the selected point mutations via recombination. The variants mixing in this way can be obtained as described in WO 92/18645. Nature often already has a collection of positively selected muteins in the form of enzyme genes from various microorganisms that catalyze the desired type of reaction, for example. Starting from these collections, spectra of recombined form codes and function codes can already be generated, before mutation cycles or a combination of mutation / recombination cycles may be run again in the further course. At the beginning of such a process, it is entirely advantageous to start with the most extensive possible form codes, the mutations of which have proven to be positive or neutral in a specific context of the respective gene. The in vitro recombination is preferably carried out according to two different strategies.
Rekombination kann ein in der Regel unerwünschtes Neben¬ produkt einer Amplifikationsreaktion im Sinne einer PCR- Reaktion sein. Wenn in der Sättigungsphase einer PCR-Reaktion nach dem Durchlaufen vieler Zyklen die Lösung an Reagentien oder Enzym verarmt und die Reaktion unterhalb des Km-Wertes für bestimmte Nucleotidtriphosphate verläuft, kommt es zwangsläufig zu nicht fertiggestellten Syntheseprodukten. Solche Ereignisse sind als unerwünschte Artefakte bereits von Simon Wain-Hobson diskutiert worden, um HIV-Varianten als mögliche Artefakte nach erfolgter PCR-Amplifikation zu beschreiben. Dieser Effekt wird aber erfindungsgemäß einge¬ setzt und gesteuert, insbesondere noch verstärkt, daß wunsch¬ gemäß unvollständig synthetisierte Produkte dominant werden. Wenn gleichzeitig die Primer-induzierte Neusynthese unvoll¬ ständig erfolgt, hybridisieren maßgeblich unvollständige Syntheseprodukte mit vollständig oder ebenfalls unvollständig synthetisierten Gegensträngen. Dabei kommt es zu molekularen Rekombinationsereignissen, bei denen verschiedene Gensegmente im Sinne einer Rekombination von Formencodes miteinander rekombiniert werden.Recombination can be a generally undesirable by-product of an amplification reaction in the sense of a PCR reaction. If, in the saturation phase of a PCR reaction, after many cycles have been run through, the solution becomes depleted of reagents or enzyme and the reaction is below the Km value for certain nucleotide triphosphates, unfinished synthesis products inevitably result. Such events have already been discussed by Simon Wain-Hobson as undesirable artifacts in order to describe HIV variants as possible artifacts after PCR amplification. However, this effect is used and controlled according to the invention, in particular further intensified, that products which are incompletely synthesized as desired become dominant. If at the same time the primer-induced resynthesis is incomplete, significantly incomplete synthesis products hybridize with completely or likewise incompletely synthesized counter-strands. This leads to molecular recombination events in which different gene segments are recombined with one another in the sense of a recombination of shape codes.
Erfindungsgemaß läßt sich nach einer weiteren spezifischen Vorgehensweise die Rekombination während und nicht nur nach einer PCR-Reaktion steuern. Hierbei werden der standard¬ mäßigen PCR-Reaktion kurze Oligomere zugesetzt, die nur dann als PCR-Primer fungieren, wenn die Initiation der Synthese mittels thermostabiler Polymerase bei vergleichsweise tiefen Temperaturen erfolgt. Wann immer die korrekte PCR-Reaktion dominieren soll, wird ein normaler Temperaturzyklus ausge¬ führt. Wenn es zu internen Startreaktionen kommen soll, werden einige Zyklen bei niedriger Temperatur initiiert, eventuell unter Zusatz von Polymerasen wie DNA-Polymerase I, wie sei bei Oligomer-gestarteten Markierungsreaktionen eingesetzt wird (Sambrook, Fritsch, Maniatis, "Molecular cloning") . Die entstehenden unvollständigen Sequenzen können sich bei weiteren A plifikationsrunden zusammenlagern, wobei die überhängenden Enden jeweils am 3'-Ende aufgefüllt werden können. Bei diesen Reaktionen muß gemäß an sich bekannten Reassoziationskinetik von Nucleinsäuren darauf geachtet werden, daß die für eine Rekombination bestimmten Sequenzen in hinreichender Konzentration zur Verfügung stehen, um in wenigen Sekunden bis Minuten die unvollständig gepaarten Duplices auszubilden. Um zu vermeiden, daß bei der matrizen¬ vermittelten Neusynthese unerwünscht eine Strangverdrängung anstelle eines Rekombinationsereignisses stattfindet, werden insbesondere solche Poly erasen verwendet, die keine Strang¬ verdrängung induzieren oder keine 5' -3' -Exonucleaseaktivität aufweisen. Stattdessen lassen sich bevorzugt thermostabile Ligasen einsetzen, so daß Rekombinationsereignisse durch kovalente Verknüpfung der Fragmente fixiert werden.According to the invention, the recombination can be controlled during a further specific procedure and not only after a PCR reaction. Short oligomers are added to the standard PCR reaction, which only act as PCR primers when the synthesis is initiated by means of thermostable polymerase at comparatively low temperatures. Whenever the correct PCR reaction should dominate, a normal temperature cycle is carried out. If internal start reactions are to occur, a few cycles are initiated at low temperature, possibly with the addition of polymerases such as DNA polymerase I, as is used in oligomer-started labeling reactions (Sambrook, Fritsch, Maniatis, "Molecular cloning "). The resulting incomplete sequences can aggregate in further rounds of amplification, the overhanging ends being able to be filled in at the 3 'end. In these reactions, in accordance with known kinetics of association of nucleic acids, care must be taken to ensure that those for recombination Certain sequences are available in sufficient concentration to form the incompletely paired duplexes in a few seconds to minutes ¬ induce displacement or have no 5 '-3' exonuclease activity, instead thermostable ligases can be used instead, so that recombination events are fixed by covalently linking the fragments.
Im erfindungsgemäßen Verfahren zur Rekombination von Formen- codes setzt man Elemente mit zumindest teilweisen Sequenz¬ homologien, wie sie oben beschrieben wurden, ein. Mit Hilfe matrizenabhängiger chemischer oder enzymatischer DNA- oder RNA-Synthese durch Verlängerung von erzeugten (randomi- sierten) Primern oder ausgewählten (konstruierten) Primern wird eine Vielzahl von Fragmenten mindestens einer ursprüng¬ lichen Sequenz erzeugt (s. Fig. 9 - 11) . Ausgewählte Primer mit definierter Sequenz können dabei so positioniert werden, daß bestimmte Bereiche der zu bearbeitenden DNA- ode rRNA- Moleküle, z. B. aktiven Zentren, Endonuclease-spezifische Spaltstellen oder genregulatorische Elemente, vom Rekom¬ binationsprozeß ausgeschlossen sind und somit unverändert erhalten bleiben. Der Einsatz teilweise randomisierter Primer in Bereichen (partieller) Komplementarität analog Mutagani- sierungs-Primern, kann dazu verwendet werden, zusätzlich eine erhöhte Mutationsrate einzuführen. Durch den Einsatz einer kleinen, subinhibitorischen Menge von Kettenabbruchmonomeren, in der DNA-Synthese von vorzugsweise Dideoxynucleotiden, wir ein zufälliger Abbruch der Verlängerungsreaktion und damit eine Längenvarianz der synthetisierten Polymere erreicht. Mittels des Verhältnisses der Konzentration des Abbruch¬ reagenz zu den Konzentrationen der Nucleotidmonomeren läßt sich wie bei einer Sequenzierungsreaktion die durchschnitt¬ liche Kettenlänge des Syntheseproduktes steuern. Nach Ab¬ trennung des polymerisierenden Agenz, beispielsweise einer Inaktivierung des Enzyms, kann die endständige Schutzgruppe, d. h. das Kettenabbruchmonomer ganz oder teilweise wiede abgespalten werden, damit die entstehenden Polymere wieder gute Substrate für die Verlängerungsreaktion sind (Fig. 12) . Die so entschützten DNA- oder RNA-Polymere werden dan mindestens einem Zyklus aus Denaturierung/Hybridisierun teilweise komplementärer Stränge gefolgt von einer Auffüll- reaktion unterzogen. Am Schluß des Verfahrens wird das entstandene Gemisch verlängerter Polymere einer Polymerase- Kettenreaktion unterzogen, wobei die Primer vorzugsweise komplementär zu den Enden der ursprünglich eingesetzte Sequenz liegen sollten. Auf diese Weise entstehen wiede Produkte der ursprünglichen Länge. Diese enthalten jetzt abe Kombinationen von Sequenzabschnitten verschiedener vorteil¬ hafter, bereits selektierter, einzelner Punktionmutatione in sehr effizienter Weise zu kombinieren, statt sie sequentiell in einem stochastischen Prozeß erst erzeugen z müssen In the method according to the invention for the recombination of shape codes, elements with at least partial sequence homologies as described above are used. A large number of fragments of at least one original sequence are generated with the aid of template-dependent chemical or enzymatic DNA or RNA synthesis by extending generated (randomized) primers or selected (constructed) primers (see FIGS. 9-11). Selected primers with a defined sequence can be positioned so that certain areas of the DNA or rRNA molecules to be processed, eg. B. active centers, endonuclease-specific cleavage sites or gene regulatory elements are excluded from the recombination process and thus remain unchanged. The use of partially randomized primers in areas of (partial) complementarity analogous to mutaganization primers can also be used to introduce an increased mutation rate. By using a small, sub-inhibitory amount of chain termination monomers in the DNA synthesis of preferably dideoxynucleotides, we randomly terminate the extension reaction and thus achieved a variance in length of the synthesized polymers. By means of the ratio of the concentration of the termination reagent to the concentrations of the nucleotide monomers, as in a sequencing reaction, the average chain length of the synthesis product can be controlled. After separation of the polymerizing agent, for example inactivation of the enzyme, the terminal protective group, ie the chain termination monomer, can be split off in whole or in part so that the resulting polymers are again good substrates for the extension reaction (FIG. 12). The DNA or RNA polymers deprotected in this way are then subjected to at least one cycle of denaturation / hybridization of partially complementary strands, followed by a replenishment reaction. At the end of the process, the resulting mixture of extended polymers is subjected to a polymerase chain reaction, the primers should preferably be complementary to the ends of the originally used sequence. In this way, products of the original length are created. These now contain a number of combinations of sequence sections of different advantageous, already selected, individual puncture mutations in a very efficient manner, instead of having to generate them sequentially in a stochastic process

Claims

A n s p r ü c h e Expectations
1. Verfahren zur Herstellung oligomerer oder polymerer Funktion¬ selemente aus Formenelementen, wobei die Funktionselemente erhältlich sind durch Verknüpfung von mindestens zwei Formen¬ elementen, von denen mindestens ein Formenelement selbst aus mindestens zwei Monomeren aufgebaut ist, die durch mindestens eine chemische Bindung verknüpft sind, die der chemischen Bindung zwischen zwei Formenelementen entspricht .1. Process for the production of oligomeric or polymeric functional elements from molded elements, the functional elements being obtainable by linking at least two molded elements, of which at least one molded element itself is composed of at least two monomers which are linked by at least one chemical bond, which corresponds to the chemical bond between two form elements.
2. Verfahren gemäß Anspruch 1, wobei die Verknüpfung der Formen¬ elemente unter Einsatz einer festen Phase als Reaktionsträger durchgeführt wird.2. The method according to claim 1, wherein the linking of the mold elements is carried out using a solid phase as a reaction carrier.
3. Verfahren gemäß Anspruch 1 und/oder 2, wobei die Verknüpfung der Formenelemente chemisch und/oder enzymatisch erfolgt .3. The method according to claim 1 and / or 2, wherein the linking of the shaped elements is carried out chemically and / or enzymatically.
4. Verfahren gemäß mindestens einem der Ansprüche 1 - 3 , wobei die Verknüpfung von Formenelementen zu Funktionselemente planmäßig und/oder stochastisch erfolgt.4. The method according to at least one of claims 1-3, wherein the linking of form elements to functional elements takes place according to plan and / or stochastically.
5. Verfahren gemäß mindestens einem der Ansprüche 1 - 4 , wobei die Verknüpfung schrittweise aufbauend, stereospezifisc und/oder gerichtet erfolgt.5. The method according to at least one of claims 1-4, wherein the link is step-by-step, stereospecific and / or directional.
6. Verfahren gemäß mindestens einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, daß die Formenelemente zur Stoff- klasse der Nucleinsäuren, doppelsträngiger und/oder einzel- strängiger DNA und/oder RNA und/oder modifizierten Nuclein¬ säuren und/oder Peptiden und/oder Polypeptiden gehöre und/oder aus sonstigen kopplungsfähigen chemischen Oligomer- Formenelementen aufgebaut sind.6. The method according to at least one of claims 1 to 5, characterized in that the shaped elements to the substance class of the nucleic acids, double-stranded and / or single-stranded DNA and / or RNA and / or modified nucleic acids and / or peptides and / or belong to polypeptides and / or are constructed from other couplable chemical oligomer shaped elements.
7. Verfahren gemäß mindestens einem der Ansprüche 1 - 6, dadurc gekennzeichnet, daß die Formenelemente als bereits synthe tisierte Oligomer-Bausteine eingesetzt werden oder zunächs im Reaktionsgefäß generiert werden. 7. The method according to at least one of claims 1-6, characterized in that the mold elements are used as already synthesized oligomer building blocks or are initially generated in the reaction vessel.
8. Verfahren gemäß mindestens einem der Ansprüche 1 - 7, dadurch gekennzeichnet, daß die Reaktionen in parallel geführten Micro-Reaktionsansätzen durchgeführt werden, bei denen Formenelemente in vorbestimmter Reihenfolge verknüpft werden.8. The method according to at least one of claims 1-7, characterized in that the reactions are carried out in parallel micro-reaction batches in which mold elements are linked in a predetermined order.
9. Verfahren gemäß mindestens einem der Ansprüche 1 - 8, dadurch gekennzeichnet, daß nach erfolgter Synthese die Reaktions¬ produkte, wie Funktionselemente oder Vorstufen davon fest- phasengekoppelt bleiben oder in die lösliche Phase entkoppelt werden.9. The method according to at least one of claims 1-8, characterized in that after the synthesis, the reaction products, such as functional elements or precursors thereof, remain solid-phase-coupled or are decoupled into the soluble phase.
10. Verfahren nach Anspruch 9, wobei die Reaktionsprodukte mit einem biologischen Testsystem vereinigt werden, wobei die Funktion im gleichen Volumenelement wie die Synthese be¬ wertend gemessen wird, z.B. durch den Einsatz der FCS-- Analysetechnik.10. The method according to claim 9, wherein the reaction products are combined with a biological test system, the function being measured in the same volume element as the synthesis, e.g. through the use of FCS analysis technology.
11. Verfahren gemäß mindestens einem der Ansprüche 1 - 10, dadurch gekennzeichnet, daß pro Reaktionsschritt bei der schrittweisen Verknüpfung der Formenelemente jeweils ein Formenelement als Reaktionspartner an fester Phase gekoppelt ist .11. The method according to at least one of claims 1-10, characterized in that for each reaction step in the stepwise linking of the mold elements, a mold element is coupled as a reaction partner to a solid phase.
12. Verfahren gemäß mindestens einem der Ansprüche 1 - 11, dadurch gekennzeichnet, daß Mischungen von Formenelementen eingesetzt werden und/oder generiert werden können.12. The method according to at least one of claims 1-11, characterized in that mixtures of mold elements are used and / or can be generated.
13. Verfahren gemäß mindestens einem der Ansprüche 1 - 12, dadurch gekennzeichnet, daß im Falle des Aufbaues von Nucleinsäure-Formenelementen und/oder der Verknüpfung von Nucleinsäure-Formenelementen wenigstens ein Reaktionspartner eine Schnittstelle für ein Restriktionsenzym enthält und/oder frei von Start- und/ oder Stopcodons ist.13. The method according to at least one of claims 1-12, characterized in that in the case of the construction of nucleic acid form elements and / or the linkage of nucleic acid form elements at least one reaction partner contains an interface for a restriction enzyme and / or free of start and / or stop codons.
14. Verfahren gemäß mindestens einem der Ansprüche 1 - 13, dadurch gekennzeichnet, daß über die Einführung von Restrik- tionsschnittstellen, insbesondere solchen für Enzyme der Klasse IIS beliebige Sequenzen gerichtet verknüpft werden können, ohne daß Sequenzerfordernisse des erwünschten Endpro¬ duktes die Wahl des Reaktionsenzyms beeinflußen.14. The method according to at least one of claims 1-13, characterized in that the introduction of restriction interfaces, in particular those for enzymes Class IIS can be linked to any sequence in a directed manner, without sequence requirements of the desired end product influencing the choice of the reaction enzyme.
15. Verfahren gemäß mindestens einem der Ansprüche 1 - 14, dadurch gekennzeichnet, daß über die Einführung von einzelst¬ rängigen Überhängen und/oder selektive und reversible chemische und/oder enzymatische Modifikation der 3 '-Enden und/oder der 5'-Enden der Nucleinsäuren, zum Beispiel Phosphorylierung, beliebige Sequenzen gerichtet verknüpft werden können, ohne daß dabei irgendwelche Anforderungen an die Sequenz des erwünschten Endproduktes entstehen.15. The method according to at least one of claims 1-14, characterized in that the introduction of single-ranked overhangs and / or selective and reversible chemical and / or enzymatic modification of the 3 'ends and / or the 5' ends of the Nucleic acids, for example phosphorylation, can be linked to any sequence in a directed manner, without any requirements being placed on the sequence of the desired end product.
16. Verfahren gemäß mindestens einem der Ansprüche 1 - 15, dadurch gekennzeichnet, daß Formenelemente nach dem Vorbild röntgenkristallografisch analysierter natürlicher Proteine oder Polypeptide eingesetzt werden.16. The method according to at least one of claims 1-15, characterized in that mold elements are used along the lines of X-ray crystallographically analyzed natural proteins or polypeptides.
17. Verfahren gemäß mindestens einem der Ansprüche 1 - 16, dadurch gekennzeichnet, daß mindestens eines der verwendeten Formenelemente aus Selektionsexperimenten stammt.17. The method according to at least one of claims 1-16, characterized in that at least one of the shape elements used comes from selection experiments.
18. Verfahren gemäß mindestens einem der Ansprüche 1 - 17, dadurch gekennzeichnet, daß die Formenelemente zwischen 1 und 60 Aminosäuren enthalten oder Nucleotide entsprechender Kodierungslänge.18. The method according to at least one of claims 1-17, characterized in that the shaped elements contain between 1 and 60 amino acids or nucleotides of the appropriate coding length.
19. Verfahren gemäß mindestens einem der Ansprüche 1 - 18, dadurch gekennzeichnet, daß Formenelemente eingesetzt werden, die an bestimmten Positionen degeneriert sind und/oder Deletionen oder Insertionen tragen.19. The method according to at least one of claims 1-18, characterized in that mold elements are used which are degenerate at certain positions and / or carry deletions or insertions.
20. Verfahren gemäß einem der Ansprüche 1 bis 19, dadurch gekenn¬ zeichnet, daß die Funktions- und/oder Formenelemente bzw. Funktionscodes und/oder Formencodes als Oligo- oder Poly- nucleotide niedergelegt sind, die erhältlich sind durch Generierung aus Algorithmen, insbesondere evo- lutiver Algorithmen, durch Übernahme oder Modifizierung natürlich vorkommen¬ der Nucleinsäuren und/oder,20. The method according to any one of claims 1 to 19, characterized gekenn¬ characterized in that the functional and / or shape elements or function codes and / or shape codes are deposited as oligo- or polynucleotides that are available by generating from algorithms, in particular evolutionary algorithms, by adopting or modifying naturally occurring nucleic acids and / or,
Generierung mittels de novo Synthese von Oligo-/Poly- nucleotiden durch matrizenabhängige oder -unabhängige Reaktionen von Polymerasen mit Nucleotiden.Generation by means of de novo synthesis of oligo- / polynucleotides through template-dependent or template-independent reactions of polymerases with nucleotides.
21. Verwendung des Verfahrens gemäß mindestens einem der Ansprüche 1 - 20 zur Synthese parallel aufgebauter Formen- Bibliotheken funktionaler Oligomere oder Polymere. 21. Use of the method according to at least one of claims 1-20 for the synthesis of parallel form libraries of functional oligomers or polymers.
PCT/EP1994/004240 1993-12-21 1994-12-20 Process for the evolutive design and synthesis of functional polymers based on designer elements and codes WO1995017413A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DEP4343591.2 1993-12-21
DE19934343591 DE4343591A1 (en) 1993-12-21 1993-12-21 Process for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes

Publications (1)

Publication Number Publication Date
WO1995017413A1 true WO1995017413A1 (en) 1995-06-29

Family

ID=6505604

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1994/004240 WO1995017413A1 (en) 1993-12-21 1994-12-20 Process for the evolutive design and synthesis of functional polymers based on designer elements and codes

Country Status (2)

Country Link
DE (1) DE4343591A1 (en)
WO (1) WO1995017413A1 (en)

Cited By (608)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998005764A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Nucleic acid pool and method for producing the same
WO1998005765A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Double-stranded dna with cohesive end(s), and method of shuffling dna using the same
US5811238A (en) * 1994-02-17 1998-09-22 Affymax Technologies N.V. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
WO1998041622A1 (en) 1997-03-18 1998-09-24 Novo Nordisk A/S Method for constructing a library using dna shuffling
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
DE19800899A1 (en) * 1998-01-13 1999-07-15 Biotecon Ges Fuer Biotechnologische Entwicklung & Consulting Mbh Preparation of oligo-ligands for macromolecules with optionally unknown composition of building blocks
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
WO2000049142A1 (en) * 1999-02-19 2000-08-24 Febit Ferrarius Biotechnology Gmbh Method for producing polymers
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6159688A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods of producing polynucleotide variants
WO2000075368A2 (en) * 1999-06-07 2000-12-14 Sloning Biotechnology Gmbh Method for the synthesis of dna fragments
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6291165B1 (en) 1997-03-18 2001-09-18 Novo Nordisk A/S Shuffling of heterologous DNA sequences
US6303344B1 (en) 1996-12-18 2001-10-16 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
WO2002099091A2 (en) 2001-06-06 2002-12-12 Novozymes A/S Endo-beta-1,4-glucanase from bacillus
EP1411122A1 (en) * 2002-10-18 2004-04-21 Sloning BioTechnology GmbH Method for the manufacture of nucleic acid molecules
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005121351A2 (en) 2004-05-27 2005-12-22 Novozymes, Inc. Methods for transforming and expression screening of filamentous fungal cells with a dna library
WO2006037327A2 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006037328A1 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2006053565A2 (en) 2004-11-19 2006-05-26 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006069289A2 (en) 2004-12-22 2006-06-29 Novozymes North America, Inc Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2006097110A2 (en) 2005-03-18 2006-09-21 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2007023163A1 (en) 2005-08-26 2007-03-01 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2007109441A2 (en) 2006-03-20 2007-09-27 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2008022789A2 (en) 2006-08-23 2008-02-28 Febit Holding Gmbh Programmable oligonucleotide synthesis
WO2008037757A1 (en) 2006-09-29 2008-04-03 Novozymes A/S Xylanases for animal feed
WO2008067423A2 (en) 2006-11-29 2008-06-05 Novozymes, Inc. Methods of improving the introduction of dna into bacterial cells
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2008116878A1 (en) 2007-03-26 2008-10-02 Novozymes A/S Hafnia phytase
EP1982732A2 (en) 2000-02-11 2008-10-22 Maxygen Holdings Ltd. Factor VII or VIIA-like molecules
WO2009037253A2 (en) 2007-09-18 2009-03-26 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2009068554A1 (en) 2007-11-29 2009-06-04 Novozymes A/S Synthase inhibitor screening method
WO2009068565A1 (en) 2007-11-27 2009-06-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2009073709A1 (en) 2007-12-06 2009-06-11 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009147210A1 (en) 2008-06-06 2009-12-10 Novozymes A/S Variants of a family 44 xyloglucanase
EP2133098A1 (en) 2000-01-10 2009-12-16 Maxygen Holdings Ltd G-CSF conjugates
WO2010059413A2 (en) 2008-11-20 2010-05-27 Novozymes, Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US7737088B1 (en) 1998-08-28 2010-06-15 Febit Holding Gmbh Method and device for producing biochemical reaction supporting materials
WO2010068800A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2010070110A2 (en) 2008-12-19 2010-06-24 Novozymes A/S Use of enzymes having silicase activity
WO2010074955A1 (en) 2008-12-16 2010-07-01 Novozymes, Inc. Polypeptides having carboxypeptidase activity and polynucleotides encoding same
WO2010074972A1 (en) 2008-12-15 2010-07-01 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2010077775A1 (en) 2008-12-16 2010-07-08 Novozymes, Inc. Polypeptides having alpha-mannosidase activity and polynucleotides encoding same
EP2210898A1 (en) 2006-11-29 2010-07-28 Novozymes Inc. Bacillus Licheniformis chromosome
WO2010084086A1 (en) 2009-01-21 2010-07-29 Novozymes A/S Polypeptides having esterase activity and nucleic acids encoding the same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088447A1 (en) 2009-01-30 2010-08-05 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010089302A1 (en) 2009-02-06 2010-08-12 University Of Chile Protein and dna sequence encoding a cold adapted xylanase
WO2010091221A1 (en) 2009-02-06 2010-08-12 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
EP2221366A1 (en) 2004-06-29 2010-08-25 Novozymes Inc. Polypeptides having alpha-glucosidase activity and polynucleotides encoding same
WO2010094772A1 (en) 2009-02-20 2010-08-26 Febit Holding Gmbh Synthesis of sequence-verified nucleic acids
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
WO2010106068A1 (en) 2009-03-17 2010-09-23 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
EP2248893A1 (en) 2009-05-06 2010-11-10 Novozymes A/S DFPase Enzymes from Octopus Vulgaris
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2261359A1 (en) 1998-06-10 2010-12-15 Novozymes A/S Mannanases
WO2010151787A1 (en) 2009-06-26 2010-12-29 Novozymes North America, Inc. Heat-stable carbonic anhydrases and their use
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011009747A1 (en) 2009-07-24 2011-01-27 Novozymes A/S Carbohydrate oxidases
WO2011014458A1 (en) 2009-07-28 2011-02-03 Novozymes, Inc. Polypeptides having phytase activity and polynucleotides encoding same
WO2011020910A1 (en) 2009-08-21 2011-02-24 Novozymes A/S Polypeptides having isoamylase activity and polynucleotides encoding same
WO2011028643A1 (en) 2009-09-01 2011-03-10 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
EP2305808A1 (en) 2001-06-20 2011-04-06 Nuevolution A/S Templated molecules and methods for using such molecules
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011051489A2 (en) 2009-10-30 2011-05-05 Novozymes Biopharma Dk A/S Albumin variants
WO2011057086A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP2322630A2 (en) 2004-02-12 2011-05-18 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011066576A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011066560A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011068803A1 (en) 2009-12-01 2011-06-09 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011067335A1 (en) 2009-12-02 2011-06-09 Novozymes A/S Use of defensins for treatment of infective endocarditis
WO2011067349A1 (en) 2009-12-03 2011-06-09 Novozymes A/S Variants of a polypeptide with lipolytic activity and improved stability
WO2011070032A1 (en) 2009-12-11 2011-06-16 Novozymes A/S Arenicin-3 for use in the treatment of urinary tract infections
WO2011070101A1 (en) 2009-12-09 2011-06-16 Novozymes A/S Methods of producing gh8 xylanase variants
WO2011082429A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
WO2011104339A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Variants of a lysozyme and polynucleotides encoding same
WO2011104284A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Polypeptides having antimicrobial activity
WO2011109524A2 (en) 2010-03-03 2011-09-09 Novozymes, Inc. Xylanase variants and polynucleotides encoding same
WO2011120938A2 (en) 2010-03-28 2011-10-06 Novozymes A/S Enzymatic hydroxylation of aliphatic hydrocarbon
WO2011123450A1 (en) 2010-03-31 2011-10-06 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011123505A1 (en) 2010-03-30 2011-10-06 Novozymes North America, Inc. Processes of producing a fermentation product
EP2374877A2 (en) 2006-03-30 2011-10-12 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2011127802A1 (en) 2010-04-14 2011-10-20 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2011153317A1 (en) 2010-06-04 2011-12-08 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
WO2011154525A1 (en) 2010-06-12 2011-12-15 Novozymes A/S Antimicrobial peptide variants and polynucleotides encoding same
EP2399600A1 (en) 2008-07-18 2011-12-28 Novozymes Adenium Biotech A/S Treatment of inflammatory bowel diseases with mammal beta defensins
WO2011163269A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same
WO2011163270A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Methods for improved c4-dicarboxylic acid production in filamentous fungi
WO2012003379A1 (en) 2010-06-30 2012-01-05 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
US8092991B2 (en) 2004-01-23 2012-01-10 Cloning Biotechnology GmbH De novo enzymatic production of nucleic acid molecules
WO2012021396A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof
WO2012022777A1 (en) 2010-08-19 2012-02-23 Novozymes A/S Induced sporulation screening method
WO2012025577A1 (en) 2010-08-24 2012-03-01 Novozymes A/S Heat-stable persephonella carbonic anhydrases and their use
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US8137906B2 (en) 1999-06-07 2012-03-20 Sloning Biotechnology Gmbh Method for the synthesis of DNA fragments
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044915A2 (en) 2010-10-01 2012-04-05 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012042037A1 (en) 2010-10-01 2012-04-05 Novozymes A/S Polypeptides having endopeptidase activity and polynucleotides encoding same
WO2012058566A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same
WO2012058603A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Recombinant n-propanol and isopropanol production
WO2012058293A1 (en) 2010-10-26 2012-05-03 Novozymes North America, Inc. Methods of saccharifying sugarcane trash
WO2012059053A1 (en) 2010-11-04 2012-05-10 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012061517A1 (en) 2010-11-02 2012-05-10 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
WO2012064350A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same
WO2012064351A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012062817A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012078656A1 (en) 2010-12-06 2012-06-14 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
US8202831B2 (en) 2008-06-06 2012-06-19 The Procter & Gamble Company Detergent composition comprising a variant of a family 44 xyloglucanase
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
WO2012103350A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012118848A1 (en) 2011-02-28 2012-09-07 Novozymes, Inc. Microorganism for c4-dicarboxylic acid production
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012127002A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Sweet-tasting polypeptide from gram-positive bacteria
WO2012127001A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Methods for producing secreted polypeptides
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012134626A2 (en) 2011-01-31 2012-10-04 Novozymes North America, Inc. Processes for enzymatic refining of pretreated cellulosic material for saccharification
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012149192A1 (en) 2011-04-28 2012-11-01 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012150319A1 (en) 2011-05-05 2012-11-08 Novozymes Biopharma Dk A/S Albumin variants
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012159007A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
EP2527432A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP2540824A1 (en) 2011-06-30 2013-01-02 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013001078A1 (en) 2011-06-30 2013-01-03 Novozymes A/S Alpha-amylase variants
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
WO2013004639A2 (en) 2011-07-07 2013-01-10 Novozymes A/S Enzymatic preparation of diols
WO2013006756A2 (en) 2011-07-06 2013-01-10 Novozymes A/S Alpha amylase variants and polynucleotides encoding same
WO2013007596A2 (en) 2011-07-08 2013-01-17 Novozymes A/S Oral treatment of inflammatory bowel disease
WO2013010783A1 (en) 2011-07-15 2013-01-24 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013016115A1 (en) 2011-07-22 2013-01-31 Novozymes North America, Inc. Processes for pretreating cellulosic material and improving hydrolysis thereof
WO2013019780A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013019827A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2013021065A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021062A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021060A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021059A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021061A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021064A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021063A2 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026794A1 (en) 2011-08-19 2013-02-28 Novozymes Novel immunomodulatory peptide
WO2013028512A1 (en) 2011-08-19 2013-02-28 Novozymes, Inc. Recombinant microorganisms for production c4-dicarboxylic acids
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013029496A1 (en) 2011-08-26 2013-03-07 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2013036526A1 (en) 2011-09-06 2013-03-14 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013034106A1 (en) 2011-09-09 2013-03-14 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013036898A2 (en) 2011-09-09 2013-03-14 Novozymes A/S Improving properties of paper materials
WO2013039776A1 (en) 2011-09-13 2013-03-21 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013040991A1 (en) 2011-09-23 2013-03-28 Novozymes A/S Color modification of textile
WO2013049073A1 (en) 2011-09-30 2013-04-04 Novozymes, Inc. Dehydrogenase variants and polynucleotides encoding same
WO2013044867A1 (en) 2011-09-30 2013-04-04 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013053801A1 (en) 2011-10-11 2013-04-18 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013057143A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013057141A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013064195A1 (en) 2011-11-04 2013-05-10 Enel Ingegneria E Ricerca S.P.A. A new heat-stable carbonic anhydrase and uses thereof
WO2013064075A1 (en) 2011-10-31 2013-05-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013068309A1 (en) 2011-11-08 2013-05-16 Novozymes A/S Methods for production of archeae protease in yeast
WO2013074956A2 (en) 2011-11-18 2013-05-23 Novozymes, Inc. Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2013076259A2 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013075644A1 (en) 2011-11-22 2013-05-30 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013079531A2 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013079015A1 (en) 2011-12-01 2013-06-06 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079533A1 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013096603A2 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013091547A1 (en) 2011-12-19 2013-06-27 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
EP2623586A2 (en) 2012-02-03 2013-08-07 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
WO2013113622A1 (en) 2012-02-03 2013-08-08 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013123871A1 (en) 2012-02-20 2013-08-29 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013135896A1 (en) 2012-03-16 2013-09-19 Novozymes Biopharma Dk A/S Albumin variants
WO2013144105A1 (en) 2012-03-31 2013-10-03 Novozymes A/S Epoxidation using peroxygenase
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013160370A1 (en) 2012-04-25 2013-10-31 Novozymes A/S Method of baking
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013160247A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013173711A1 (en) 2012-05-18 2013-11-21 Novozymes A/S Bacterial mutants with improved transformation efficiency
WO2013178699A1 (en) 2012-05-31 2013-12-05 Novozymes A/S Isopropanol production by bacterial hosts
WO2013178808A2 (en) 2012-05-31 2013-12-05 Novozymes A/S Polypeptides having organophosphorous hydrolase activity
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2014009473A1 (en) 2012-07-12 2014-01-16 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
WO2014015256A2 (en) 2012-07-20 2014-01-23 Novozymes A/S Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof
WO2014012506A1 (en) 2012-07-18 2014-01-23 Novozymes A/S Method of treating polyester textile
WO2014027062A1 (en) 2012-08-17 2014-02-20 Novozymes A/S Thermostable asparaginase variants and polynucleotides encoding same
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014037438A1 (en) 2012-09-05 2014-03-13 Novozymes A/S Polypeptides having protease activity
WO2014052630A1 (en) 2012-09-27 2014-04-03 Novozymes, Inc. Bacterial mutants with improved transformation efficiency
WO2014053594A1 (en) 2012-10-05 2014-04-10 Novozymes A/S Preventing adhesion of bacteria
WO2014056919A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056917A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056921A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056916A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056920A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056922A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014058896A1 (en) 2012-10-08 2014-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014056927A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014066141A2 (en) 2012-10-24 2014-05-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014068010A1 (en) 2012-10-31 2014-05-08 Novozymes A/S Isopropanol production by bacterial hosts
WO2014076232A2 (en) 2012-11-19 2014-05-22 Novozymes A/S Isopropanol production by recombinant hosts using an hmg-coa intermediate
WO2014085330A1 (en) 2012-11-30 2014-06-05 Novozymes, Inc. 3-hydroxypropionic acid production by recombinant yeasts
EP2740840A1 (en) 2012-12-07 2014-06-11 Novozymes A/S Improving drainage of paper pulp
WO2014086706A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Method for generating site-specific mutations in filamentous fungi
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014090161A1 (en) 2012-12-11 2014-06-19 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2014092832A2 (en) 2012-09-19 2014-06-19 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
WO2014099653A1 (en) 2012-12-17 2014-06-26 Novozymes A/S Alpha-amylases and polynucleotides encoding same
WO2014101753A1 (en) 2012-12-24 2014-07-03 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2014122109A1 (en) 2013-02-05 2014-08-14 Novozymes A/S Enzymatic preparation of indigo dyes and intermediates
WO2014122161A2 (en) 2013-02-06 2014-08-14 Novozymes A/S Polypeptides having protease activity
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2014147219A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides having phospholipase a activity and polynucleotides encoding same
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014170218A1 (en) 2013-04-18 2014-10-23 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2014177541A2 (en) 2013-04-30 2014-11-06 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2014182990A1 (en) 2013-05-10 2014-11-13 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
WO2014202793A1 (en) 2013-06-21 2014-12-24 Novozymes A/S Production of polypeptides without secretion signal in bacillus
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015007639A1 (en) 2013-07-17 2015-01-22 Novozymes A/S Pullulanase chimeras and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
WO2015017721A1 (en) 2013-07-31 2015-02-05 Novozymes A/S 3-hydroxypropionic acid production by recombinant yeasts expressing an insect aspartate 1-decarboxylase
WO2015022429A1 (en) 2013-08-15 2015-02-19 Novozymes A/S Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
WO2015059133A1 (en) 2013-10-22 2015-04-30 Novozymes A/S Cellobiose dehydrogenase variants and polynucleotides encoding same
EP2876156A1 (en) 2013-11-26 2015-05-27 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof
WO2015079064A2 (en) 2013-11-29 2015-06-04 Novozymes A/S Peroxygenase variants
WO2015085920A1 (en) 2013-12-11 2015-06-18 Novozymes A/S Cutinase variants and polynucleotides encoding same
EP2886656A1 (en) 2013-12-18 2015-06-24 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
WO2015109972A1 (en) 2014-01-22 2015-07-30 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
US9115352B2 (en) 2008-03-31 2015-08-25 Sloning Biotechnology Gmbh Method for the preparation of a nucleic acid library
WO2015143144A1 (en) 2014-03-19 2015-09-24 Novozymes A/S Method for enhancing activity of an x143 polypeptide
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
WO2015158237A1 (en) 2014-04-15 2015-10-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015158800A1 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell for expressing proteins of interest
WO2015158808A2 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell engineered to overexpress helper proteins
WO2015173426A1 (en) 2014-05-15 2015-11-19 Novozymes A/S Compositions comprising polypeptides having phospholipase c activity and use thereof
WO2015183710A1 (en) 2014-05-30 2015-12-03 Novozymes A/S Variants of gh family 11 xylanase and polynucleotides encoding same
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
EP2952585A1 (en) 2014-06-04 2015-12-09 Boehringer Ingelheim RCV GmbH & Co KG Improved protein production in fungi or yeasts
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015200659A1 (en) 2014-06-25 2015-12-30 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
WO2016028999A1 (en) 2014-08-20 2016-02-25 Novozymes A/S Xyloglucan endotransglycosylase variants and polynucleotides encoding same
WO2016037096A1 (en) 2014-09-05 2016-03-10 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
US9295965B2 (en) 2010-11-12 2016-03-29 Gen9, Inc. Methods and devices for nucleic acid synthesis
WO2016062875A2 (en) 2014-10-23 2016-04-28 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2016073610A1 (en) 2014-11-07 2016-05-12 Novozymes A/S Xylanase based bleach boosting
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016090059A1 (en) 2014-12-02 2016-06-09 Novozymes A/S Laccase variants and polynucleotides encoding same
WO2016087327A1 (en) 2014-12-01 2016-06-09 Novozymes A/S Polypeptides having pullulanase activity comprising the x25, x45 and cbm41 domains
WO2016100910A1 (en) 2014-12-19 2016-06-23 Novozymes A/S Recombinant host cells for the production of 3-hydroxypropionic acid
WO2016095856A1 (en) 2014-12-19 2016-06-23 Novozymes A/S Compositions comprising polypeptides having xylanase activity and polypeptides having arabinofuranosidase activity
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016138315A1 (en) 2015-02-25 2016-09-01 Danisco Us Inc Alpha-glucosidase, compositions & methods
WO2016138303A1 (en) 2015-02-27 2016-09-01 Novozymes A/S Mutant host cells for the production of 3-hydroxypropionic acid
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016146473A1 (en) 2015-03-19 2016-09-22 Novozymes A/S A brewing method
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016180748A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016180792A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants having improved performance and stability
WO2016180749A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016188459A1 (en) 2015-05-27 2016-12-01 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2016193420A1 (en) 2015-06-04 2016-12-08 Novozymes A/S Use of m4 metalloprotease in wort production
WO2016196202A1 (en) 2015-05-29 2016-12-08 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2016205127A1 (en) 2015-06-18 2016-12-22 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
WO2016207384A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Method for producing a coffee extract
WO2016206621A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Biofinishing system
WO2016207373A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Polypeptides having peroxygenase activity
WO2017000922A1 (en) 2015-07-02 2017-01-05 Novozymes A/S Animal feed compositions and uses thereof
WO2017019490A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2017019491A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2017035270A1 (en) 2015-08-24 2017-03-02 Novozymes A/S Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid
WO2017050242A1 (en) 2015-09-22 2017-03-30 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017066255A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017100240A1 (en) 2015-12-07 2017-06-15 Eastman Chemical Company Calb variants
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017140807A1 (en) 2016-02-16 2017-08-24 Monaghan Mushrooms Group Fungal polypeptides having lysozyme activity
WO2017151957A1 (en) 2016-03-02 2017-09-08 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017165760A1 (en) 2016-03-24 2017-09-28 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017186250A1 (en) 2016-04-29 2017-11-02 Defensin Therapeutics Aps Treatment of liver, biliary tract and pancreatic disorders
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
WO2017191160A1 (en) 2016-05-03 2017-11-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
WO2017194487A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
EP3246401A1 (en) 2016-05-20 2017-11-22 Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives New fatty acid decarboxylase and its uses
WO2017202966A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Polypeptides having alpha-galactosidase activity and polynucleotides encoding same
WO2017202979A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Polypeptides having alpha-galactosidase activity and polynucleotides encoding same
WO2017202946A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity
WO2017205535A1 (en) 2016-05-27 2017-11-30 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2017202997A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity
WO2017210188A1 (en) 2016-05-31 2017-12-07 Novozymes A/S Stabilized liquid peroxide compositions
WO2017207762A1 (en) 2016-06-03 2017-12-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2017211803A1 (en) 2016-06-07 2017-12-14 Novozymes A/S Co-expression of heterologous polypeptides to increase yield
WO2018001959A1 (en) 2016-06-30 2018-01-04 Novozymes A/S Lipase variants and compositions comprising surfactant and lipase variant
WO2018002379A2 (en) 2016-07-01 2018-01-04 Novozymes A/S Enzymatic preparation of indigo dyes and in situ dyeing process
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
WO2018007154A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2018007153A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2018007435A1 (en) 2016-07-05 2018-01-11 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
WO2018011277A1 (en) 2016-07-13 2018-01-18 Novozymes A/S Bacillus cibi dnase variants
EP3272862A1 (en) 2011-12-16 2018-01-24 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2018015304A1 (en) 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same
WO2018015444A1 (en) 2016-07-22 2018-01-25 Novozymes A/S Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
WO2018017792A1 (en) 2016-07-20 2018-01-25 Novozymes A/S Heat-stable metagenomic carbonic anhydrases and their use
WO2018015303A1 (en) 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same
WO2018026868A1 (en) 2016-08-01 2018-02-08 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
WO2018037064A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants i
WO2018037062A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018060475A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Spore containing granule
EP3309249A1 (en) 2013-07-29 2018-04-18 Novozymes A/S Protease variants and polynucleotides encoding same
US9957502B2 (en) 2001-11-22 2018-05-01 Sloning Biotechnology Gmbh Nucleic acid synthesis methods
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
WO2018085370A1 (en) 2016-11-02 2018-05-11 Novozymes A/S Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material
EP3321360A2 (en) 2013-01-03 2018-05-16 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2018094181A1 (en) 2016-11-21 2018-05-24 Novozymes A/S Yeast cell extract assisted construction of dna molecules
WO2018098124A1 (en) 2016-11-23 2018-05-31 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2018102348A1 (en) 2016-11-29 2018-06-07 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2018099965A1 (en) 2016-11-30 2018-06-07 Novozymes A/S Method of baking
EP3333258A2 (en) 2011-03-25 2018-06-13 Novozymes A/S Method for degrading or converting cellulosic material
WO2018106792A1 (en) 2016-12-06 2018-06-14 Novozymes A/S Improved processes for production of ethanol from xylose-containing cellulosic substrates using engineered yeast strains
WO2018108971A2 (en) 2016-12-13 2018-06-21 Defensin Therapeutics Aps Methods for treating inflammatory conditions of the lungs
WO2018114973A1 (en) 2016-12-20 2018-06-28 Novozymes A/S Recombinant yeast strains for pentose fermentation
EP3357994A1 (en) 2017-02-01 2018-08-08 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2018141707A2 (en) 2017-02-01 2018-08-09 Novozymes A/S Alpha-amylase variants
WO2018150021A1 (en) 2017-02-20 2018-08-23 Novozymes A/S Lipolytic enzyme for use in baking
EP3372680A1 (en) 2013-04-30 2018-09-12 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2018164737A1 (en) 2017-03-07 2018-09-13 Danisco Us Inc. Thermostable glucoamylase and methods of use, thereof
US10081807B2 (en) 2012-04-24 2018-09-25 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
WO2018178126A1 (en) 2017-03-29 2018-10-04 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell with altered membrane lipid composition
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018177938A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018178061A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having rnase activity
WO2018185181A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Glycosyl hydrolases
WO2018185150A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptides
WO2018185152A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptide compositions and uses thereof
WO2018191215A1 (en) 2017-04-11 2018-10-18 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2018202846A1 (en) 2017-05-05 2018-11-08 Novozymes A/S Compositions comprising lipase and sulfite
WO2018206300A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018206535A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Carbohydrate-binding domain and polynucleotides encoding the same
WO2018206302A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018220116A1 (en) 2017-05-31 2018-12-06 Novozymes A/S Xylose fermenting yeast strains and processes thereof for ethanol production
WO2018222990A1 (en) 2017-06-02 2018-12-06 Novozymes A/S Improved yeast for ethanol production
WO2018224544A1 (en) 2017-06-08 2018-12-13 Novozymes A/S Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions
EP3415624A1 (en) 2014-01-22 2018-12-19 Novozymes A/S Pullulanase variants and polynucleotides encoding same
WO2018234349A1 (en) 2017-06-20 2018-12-27 Albumedix Ltd Improved protein expression strains
WO2018234465A1 (en) 2017-06-22 2018-12-27 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2019005755A1 (en) 2017-06-28 2019-01-03 Novozymes A/S Polypeptides having trehalase activity and polynucleotides encoding same
WO2019002356A1 (en) 2017-06-30 2019-01-03 Novozymes A/S Enzyme slurry composition
WO2019023222A1 (en) 2017-07-24 2019-01-31 Novozymes A/S Gh5 and gh30 in wet milling
US10202608B2 (en) 2006-08-31 2019-02-12 Gen9, Inc. Iterative nucleic acid assembly using activation of vector-encoded traits
WO2019030165A1 (en) 2017-08-08 2019-02-14 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
WO2019038057A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2019038059A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent compositions comprising gh9 endoglucanase variants ii
WO2019038060A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase variants ii
WO2019038058A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2019042971A1 (en) 2017-08-29 2019-03-07 Novozymes A/S Baker's yeast expressing anti-staling/freshness amylases
WO2019046703A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Methods for improving genome editing in fungi
WO2019043088A1 (en) 2017-08-31 2019-03-07 Novozymes A/S Polypeptides having d-psicose 3-epimerase activity and polynucleotides encoding same
WO2019043191A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Animal feed additives comprising a polypeptide having protease activity and uses thereof
WO2019043189A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Animal feed additives comprising polypeptide having protease activity and uses thereof
EP3453757A1 (en) 2013-12-20 2019-03-13 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2019050754A1 (en) 2017-09-11 2019-03-14 Danisco Us Inc Glucoamylase and methods of use, thereof
US10233228B2 (en) 2010-04-09 2019-03-19 Albumedix Ltd Albumin derivatives and variants
EP3461881A1 (en) 2013-05-03 2019-04-03 Novozymes A/S Microencapsulation of detergent enzymes
WO2019063499A1 (en) 2017-09-27 2019-04-04 Novozymes A/S Lipase variants and microcapsule compositions comprising such lipase variants
WO2019067390A1 (en) 2017-09-27 2019-04-04 The Procter & Gamble Company Detergent compositions comprising lipases
WO2019068713A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019070883A1 (en) 2017-10-04 2019-04-11 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2019068715A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
US10273271B2 (en) 2011-07-15 2019-04-30 The General Hospital Corporation Methods of transcription activator like effector assembly
WO2019084349A1 (en) 2017-10-27 2019-05-02 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
DE102017125560A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE III
WO2019083818A1 (en) 2017-10-23 2019-05-02 Novozymes A/S Improving expression of a protease by co-expression with propeptide
WO2019081724A1 (en) 2017-10-27 2019-05-02 Novozymes A/S Dnase variants
DE102017125558A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANING COMPOSITIONS CONTAINING DISPERSINE I
DE102017125559A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE II
WO2019092201A2 (en) 2017-11-10 2019-05-16 Defensin Therapeutics Aps Maturation of mucosal defense and gut/lung function in the preterm infant
WO2019092042A1 (en) 2017-11-10 2019-05-16 Novozymes A/S Temperature-sensitive cas9 protein
WO2019096903A1 (en) 2017-11-20 2019-05-23 Novozymes A/S New galactanases (ec 3.2.1.89) for use in soy processing
WO2019099235A1 (en) 2017-11-14 2019-05-23 Danisco Us Inc Alpha-amylase, composition and method
WO2019101773A2 (en) 2017-11-24 2019-05-31 Defensin Therapeutics Aps Prevention and treatment of graft-versus-host-disease with defensins
US10308931B2 (en) 2012-03-21 2019-06-04 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
WO2019110462A1 (en) 2017-12-04 2019-06-13 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2019113415A1 (en) 2017-12-08 2019-06-13 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2019113413A1 (en) 2017-12-08 2019-06-13 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2019122083A1 (en) 2017-12-22 2019-06-27 Novozymes A/S Wheat milling process and gh8 xylanases
WO2019125804A1 (en) 2017-12-20 2019-06-27 Basf Se Nucleases and methods for making and using them
WO2019148192A1 (en) 2018-01-29 2019-08-01 Novozymes A/S Microorganisms with improved nitrogen utilization for ethanol production
EP3521434A1 (en) 2014-03-12 2019-08-07 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2019154951A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipases, lipase variants and compositions thereof
WO2019154952A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019168650A1 (en) 2018-02-28 2019-09-06 The Procter & Gamble Company Methods of cleaning
WO2019173424A1 (en) 2018-03-09 2019-09-12 Danisco Us Inc Glucoamylases and methods of use thereof
WO2019175240A1 (en) 2018-03-13 2019-09-19 Novozymes A/S Microencapsulation using amino sugar oligomers
WO2019185726A1 (en) 2018-03-29 2019-10-03 Novozymes A/S Mannanase variants and polynucleotides encoding same
EP3550015A1 (en) 2014-04-10 2019-10-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP3553172A1 (en) 2012-08-16 2019-10-16 Novozymes A/S Method for treating textile with endoglucanase
WO2019197318A1 (en) 2018-04-09 2019-10-17 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2019201783A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019201785A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
US10457935B2 (en) 2010-11-12 2019-10-29 Gen9, Inc. Protein arrays and methods of using and making the same
EP3569611A1 (en) 2013-04-23 2019-11-20 Novozymes A/S Liquid automatic dish washing detergent compositions with stabilised subtilisin
WO2019229228A1 (en) 2018-05-31 2019-12-05 Novozymes A/S Method for treating dissolving pulp using lytic polysaccharide monooxygenase
US10501524B2 (en) 2012-11-08 2019-12-10 Albumedix Ltd Albumin variants
WO2020002575A1 (en) 2018-06-28 2020-01-02 Novozymes A/S Polypeptides having pectin lyase activity and polynucleotides encoding same
WO2020002494A1 (en) 2018-06-27 2020-01-02 Boehringer Ingelheim Rcv Gmbh & Co Kg Means and methods for increased protein expression by use of transcription factors
WO2020010101A2 (en) 2018-07-04 2020-01-09 Danisco Us Inc Glucoamylases and methods of use, thereof
WO2020023411A1 (en) 2018-07-25 2020-01-30 Novozymes A/S Enzyme-expressing yeast for ethanol production
EP3611260A1 (en) 2013-07-29 2020-02-19 Novozymes A/S Protease variants and polynucleotides encoding same
WO2020043836A1 (en) 2018-08-31 2020-03-05 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2020070199A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same
WO2020076697A1 (en) 2018-10-08 2020-04-16 Novozymes A/S Enzyme-expressing yeast for ethanol production
US10633428B2 (en) 2015-08-20 2020-04-28 Albumedix Ltd Albumin variants and conjugates
WO2020092608A1 (en) 2018-10-31 2020-05-07 Novozymes A/S Genome editing by guided endonuclease and single-stranded oligonucleotide
US10676749B2 (en) 2013-02-07 2020-06-09 The General Hospital Corporation Tale transcriptional activators
WO2020123463A1 (en) 2018-12-12 2020-06-18 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2020127796A2 (en) 2018-12-21 2020-06-25 Novozymes A/S Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same
US10711050B2 (en) 2011-11-18 2020-07-14 Albumedix Ltd Variant serum albumin with improved half-life and other properties
EP3690037A1 (en) 2014-12-04 2020-08-05 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2020160126A1 (en) 2019-01-31 2020-08-06 Novozymes A/S Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed
WO2020188095A1 (en) 2019-03-21 2020-09-24 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2020197400A1 (en) 2019-03-27 2020-10-01 Umc Utrecht Holding B.V. Engineered iga antibodies and methods of use
WO2020201403A1 (en) 2019-04-03 2020-10-08 Novozymes A/S Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions
EP3722406A1 (en) 2014-04-11 2020-10-14 Novozymes A/S Detergent composition
WO2020208056A1 (en) 2019-04-12 2020-10-15 Novozymes A/S Stabilized glycoside hydrolase variants
WO2020207944A1 (en) 2019-04-10 2020-10-15 Novozymes A/S Polypeptide variants
EP3739029A1 (en) 2014-07-04 2020-11-18 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2020229191A1 (en) 2019-05-15 2020-11-19 Novozymes A/S Temperature-sensitive rna-guided endonuclease
EP3741849A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
EP3741848A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
WO2020264552A1 (en) 2019-06-24 2020-12-30 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2020260223A1 (en) 2019-06-24 2020-12-30 Novozymes A/S Alpha-amylase variants
WO2021001400A1 (en) 2019-07-02 2021-01-07 Novozymes A/S Lipase variants and compositions thereof
WO2021013464A1 (en) 2019-07-25 2021-01-28 Novozymes A/S Filamentous fungal expression system
WO2021018751A1 (en) 2019-07-26 2021-02-04 Novozymes A/S Enzymatic treatment of paper pulp
WO2021021458A1 (en) 2019-07-26 2021-02-04 Novozymes A/S Microorganisms with improved nitrogen transport for ethanol production
WO2021025872A1 (en) 2019-08-06 2021-02-11 Novozymes A/S Fusion proteins for improved enzyme expression
WO2021032881A1 (en) 2019-08-22 2021-02-25 Basf Se Amylase variants
EP3786269A1 (en) 2013-06-06 2021-03-03 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2021055395A1 (en) 2019-09-16 2021-03-25 Novozymes A/S Polypeptides having beta-glucanase activity and polynucleotides encoding same
WO2021064068A1 (en) 2019-10-03 2021-04-08 Novozymes A/S Polypeptides comprising at least two carbohydrate binding domains
WO2021119304A1 (en) 2019-12-10 2021-06-17 Novozymes A/S Microorganism for improved pentose fermentation
WO2021123307A2 (en) 2019-12-20 2021-06-24 Novozymes A/S Polypeptides having proteolytic activity and use thereof
WO2021127319A1 (en) 2019-12-19 2021-06-24 The Procter & Gamble Company Cleaning compositions comprising polypeptides having alpha amylase activity
WO2021123184A2 (en) 2019-12-19 2021-06-24 Novozymes A/S Alpha-amylase variants
WO2021122867A2 (en) 2019-12-19 2021-06-24 Novozymes A/S Xylanase variants and polynucleotides encoding same
US11072789B2 (en) 2012-06-25 2021-07-27 Gen9, Inc. Methods for nucleic acid assembly and high throughput sequencing
WO2021148278A1 (en) 2020-01-24 2021-07-29 Novozymes A/S Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide
WO2021152120A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021152123A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021163011A2 (en) 2020-02-10 2021-08-19 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2021163030A2 (en) 2020-02-10 2021-08-19 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2021163015A1 (en) 2020-02-10 2021-08-19 Novozymes A/S Process for producing ethanol from raw starch using alpha-amylase variants
EP3872175A1 (en) 2015-06-18 2021-09-01 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2021170559A1 (en) 2020-02-26 2021-09-02 Novozymes A/S Polypeptide variants
EP3878960A1 (en) 2014-07-04 2021-09-15 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2021204838A1 (en) 2020-04-08 2021-10-14 Novozymes A/S Carbohydrate binding module variants
WO2021212095A1 (en) 2020-04-17 2021-10-21 Danisco Us Inc. Glucoamylase and methods of use thereof
WO2021214059A1 (en) 2020-04-21 2021-10-28 Novozymes A/S Cleaning compositions comprising polypeptides having fructan degrading activity
EP3929285A2 (en) 2015-07-01 2021-12-29 Novozymes A/S Methods of reducing odor
EP3950939A2 (en) 2015-07-06 2022-02-09 Novozymes A/S Lipase variants and polynucleotides encoding same
EP3957711A2 (en) 2015-10-28 2022-02-23 Novozymes A/S Detergent composition comprising amylase and protease variants
WO2022037836A1 (en) 2020-08-18 2022-02-24 Novozymes A/S Dispersins expressed with amylase signal peptides
WO2022043321A2 (en) 2020-08-25 2022-03-03 Novozymes A/S Variants of a family 44 xyloglucanase
WO2022043563A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Polyester degrading protease variants
WO2022053706A1 (en) 2020-09-14 2022-03-17 Aesculus Bio Aps Defensin fragment derived lipopeptides for treatment of drug-resistant microorganisms
WO2022074037A2 (en) 2020-10-07 2022-04-14 Novozymes A/S Alpha-amylase variants
WO2022078910A1 (en) 2020-10-13 2022-04-21 Novozymes A/S Glycosyltransferase variants for improved protein production
WO2022090320A1 (en) 2020-10-28 2022-05-05 Novozymes A/S Use of lipoxygenase
WO2022090361A2 (en) 2020-10-29 2022-05-05 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2022090564A1 (en) 2020-11-02 2022-05-05 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2022090555A1 (en) 2020-11-02 2022-05-05 Novozymes A/S Leader peptides and polynucleotides encoding the same
WO2022106404A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of proteases
WO2022106400A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of immunochemically different proteases
WO2022129166A1 (en) 2020-12-15 2022-06-23 Novozymes A/S Mutated host cells with reduced cell motility
WO2022162043A1 (en) 2021-01-28 2022-08-04 Novozymes A/S Lipase with low malodor generation
WO2022171780A2 (en) 2021-02-12 2022-08-18 Novozymes A/S Alpha-amylase variants
EP4047088A1 (en) 2021-02-22 2022-08-24 Basf Se Amylase variants
WO2022175440A1 (en) 2021-02-18 2022-08-25 Novozymes A/S Inactive heme polypeptides
WO2022175435A1 (en) 2021-02-22 2022-08-25 Basf Se Amylase variants
US11441140B2 (en) 2015-12-07 2022-09-13 Henkel Ag & Co. Kgaa Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof
WO2022189521A1 (en) 2021-03-12 2022-09-15 Novozymes A/S Polypeptide variants
EP4060010A2 (en) 2021-03-15 2022-09-21 The Procter & Gamble Company Cleaning compositions containing polypeptide variants
EP4060036A1 (en) 2021-03-15 2022-09-21 Novozymes A/S Polypeptide variants
WO2022194673A1 (en) 2021-03-15 2022-09-22 Novozymes A/S Dnase variants
WO2022199418A1 (en) 2021-03-26 2022-09-29 Novozymes A/S Detergent composition with reduced polymer content
WO2022218863A1 (en) 2021-04-12 2022-10-20 Novozymes A/S Method for producing a meat analogue product
WO2022251056A1 (en) 2021-05-27 2022-12-01 Novozymes A/S Transcriptional regulators and polynucleotides encoding the same
WO2022261003A1 (en) 2021-06-07 2022-12-15 Novozymes A/S Engineered microorganism for improved ethanol fermentation
WO2022263553A1 (en) 2021-06-16 2022-12-22 Novozymes A/S Method for controlling slime in a pulp or paper making process
US11555061B2 (en) 2009-02-11 2023-01-17 Albumedix, Ltd Albumin variants and conjugates
WO2023288294A1 (en) 2021-07-16 2023-01-19 Novozymes A/S Compositions and methods for improving the rainfastness of proteins on plant surfaces
WO2023285348A1 (en) 2021-07-13 2023-01-19 Novozymes A/S Recombinant cutinase expression
EP4163354A2 (en) 2014-03-19 2023-04-12 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2023061928A1 (en) 2021-10-12 2023-04-20 Novozymes A/S Endoglucanase with improved stability
WO2023064905A1 (en) 2021-10-15 2023-04-20 Danisco Us Inc. Glucoamylase variants and methods for use thereof
US11667941B2 (en) 2018-01-12 2023-06-06 Camena Bioscience Limited Compositions and methods for template-free geometric enzymatic nucleic acid synthesis
WO2023104846A1 (en) 2021-12-10 2023-06-15 Novozymes A/S Improved protein production in recombinant bacteria
WO2023118436A1 (en) 2021-12-22 2023-06-29 Novozymes A/S Method of producing a milk-based product
WO2023118565A1 (en) 2021-12-23 2023-06-29 Novozymes A/S Reduction of residual dna in microbial fermentation products
US11702662B2 (en) 2011-08-26 2023-07-18 Gen9, Inc. Compositions and methods for high fidelity assembly of nucleic acids
EP4219702A2 (en) 2015-12-30 2023-08-02 Novozymes A/S Enzyme variants and polynucleotides encoding the same
WO2023152220A1 (en) 2022-02-10 2023-08-17 Novozymes A/S Improved expression of recombinant proteins
WO2023161245A1 (en) 2022-02-22 2023-08-31 Novozymes A/S Oral care composition comprising enzymes
WO2023165507A1 (en) 2022-03-02 2023-09-07 Novozymes A/S Use of xyloglucanase for improvement of sustainability of detergents
EP4242303A1 (en) 2022-03-08 2023-09-13 Novozymes A/S Fusion polypeptides with deamidase inhibitor and deamidase domains
WO2023170177A1 (en) 2022-03-08 2023-09-14 Novozymes A/S Fusion polypeptides with deamidase inhibitor and deamidase domains
EP4273249A2 (en) 2023-07-07 2023-11-08 Novozymes A/S Improved expression of recombinant proteins
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
WO2023222648A2 (en) 2022-05-17 2023-11-23 Novozymes A/S Process for reducing free fatty acids
WO2023247664A2 (en) 2022-06-24 2023-12-28 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2023247514A1 (en) 2022-06-22 2023-12-28 Novozymes A/S Recombinant mannanase expression
WO2023247348A1 (en) 2022-06-21 2023-12-28 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2024003143A1 (en) 2022-06-30 2024-01-04 Novozymes A/S Mutanases and oral care compositions comprising same
WO2024012912A1 (en) 2022-07-15 2024-01-18 Novozymes A/S Polypeptides having deamidase inhibitor activity
US11891631B2 (en) 2012-10-12 2024-02-06 The General Hospital Corporation Transcription activator-like effector (tale) - lysine-specific demethylase 1 (LSD1) fusion proteins
WO2024033133A2 (en) 2022-08-11 2024-02-15 Basf Se Enzyme compositions comprising an amylase
WO2024033134A1 (en) 2022-08-11 2024-02-15 Basf Se Enzyme compositions comprising protease, mannanase, and/or cellulase
EP4339282A2 (en) 2014-12-04 2024-03-20 Novozymes A/S Liquid cleaning compositions comprising protease variants
WO2024056643A1 (en) 2022-09-15 2024-03-21 Novozymes A/S Fungal signal peptides

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19619373A1 (en) * 1996-05-14 1997-11-20 Hoechst Ag New substance library and the resulting supramolecular complexes
US5942609A (en) * 1998-11-12 1999-08-24 The Porkin-Elmer Corporation Ligation assembly and detection of polynucleotides on solid-support
US6479262B1 (en) 2000-05-16 2002-11-12 Hercules, Incorporated Solid phase enzymatic assembly of polynucleotides
WO2016007604A1 (en) 2014-07-09 2016-01-14 Gen9, Inc. Compositions and methods for site-directed dna nicking and cleaving

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990000626A1 (en) * 1988-07-14 1990-01-25 Baylor College Of Medicine Solid phase assembly and reconstruction of biopolymers
WO1992018645A1 (en) * 1991-04-16 1992-10-29 Diagen Institut Für Molekularbiologische Diagnostik Gmbh Method for preparing new biopolymers

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990000626A1 (en) * 1988-07-14 1990-01-25 Baylor College Of Medicine Solid phase assembly and reconstruction of biopolymers
WO1992018645A1 (en) * 1991-04-16 1992-10-29 Diagen Institut Für Molekularbiologische Diagnostik Gmbh Method for preparing new biopolymers

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MUTTER M. ET AL: "The Construction of New Proteins Part III", HELVETICA CHIMICA ACTA, vol. 71, 1988, BASEL CH, pages 835 - 847 *

Cited By (762)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6413774B1 (en) 1994-02-17 2002-07-02 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6291242B1 (en) 1994-02-17 2001-09-18 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US7105297B2 (en) 1994-02-17 2006-09-12 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6180406B1 (en) 1994-02-17 2001-01-30 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5830721A (en) * 1994-02-17 1998-11-03 Affymax Technologies N.V. DNA mutagenesis by random fragmentation and reassembly
US8048674B2 (en) 1994-02-17 2011-11-01 Codexis Mayflower Holdings, Llc Methods and compositions for cellular and metabolic engineering
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6132970A (en) * 1994-02-17 2000-10-17 Maxygen, Inc. Methods of shuffling polynucleotides
US5811238A (en) * 1994-02-17 1998-09-22 Affymax Technologies N.V. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
US6440668B1 (en) 1996-07-09 2002-08-27 Diversa Corporation Method of DNA shuffling with polynucleotides produced by blocking or interrupting a synthesis or amplification process
WO1998005764A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Nucleic acid pool and method for producing the same
WO1998005765A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Double-stranded dna with cohesive end(s), and method of shuffling dna using the same
US6303344B1 (en) 1996-12-18 2001-10-16 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6541207B1 (en) 1997-03-18 2003-04-01 Novozymes A/S Methods for generating recombined polynucleotides
US6159688A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods of producing polynucleotide variants
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6291165B1 (en) 1997-03-18 2001-09-18 Novo Nordisk A/S Shuffling of heterologous DNA sequences
WO1998041622A1 (en) 1997-03-18 1998-09-24 Novo Nordisk A/S Method for constructing a library using dna shuffling
US6368805B1 (en) 1997-03-18 2002-04-09 Novozymes A/S Methods of producing polynucleotide variants
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6177263B1 (en) * 1997-03-25 2001-01-23 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
WO1999036430A1 (en) * 1998-01-13 1999-07-22 BioteCon Gesellschaft für Biotechnologische Entwicklung und Consulting mbH Oligoligands with a binding capacity
DE19800899A1 (en) * 1998-01-13 1999-07-15 Biotecon Ges Fuer Biotechnologische Entwicklung & Consulting Mbh Preparation of oligo-ligands for macromolecules with optionally unknown composition of building blocks
EP2284272A1 (en) 1998-06-10 2011-02-16 Novozymes A/S Mannanases
EP2287318A1 (en) 1998-06-10 2011-02-23 Novozymes A/S Mannanases
EP2261359A1 (en) 1998-06-10 2010-12-15 Novozymes A/S Mannanases
US7737088B1 (en) 1998-08-28 2010-06-15 Febit Holding Gmbh Method and device for producing biochemical reaction supporting materials
US6586211B1 (en) 1999-02-19 2003-07-01 Febit Ferrarius Biotechnology Gmbh Method for producing polymers
US7790369B2 (en) 1999-02-19 2010-09-07 Febit Holding Gmbh Method for producing polymers
EP1728860A1 (en) * 1999-02-19 2006-12-06 febit biotech GmbH Method for producing polymers
US9568839B2 (en) 1999-02-19 2017-02-14 Synthetic Genomics, Inc. Method for producing polymers
WO2000049142A1 (en) * 1999-02-19 2000-08-24 Febit Ferrarius Biotechnology Gmbh Method for producing polymers
WO2000075368A3 (en) * 1999-06-07 2001-05-17 Diavir Gmbh Method for the synthesis of dna fragments
US8137906B2 (en) 1999-06-07 2012-03-20 Sloning Biotechnology Gmbh Method for the synthesis of DNA fragments
JP4756805B2 (en) * 1999-06-07 2011-08-24 スローニング・ビオテヒノロギー・ゲーエムベーハー DNA fragment synthesis method
JP2003501069A (en) * 1999-06-07 2003-01-14 スローニング・ビオテヒノロギー・ゲーエムベーハー Method for synthesizing DNA fragments
WO2000075368A2 (en) * 1999-06-07 2000-12-14 Sloning Biotechnology Gmbh Method for the synthesis of dna fragments
EP2133098A1 (en) 2000-01-10 2009-12-16 Maxygen Holdings Ltd G-CSF conjugates
EP1982732A2 (en) 2000-02-11 2008-10-22 Maxygen Holdings Ltd. Factor VII or VIIA-like molecules
EP2319541A1 (en) 2000-02-11 2011-05-11 Bayer HealthCare LLC Factor VII or VIIA-like conjugates
WO2002099091A2 (en) 2001-06-06 2002-12-12 Novozymes A/S Endo-beta-1,4-glucanase from bacillus
EP2305808A1 (en) 2001-06-20 2011-04-06 Nuevolution A/S Templated molecules and methods for using such molecules
US9957502B2 (en) 2001-11-22 2018-05-01 Sloning Biotechnology Gmbh Nucleic acid synthesis methods
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
EP1411122A1 (en) * 2002-10-18 2004-04-21 Sloning BioTechnology GmbH Method for the manufacture of nucleic acid molecules
WO2004035781A1 (en) * 2002-10-18 2004-04-29 Sloning Biotechnology Gmbh Method for the manufacture of nucleic acid molecules
US7695906B2 (en) 2002-10-18 2010-04-13 Octavian Schatz Method for the manufacture of nucleic acid molecules
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
US8092991B2 (en) 2004-01-23 2012-01-10 Cloning Biotechnology GmbH De novo enzymatic production of nucleic acid molecules
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2314605A1 (en) 2004-01-30 2011-04-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2301958A1 (en) 2004-01-30 2011-03-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305702A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305703A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2308890A1 (en) 2004-01-30 2011-04-13 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2322630A2 (en) 2004-02-12 2011-05-18 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2005121351A2 (en) 2004-05-27 2005-12-22 Novozymes, Inc. Methods for transforming and expression screening of filamentous fungal cells with a dna library
EP2221366A1 (en) 2004-06-29 2010-08-25 Novozymes Inc. Polypeptides having alpha-glucosidase activity and polynucleotides encoding same
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2302042A2 (en) 2004-09-30 2011-03-30 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP2298872A2 (en) 2004-09-30 2011-03-23 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP2295555A2 (en) 2004-09-30 2011-03-16 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encodig same
WO2006037327A2 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006037328A1 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
EP2272964A2 (en) 2004-10-04 2011-01-12 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006053565A2 (en) 2004-11-19 2006-05-26 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006069289A2 (en) 2004-12-22 2006-06-29 Novozymes North America, Inc Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2006097110A2 (en) 2005-03-18 2006-09-21 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
EP2360246A1 (en) 2005-08-16 2011-08-24 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2007023163A1 (en) 2005-08-26 2007-03-01 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2007109441A2 (en) 2006-03-20 2007-09-27 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
EP2336309A2 (en) 2006-03-20 2011-06-22 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
EP2374877A2 (en) 2006-03-30 2011-10-12 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2008022789A2 (en) 2006-08-23 2008-02-28 Febit Holding Gmbh Programmable oligonucleotide synthesis
EP2489671A2 (en) 2006-08-23 2012-08-22 febit holding GmbH Programmable oligonucleotide synthesis
US10202608B2 (en) 2006-08-31 2019-02-12 Gen9, Inc. Iterative nucleic acid assembly using activation of vector-encoded traits
WO2008037757A1 (en) 2006-09-29 2008-04-03 Novozymes A/S Xylanases for animal feed
EP2210898A1 (en) 2006-11-29 2010-07-28 Novozymes Inc. Bacillus Licheniformis chromosome
WO2008067423A2 (en) 2006-11-29 2008-06-05 Novozymes, Inc. Methods of improving the introduction of dna into bacterial cells
WO2008116878A1 (en) 2007-03-26 2008-10-02 Novozymes A/S Hafnia phytase
EP2471911A2 (en) 2007-03-30 2012-07-04 Novozymes A/S Fungal peroxygenases and methods of application
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
WO2009037253A2 (en) 2007-09-18 2009-03-26 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2009068565A1 (en) 2007-11-27 2009-06-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2009068554A1 (en) 2007-11-29 2009-06-04 Novozymes A/S Synthase inhibitor screening method
WO2009073709A1 (en) 2007-12-06 2009-06-11 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2653539A1 (en) 2007-12-19 2013-10-23 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US9115352B2 (en) 2008-03-31 2015-08-25 Sloning Biotechnology Gmbh Method for the preparation of a nucleic acid library
EP3404088A1 (en) 2008-06-06 2018-11-21 The Procter & Gamble Company Detergent composition comprising a variant of a family 44 xyloglucanase
US8202831B2 (en) 2008-06-06 2012-06-19 The Procter & Gamble Company Detergent composition comprising a variant of a family 44 xyloglucanase
WO2009147210A1 (en) 2008-06-06 2009-12-10 Novozymes A/S Variants of a family 44 xyloglucanase
EP2905333A1 (en) 2008-06-06 2015-08-12 Novozymes A/S Variants of a family 44 xylogucanase
EP2674488A1 (en) 2008-06-06 2013-12-18 Novozymes A/S Variants of a family 44 xyloglucanase
US9279010B2 (en) 2008-07-18 2016-03-08 Defensin Therapeutics Aps Treatment of inflammatory bowel diseases with mammal beta defensins
EP2399600A1 (en) 2008-07-18 2011-12-28 Novozymes Adenium Biotech A/S Treatment of inflammatory bowel diseases with mammal beta defensins
US8802621B2 (en) 2008-07-18 2014-08-12 Defensin Therapeutics Aps Treatment of inflammatory bowel diseases with mammal beta defensins
WO2010059413A2 (en) 2008-11-20 2010-05-27 Novozymes, Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
EP2857515A2 (en) 2008-11-20 2015-04-08 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010068800A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2010074972A1 (en) 2008-12-15 2010-07-01 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2010074955A1 (en) 2008-12-16 2010-07-01 Novozymes, Inc. Polypeptides having carboxypeptidase activity and polynucleotides encoding same
WO2010077775A1 (en) 2008-12-16 2010-07-08 Novozymes, Inc. Polypeptides having alpha-mannosidase activity and polynucleotides encoding same
WO2010070110A2 (en) 2008-12-19 2010-06-24 Novozymes A/S Use of enzymes having silicase activity
WO2010084086A1 (en) 2009-01-21 2010-07-29 Novozymes A/S Polypeptides having esterase activity and nucleic acids encoding the same
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088447A1 (en) 2009-01-30 2010-08-05 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
US8679814B2 (en) 2009-02-06 2014-03-25 University Of Chile Protein and DNA sequence encoding a cold adapted xylanase
WO2010091221A1 (en) 2009-02-06 2010-08-12 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010089302A1 (en) 2009-02-06 2010-08-12 University Of Chile Protein and dna sequence encoding a cold adapted xylanase
US11555061B2 (en) 2009-02-11 2023-01-17 Albumedix, Ltd Albumin variants and conjugates
WO2010094772A1 (en) 2009-02-20 2010-08-26 Febit Holding Gmbh Synthesis of sequence-verified nucleic acids
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
WO2010106068A1 (en) 2009-03-17 2010-09-23 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
EP2248893A1 (en) 2009-05-06 2010-11-10 Novozymes A/S DFPase Enzymes from Octopus Vulgaris
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2010151787A1 (en) 2009-06-26 2010-12-29 Novozymes North America, Inc. Heat-stable carbonic anhydrases and their use
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011009747A1 (en) 2009-07-24 2011-01-27 Novozymes A/S Carbohydrate oxidases
WO2011014458A1 (en) 2009-07-28 2011-02-03 Novozymes, Inc. Polypeptides having phytase activity and polynucleotides encoding same
WO2011020910A1 (en) 2009-08-21 2011-02-24 Novozymes A/S Polypeptides having isoamylase activity and polynucleotides encoding same
EP3103876A1 (en) 2009-09-01 2016-12-14 Novozymes Inc. Methods for improving malic acid production in filamentous fungi
WO2011028643A1 (en) 2009-09-01 2011-03-10 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
EP3269804A1 (en) 2009-09-17 2018-01-17 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3805348A2 (en) 2009-09-17 2021-04-14 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2977382A2 (en) 2009-09-30 2016-01-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011051489A2 (en) 2009-10-30 2011-05-05 Novozymes Biopharma Dk A/S Albumin variants
US10696732B2 (en) 2009-10-30 2020-06-30 Albumedix, Ltd Albumin variants
EP3421491A2 (en) 2009-10-30 2019-01-02 Albumedix Ltd Albumin variants
WO2011057086A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011066576A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011066560A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011068803A1 (en) 2009-12-01 2011-06-09 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011067335A1 (en) 2009-12-02 2011-06-09 Novozymes A/S Use of defensins for treatment of infective endocarditis
WO2011067349A1 (en) 2009-12-03 2011-06-09 Novozymes A/S Variants of a polypeptide with lipolytic activity and improved stability
WO2011070101A1 (en) 2009-12-09 2011-06-16 Novozymes A/S Methods of producing gh8 xylanase variants
WO2011070032A1 (en) 2009-12-11 2011-06-16 Novozymes A/S Arenicin-3 for use in the treatment of urinary tract infections
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
WO2011082425A2 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP3101127A1 (en) 2010-01-04 2016-12-07 Novozymes A/S Alpha-amylase variants with improved stability
WO2011082429A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011080354A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011104339A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Variants of a lysozyme and polynucleotides encoding same
WO2011104284A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Polypeptides having antimicrobial activity
WO2011109524A2 (en) 2010-03-03 2011-09-09 Novozymes, Inc. Xylanase variants and polynucleotides encoding same
WO2011120938A2 (en) 2010-03-28 2011-10-06 Novozymes A/S Enzymatic hydroxylation of aliphatic hydrocarbon
WO2011123505A1 (en) 2010-03-30 2011-10-06 Novozymes North America, Inc. Processes of producing a fermentation product
WO2011126897A2 (en) 2010-03-30 2011-10-13 Novozymes A/S Methods for enhancing by-products from fermentation processes
EP3070171A1 (en) 2010-03-30 2016-09-21 Novozymes A/S Processes of producing a fermentation product
WO2011123450A1 (en) 2010-03-31 2011-10-06 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
US10233228B2 (en) 2010-04-09 2019-03-19 Albumedix Ltd Albumin derivatives and variants
WO2011127802A1 (en) 2010-04-14 2011-10-20 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011153317A1 (en) 2010-06-04 2011-12-08 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
WO2011154525A1 (en) 2010-06-12 2011-12-15 Novozymes A/S Antimicrobial peptide variants and polynucleotides encoding same
WO2011163270A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Methods for improved c4-dicarboxylic acid production in filamentous fungi
EP2769985A1 (en) 2010-06-21 2014-08-27 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having C4-dicarboxylic acid transporter activity and polynucleotides encoding same
WO2011163269A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same
WO2012003379A1 (en) 2010-06-30 2012-01-05 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2012021394A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof
WO2012021396A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof
WO2012021399A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof
WO2012021400A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a heterocyclic compound and uses thereof
WO2012021410A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof
WO2012021408A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a dioxy compound and uses thereof
WO2012021401A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicyclic compound and uses thereof
WO2012021395A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a sulfur-containing compound and uses thereof
WO2012022777A1 (en) 2010-08-19 2012-02-23 Novozymes A/S Induced sporulation screening method
WO2012025577A1 (en) 2010-08-24 2012-03-01 Novozymes A/S Heat-stable persephonella carbonic anhydrases and their use
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2735611A2 (en) 2010-08-30 2014-05-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
EP3470514A1 (en) 2010-08-30 2019-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012042037A1 (en) 2010-10-01 2012-04-05 Novozymes A/S Polypeptides having endopeptidase activity and polynucleotides encoding same
WO2012044915A2 (en) 2010-10-01 2012-04-05 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
EP3023492A1 (en) 2010-10-01 2016-05-25 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012058293A1 (en) 2010-10-26 2012-05-03 Novozymes North America, Inc. Methods of saccharifying sugarcane trash
WO2012058566A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same
WO2012058603A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Recombinant n-propanol and isopropanol production
WO2012061517A1 (en) 2010-11-02 2012-05-10 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
WO2012059053A1 (en) 2010-11-04 2012-05-10 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012064351A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2012064350A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same
US10982208B2 (en) 2010-11-12 2021-04-20 Gen9, Inc. Protein arrays and methods of using and making the same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012062817A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
US9295965B2 (en) 2010-11-12 2016-03-29 Gen9, Inc. Methods and devices for nucleic acid synthesis
US11845054B2 (en) 2010-11-12 2023-12-19 Gen9, Inc. Methods and devices for nucleic acids synthesis
US10457935B2 (en) 2010-11-12 2019-10-29 Gen9, Inc. Protein arrays and methods of using and making the same
US11084014B2 (en) 2010-11-12 2021-08-10 Gen9, Inc. Methods and devices for nucleic acids synthesis
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012078656A1 (en) 2010-12-06 2012-06-14 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
EP3235903A1 (en) 2011-01-26 2017-10-25 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103350A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012103300A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012134626A2 (en) 2011-01-31 2012-10-04 Novozymes North America, Inc. Processes for enzymatic refining of pretreated cellulosic material for saccharification
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012118848A1 (en) 2011-02-28 2012-09-07 Novozymes, Inc. Microorganism for c4-dicarboxylic acid production
EP3339442A1 (en) 2011-03-09 2018-06-27 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012127002A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Sweet-tasting polypeptide from gram-positive bacteria
WO2012127001A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Methods for producing secreted polypeptides
EP3333258A2 (en) 2011-03-25 2018-06-13 Novozymes A/S Method for degrading or converting cellulosic material
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
WO2012149192A1 (en) 2011-04-28 2012-11-01 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012150319A1 (en) 2011-05-05 2012-11-08 Novozymes Biopharma Dk A/S Albumin variants
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012159007A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012160093A1 (en) 2011-05-23 2012-11-29 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
EP2527432A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2012160097A1 (en) 2011-05-23 2012-11-29 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP3121270A2 (en) 2011-06-30 2017-01-25 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
EP2540824A1 (en) 2011-06-30 2013-01-02 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
EP2540825A2 (en) 2011-06-30 2013-01-02 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013001078A1 (en) 2011-06-30 2013-01-03 Novozymes A/S Alpha-amylase variants
EP4026901A2 (en) 2011-06-30 2022-07-13 Novozymes A/S Method for screening alpha-amylases
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
WO2013003659A1 (en) 2011-06-30 2013-01-03 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
EP3798303A1 (en) 2011-06-30 2021-03-31 Novozymes A/S Alpha-amylase-variants
EP3543333A2 (en) 2011-06-30 2019-09-25 Novozymes A/S Method for screening alpha-amylases
EP3421595A1 (en) 2011-06-30 2019-01-02 Novozymes A/S Alpha-amylase-variants
WO2013006756A2 (en) 2011-07-06 2013-01-10 Novozymes A/S Alpha amylase variants and polynucleotides encoding same
WO2013004639A2 (en) 2011-07-07 2013-01-10 Novozymes A/S Enzymatic preparation of diols
US9217021B2 (en) 2011-07-08 2015-12-22 Defensin Therapeutics Aps Oral treatment of inflammatory bowel disease
WO2013007596A2 (en) 2011-07-08 2013-01-17 Novozymes A/S Oral treatment of inflammatory bowel disease
US9833495B2 (en) 2011-07-08 2017-12-05 Defensin Therapeutics Aps Oral treatment of inflammatory bowel disease
WO2013010783A1 (en) 2011-07-15 2013-01-24 Novozymes A/S Lipase variants and polynucleotides encoding same
US11472849B2 (en) 2011-07-15 2022-10-18 The General Hospital Corporation Methods of transcription activator like effector assembly
US10273271B2 (en) 2011-07-15 2019-04-30 The General Hospital Corporation Methods of transcription activator like effector assembly
WO2013016115A1 (en) 2011-07-22 2013-01-31 Novozymes North America, Inc. Processes for pretreating cellulosic material and improving hydrolysis thereof
WO2013019827A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
EP3091073A2 (en) 2011-08-04 2016-11-09 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP3382016A1 (en) 2011-08-04 2018-10-03 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2013019780A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013021062A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021065A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021061A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021064A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021059A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021060A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021063A2 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026794A1 (en) 2011-08-19 2013-02-28 Novozymes Novel immunomodulatory peptide
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013028512A1 (en) 2011-08-19 2013-02-28 Novozymes, Inc. Recombinant microorganisms for production c4-dicarboxylic acids
WO2013029496A1 (en) 2011-08-26 2013-03-07 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
US11702662B2 (en) 2011-08-26 2023-07-18 Gen9, Inc. Compositions and methods for high fidelity assembly of nucleic acids
WO2013036526A1 (en) 2011-09-06 2013-03-14 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013034106A1 (en) 2011-09-09 2013-03-14 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013036898A2 (en) 2011-09-09 2013-03-14 Novozymes A/S Improving properties of paper materials
WO2013039776A1 (en) 2011-09-13 2013-03-21 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013040991A1 (en) 2011-09-23 2013-03-28 Novozymes A/S Color modification of textile
WO2013044867A1 (en) 2011-09-30 2013-04-04 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013049073A1 (en) 2011-09-30 2013-04-04 Novozymes, Inc. Dehydrogenase variants and polynucleotides encoding same
WO2013053801A1 (en) 2011-10-11 2013-04-18 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
EP4253534A2 (en) 2011-10-17 2023-10-04 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP3495479A1 (en) 2011-10-17 2019-06-12 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013057141A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013057143A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013064075A1 (en) 2011-10-31 2013-05-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013064195A1 (en) 2011-11-04 2013-05-10 Enel Ingegneria E Ricerca S.P.A. A new heat-stable carbonic anhydrase and uses thereof
WO2013068309A1 (en) 2011-11-08 2013-05-16 Novozymes A/S Methods for production of archeae protease in yeast
WO2013074956A2 (en) 2011-11-18 2013-05-23 Novozymes, Inc. Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP3382017A1 (en) 2011-11-18 2018-10-03 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP3409769A1 (en) 2011-11-18 2018-12-05 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
US10711050B2 (en) 2011-11-18 2020-07-14 Albumedix Ltd Variant serum albumin with improved half-life and other properties
EP3219794A1 (en) 2011-11-21 2017-09-20 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
EP3597736A1 (en) 2011-11-21 2020-01-22 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP3342860A1 (en) 2011-11-22 2018-07-04 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013075644A1 (en) 2011-11-22 2013-05-30 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013076259A2 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013076253A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013079015A1 (en) 2011-12-01 2013-06-06 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079533A1 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013079531A2 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
EP3272862A1 (en) 2011-12-16 2018-01-24 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2013091547A1 (en) 2011-12-19 2013-06-27 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2013096603A2 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
EP3323875A1 (en) 2011-12-20 2018-05-23 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2013113622A1 (en) 2012-02-03 2013-08-08 Novozymes A/S Lipase variants and polynucleotides encoding same
EP2623586A2 (en) 2012-02-03 2013-08-07 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
WO2013116261A2 (en) 2012-02-03 2013-08-08 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
EP3211074A2 (en) 2012-02-03 2017-08-30 Novozymes A/S Lipase variants and polynucleotides encoding same
EP3696265A2 (en) 2012-02-03 2020-08-19 Novozymes A/S Lipase variants and polynucleotides encoding same
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120952A2 (en) 2012-02-17 2013-08-22 Henkel Ag & Co. Kgaa Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013123871A1 (en) 2012-02-20 2013-08-29 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US10329340B2 (en) 2012-03-16 2019-06-25 Albumedix Ltd Albumin variants
EP3330283A2 (en) 2012-03-16 2018-06-06 Albumedix A/S Albumin variants
WO2013135896A1 (en) 2012-03-16 2013-09-19 Novozymes Biopharma Dk A/S Albumin variants
US10308931B2 (en) 2012-03-21 2019-06-04 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
WO2013144105A1 (en) 2012-03-31 2013-10-03 Novozymes A/S Epoxidation using peroxygenase
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2013160247A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
US10927369B2 (en) 2012-04-24 2021-02-23 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
US10081807B2 (en) 2012-04-24 2018-09-25 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
WO2013160370A1 (en) 2012-04-25 2013-10-31 Novozymes A/S Method of baking
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP3279320A2 (en) 2012-04-27 2018-02-07 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013173711A1 (en) 2012-05-18 2013-11-21 Novozymes A/S Bacterial mutants with improved transformation efficiency
US10894950B2 (en) 2012-05-29 2021-01-19 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
WO2013178699A1 (en) 2012-05-31 2013-12-05 Novozymes A/S Isopropanol production by bacterial hosts
WO2013178808A2 (en) 2012-05-31 2013-12-05 Novozymes A/S Polypeptides having organophosphorous hydrolase activity
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
US11072789B2 (en) 2012-06-25 2021-07-27 Gen9, Inc. Methods for nucleic acid assembly and high throughput sequencing
WO2014009473A1 (en) 2012-07-12 2014-01-16 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
WO2014012506A1 (en) 2012-07-18 2014-01-23 Novozymes A/S Method of treating polyester textile
WO2014015256A2 (en) 2012-07-20 2014-01-23 Novozymes A/S Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof
EP3553172A1 (en) 2012-08-16 2019-10-16 Novozymes A/S Method for treating textile with endoglucanase
WO2014027062A1 (en) 2012-08-17 2014-02-20 Novozymes A/S Thermostable asparaginase variants and polynucleotides encoding same
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014037438A1 (en) 2012-09-05 2014-03-13 Novozymes A/S Polypeptides having protease activity
WO2014092832A2 (en) 2012-09-19 2014-06-19 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2014052630A1 (en) 2012-09-27 2014-04-03 Novozymes, Inc. Bacterial mutants with improved transformation efficiency
EP3176260A1 (en) 2012-10-05 2017-06-07 Novozymes A/S Preventing adhesion of bacteria
WO2014053594A1 (en) 2012-10-05 2014-04-10 Novozymes A/S Preventing adhesion of bacteria
WO2014058896A1 (en) 2012-10-08 2014-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3586610A1 (en) 2012-10-08 2020-01-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014056920A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056919A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056917A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056921A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
US11891631B2 (en) 2012-10-12 2024-02-06 The General Hospital Corporation Transcription activator-like effector (tale) - lysine-specific demethylase 1 (LSD1) fusion proteins
WO2014056916A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056927A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056922A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014066141A2 (en) 2012-10-24 2014-05-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014068010A1 (en) 2012-10-31 2014-05-08 Novozymes A/S Isopropanol production by bacterial hosts
US10501524B2 (en) 2012-11-08 2019-12-10 Albumedix Ltd Albumin variants
US10934341B2 (en) 2012-11-08 2021-03-02 Albumedix, Ltd. Albumin variants
WO2014076232A2 (en) 2012-11-19 2014-05-22 Novozymes A/S Isopropanol production by recombinant hosts using an hmg-coa intermediate
WO2014085330A1 (en) 2012-11-30 2014-06-05 Novozymes, Inc. 3-hydroxypropionic acid production by recombinant yeasts
EP2740840A1 (en) 2012-12-07 2014-06-11 Novozymes A/S Improving drainage of paper pulp
WO2014086706A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Method for generating site-specific mutations in filamentous fungi
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014086976A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Improving drainage of paper pulp
EP3556836A1 (en) 2012-12-07 2019-10-23 Novozymes A/S Preventing adhesion of bacteria
WO2014090161A1 (en) 2012-12-11 2014-06-19 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014099653A1 (en) 2012-12-17 2014-06-26 Novozymes A/S Alpha-amylases and polynucleotides encoding same
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014101753A1 (en) 2012-12-24 2014-07-03 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
EP3321360A2 (en) 2013-01-03 2018-05-16 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2014122109A1 (en) 2013-02-05 2014-08-14 Novozymes A/S Enzymatic preparation of indigo dyes and intermediates
WO2014122161A2 (en) 2013-02-06 2014-08-14 Novozymes A/S Polypeptides having protease activity
US10676749B2 (en) 2013-02-07 2020-06-09 The General Hospital Corporation Tale transcriptional activators
US10731167B2 (en) 2013-02-07 2020-08-04 The General Hospital Corporation Tale transcriptional activators
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
EP3533866A1 (en) 2013-03-21 2019-09-04 Novozymes A/S Polypeptides having phospholipase a activity and polynucleotides encoding same
WO2014147219A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides having phospholipase a activity and polynucleotides encoding same
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014170218A1 (en) 2013-04-18 2014-10-23 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP3569611A1 (en) 2013-04-23 2019-11-20 Novozymes A/S Liquid automatic dish washing detergent compositions with stabilised subtilisin
EP3372680A1 (en) 2013-04-30 2018-09-12 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2014177541A2 (en) 2013-04-30 2014-11-06 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
EP3461881A1 (en) 2013-05-03 2019-04-03 Novozymes A/S Microencapsulation of detergent enzymes
WO2014182990A1 (en) 2013-05-10 2014-11-13 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
EP3786269A1 (en) 2013-06-06 2021-03-03 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2014202793A1 (en) 2013-06-21 2014-12-24 Novozymes A/S Production of polypeptides without secretion signal in bacillus
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015007639A1 (en) 2013-07-17 2015-01-22 Novozymes A/S Pullulanase chimeras and polynucleotides encoding same
EP3613853A1 (en) 2013-07-29 2020-02-26 Novozymes A/S Protease variants and polynucleotides encoding same
EP3339436A1 (en) 2013-07-29 2018-06-27 Henkel AG & Co. KGaA Detergent composition comprising protease variants
EP3611260A1 (en) 2013-07-29 2020-02-19 Novozymes A/S Protease variants and polynucleotides encoding same
EP3309249A1 (en) 2013-07-29 2018-04-18 Novozymes A/S Protease variants and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
WO2015017721A1 (en) 2013-07-31 2015-02-05 Novozymes A/S 3-hydroxypropionic acid production by recombinant yeasts expressing an insect aspartate 1-decarboxylase
WO2015022429A1 (en) 2013-08-15 2015-02-19 Novozymes A/S Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
WO2015059133A1 (en) 2013-10-22 2015-04-30 Novozymes A/S Cellobiose dehydrogenase variants and polynucleotides encoding same
EP2876156A1 (en) 2013-11-26 2015-05-27 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof
WO2015079064A2 (en) 2013-11-29 2015-06-04 Novozymes A/S Peroxygenase variants
WO2015085920A1 (en) 2013-12-11 2015-06-18 Novozymes A/S Cutinase variants and polynucleotides encoding same
WO2015091755A2 (en) 2013-12-18 2015-06-25 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
EP2886656A1 (en) 2013-12-18 2015-06-24 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
EP3453757A1 (en) 2013-12-20 2019-03-13 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2015109972A1 (en) 2014-01-22 2015-07-30 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3415624A1 (en) 2014-01-22 2018-12-19 Novozymes A/S Pullulanase variants and polynucleotides encoding same
EP3521434A1 (en) 2014-03-12 2019-08-07 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015143144A1 (en) 2014-03-19 2015-09-24 Novozymes A/S Method for enhancing activity of an x143 polypeptide
EP4163354A2 (en) 2014-03-19 2023-04-12 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
EP3550015A1 (en) 2014-04-10 2019-10-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP3722406A1 (en) 2014-04-11 2020-10-14 Novozymes A/S Detergent composition
WO2015158237A1 (en) 2014-04-15 2015-10-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015158800A1 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell for expressing proteins of interest
WO2015158808A2 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell engineered to overexpress helper proteins
EP4311857A2 (en) 2014-04-17 2024-01-31 Boehringer Ingelheim RCV GmbH & Co KG Recombinant host cell engineered to overexpress helper proteins
WO2015173426A1 (en) 2014-05-15 2015-11-19 Novozymes A/S Compositions comprising polypeptides having phospholipase c activity and use thereof
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
EP3760713A2 (en) 2014-05-27 2021-01-06 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015183710A1 (en) 2014-05-30 2015-12-03 Novozymes A/S Variants of gh family 11 xylanase and polynucleotides encoding same
EP2952584A1 (en) 2014-06-04 2015-12-09 Boehringer Ingelheim RCV GmbH & Co KG Improved protein production
EP2952585A1 (en) 2014-06-04 2015-12-09 Boehringer Ingelheim RCV GmbH & Co KG Improved protein production in fungi or yeasts
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015200659A1 (en) 2014-06-25 2015-12-30 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP3878960A1 (en) 2014-07-04 2021-09-15 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3739029A1 (en) 2014-07-04 2020-11-18 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2016028999A1 (en) 2014-08-20 2016-02-25 Novozymes A/S Xyloglucan endotransglycosylase variants and polynucleotides encoding same
EP3594335A1 (en) 2014-09-05 2020-01-15 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
WO2016037096A1 (en) 2014-09-05 2016-03-10 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
WO2016062875A2 (en) 2014-10-23 2016-04-28 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2016073610A1 (en) 2014-11-07 2016-05-12 Novozymes A/S Xylanase based bleach boosting
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016087327A1 (en) 2014-12-01 2016-06-09 Novozymes A/S Polypeptides having pullulanase activity comprising the x25, x45 and cbm41 domains
WO2016090059A1 (en) 2014-12-02 2016-06-09 Novozymes A/S Laccase variants and polynucleotides encoding same
EP4339282A2 (en) 2014-12-04 2024-03-20 Novozymes A/S Liquid cleaning compositions comprising protease variants
EP3690037A1 (en) 2014-12-04 2020-08-05 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP4067485A2 (en) 2014-12-05 2022-10-05 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016095856A1 (en) 2014-12-19 2016-06-23 Novozymes A/S Compositions comprising polypeptides having xylanase activity and polypeptides having arabinofuranosidase activity
EP3741848A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
EP4273238A2 (en) 2014-12-19 2023-11-08 Novozymes A/S Compositions comprising polypeptides having xylanase activity and polypeptides having arabinofuranosidase activity
WO2016100910A1 (en) 2014-12-19 2016-06-23 Novozymes A/S Recombinant host cells for the production of 3-hydroxypropionic acid
EP3741849A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
EP3739045A2 (en) 2015-02-24 2020-11-18 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016138315A1 (en) 2015-02-25 2016-09-01 Danisco Us Inc Alpha-glucosidase, compositions & methods
WO2016138303A1 (en) 2015-02-27 2016-09-01 Novozymes A/S Mutant host cells for the production of 3-hydroxypropionic acid
WO2016146473A1 (en) 2015-03-19 2016-09-22 Novozymes A/S A brewing method
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016180749A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016180748A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016180792A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants having improved performance and stability
EP3964575A2 (en) 2015-05-08 2022-03-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP4212609A1 (en) 2015-05-08 2023-07-19 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016188459A1 (en) 2015-05-27 2016-12-01 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2016196202A1 (en) 2015-05-29 2016-12-08 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2016193420A1 (en) 2015-06-04 2016-12-08 Novozymes A/S Use of m4 metalloprotease in wort production
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP4071244A1 (en) 2015-06-18 2022-10-12 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016205127A1 (en) 2015-06-18 2016-12-22 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
EP3872175A1 (en) 2015-06-18 2021-09-01 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2016207373A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Polypeptides having peroxygenase activity
WO2016207384A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Method for producing a coffee extract
WO2016206621A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Biofinishing system
EP3929285A2 (en) 2015-07-01 2021-12-29 Novozymes A/S Methods of reducing odor
WO2017000922A1 (en) 2015-07-02 2017-01-05 Novozymes A/S Animal feed compositions and uses thereof
EP3950939A2 (en) 2015-07-06 2022-02-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2017019491A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2017019490A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
US10633428B2 (en) 2015-08-20 2020-04-28 Albumedix Ltd Albumin variants and conjugates
WO2017035270A1 (en) 2015-08-24 2017-03-02 Novozymes A/S Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid
WO2017050242A1 (en) 2015-09-22 2017-03-30 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP3708660A2 (en) 2015-10-07 2020-09-16 Novozymes A/S Polypeptides
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
EP4324919A2 (en) 2015-10-14 2024-02-21 Novozymes A/S Polypeptide variants
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017066255A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
EP3957711A2 (en) 2015-10-28 2022-02-23 Novozymes A/S Detergent composition comprising amylase and protease variants
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017100240A1 (en) 2015-12-07 2017-06-15 Eastman Chemical Company Calb variants
US11441140B2 (en) 2015-12-07 2022-09-13 Henkel Ag & Co. Kgaa Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof
US10035995B2 (en) 2015-12-07 2018-07-31 Eastman Chemical Company CALB variants
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
US10023618B2 (en) 2015-12-22 2018-07-17 Albumedix A/S Protein expression strains
EP4219702A2 (en) 2015-12-30 2023-08-02 Novozymes A/S Enzyme variants and polynucleotides encoding the same
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017140807A1 (en) 2016-02-16 2017-08-24 Monaghan Mushrooms Group Fungal polypeptides having lysozyme activity
US11685911B2 (en) 2016-02-16 2023-06-27 Monaghan Mushroom S Group Fungal polypeptides having lysozyme activity
WO2017151957A1 (en) 2016-03-02 2017-09-08 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017165760A1 (en) 2016-03-24 2017-09-28 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
EP3693449A1 (en) 2016-04-29 2020-08-12 Novozymes A/S Detergent compositions and uses thereof
WO2017186250A1 (en) 2016-04-29 2017-11-02 Defensin Therapeutics Aps Treatment of liver, biliary tract and pancreatic disorders
WO2017191160A1 (en) 2016-05-03 2017-11-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
WO2017194487A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
EP3246401A1 (en) 2016-05-20 2017-11-22 Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives New fatty acid decarboxylase and its uses
WO2017202979A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Polypeptides having alpha-galactosidase activity and polynucleotides encoding same
WO2017202997A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity
WO2017202966A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Polypeptides having alpha-galactosidase activity and polynucleotides encoding same
WO2017202946A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity
WO2017205535A1 (en) 2016-05-27 2017-11-30 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2017210188A1 (en) 2016-05-31 2017-12-07 Novozymes A/S Stabilized liquid peroxide compositions
WO2017207762A1 (en) 2016-06-03 2017-12-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2017211803A1 (en) 2016-06-07 2017-12-14 Novozymes A/S Co-expression of heterologous polypeptides to increase yield
WO2018001959A1 (en) 2016-06-30 2018-01-04 Novozymes A/S Lipase variants and compositions comprising surfactant and lipase variant
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
WO2018002379A2 (en) 2016-07-01 2018-01-04 Novozymes A/S Enzymatic preparation of indigo dyes and in situ dyeing process
WO2018007435A1 (en) 2016-07-05 2018-01-11 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018007154A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
WO2018007153A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
EP3950941A2 (en) 2016-07-13 2022-02-09 Novozymes A/S Dnase polypeptide variants
WO2018011277A1 (en) 2016-07-13 2018-01-18 Novozymes A/S Bacillus cibi dnase variants
WO2018011276A1 (en) 2016-07-13 2018-01-18 The Procter & Gamble Company Bacillus cibi dnase variants and uses thereof
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
WO2018017792A1 (en) 2016-07-20 2018-01-25 Novozymes A/S Heat-stable metagenomic carbonic anhydrases and their use
WO2018015303A1 (en) 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same
WO2018015304A1 (en) 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same
WO2018015444A1 (en) 2016-07-22 2018-01-25 Novozymes A/S Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi
WO2018026868A1 (en) 2016-08-01 2018-02-08 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2018037064A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants i
WO2018037062A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018060475A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Spore containing granule
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
WO2018085370A1 (en) 2016-11-02 2018-05-11 Novozymes A/S Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material
WO2018094181A1 (en) 2016-11-21 2018-05-24 Novozymes A/S Yeast cell extract assisted construction of dna molecules
WO2018098124A1 (en) 2016-11-23 2018-05-31 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2018102348A1 (en) 2016-11-29 2018-06-07 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2018099965A1 (en) 2016-11-30 2018-06-07 Novozymes A/S Method of baking
WO2018106792A1 (en) 2016-12-06 2018-06-14 Novozymes A/S Improved processes for production of ethanol from xylose-containing cellulosic substrates using engineered yeast strains
WO2018108971A2 (en) 2016-12-13 2018-06-21 Defensin Therapeutics Aps Methods for treating inflammatory conditions of the lungs
WO2018114973A1 (en) 2016-12-20 2018-06-28 Novozymes A/S Recombinant yeast strains for pentose fermentation
EP4001416A1 (en) 2016-12-20 2022-05-25 Novozymes A/S Recombinant yeast strains for pentose fermentation
WO2018141707A2 (en) 2017-02-01 2018-08-09 Novozymes A/S Alpha-amylase variants
WO2018144399A1 (en) 2017-02-01 2018-08-09 The Procter & Gamble Company Cleaning compositions comprising amylase variants
EP3357994A1 (en) 2017-02-01 2018-08-08 The Procter & Gamble Company Cleaning compositions comprising amylase variants
EP4276179A2 (en) 2017-02-01 2023-11-15 Novozymes A/S Alpha-amylase variants
WO2018150021A1 (en) 2017-02-20 2018-08-23 Novozymes A/S Lipolytic enzyme for use in baking
WO2018164737A1 (en) 2017-03-07 2018-09-13 Danisco Us Inc. Thermostable glucoamylase and methods of use, thereof
WO2018178126A1 (en) 2017-03-29 2018-10-04 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell with altered membrane lipid composition
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018177938A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018178061A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having rnase activity
WO2018185181A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Glycosyl hydrolases
WO2018185150A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptides
WO2018185152A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptide compositions and uses thereof
WO2018191215A1 (en) 2017-04-11 2018-10-18 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2018202846A1 (en) 2017-05-05 2018-11-08 Novozymes A/S Compositions comprising lipase and sulfite
WO2018206300A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018206535A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Carbohydrate-binding domain and polynucleotides encoding the same
WO2018206302A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018220116A1 (en) 2017-05-31 2018-12-06 Novozymes A/S Xylose fermenting yeast strains and processes thereof for ethanol production
WO2018222990A1 (en) 2017-06-02 2018-12-06 Novozymes A/S Improved yeast for ethanol production
WO2018224544A1 (en) 2017-06-08 2018-12-13 Novozymes A/S Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions
US11396670B2 (en) 2017-06-20 2022-07-26 Albumedix Limited Protein expression strains
WO2018234349A1 (en) 2017-06-20 2018-12-27 Albumedix Ltd Improved protein expression strains
EP4026908A1 (en) 2017-06-20 2022-07-13 Albumedix Ltd Improved protein expression strains
US11130979B2 (en) 2017-06-20 2021-09-28 Albumedix Ltd Protein expression strains
WO2018234465A1 (en) 2017-06-22 2018-12-27 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2019005755A1 (en) 2017-06-28 2019-01-03 Novozymes A/S Polypeptides having trehalase activity and polynucleotides encoding same
EP4015524A1 (en) 2017-06-28 2022-06-22 Novozymes A/S Polypeptides having trehalase activity and polynucleotides encoding same
WO2019002356A1 (en) 2017-06-30 2019-01-03 Novozymes A/S Enzyme slurry composition
WO2019023222A1 (en) 2017-07-24 2019-01-31 Novozymes A/S Gh5 and gh30 in wet milling
WO2019030165A1 (en) 2017-08-08 2019-02-14 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
WO2019038060A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase variants ii
WO2019038059A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent compositions comprising gh9 endoglucanase variants ii
WO2019038057A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2019038058A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2019042971A1 (en) 2017-08-29 2019-03-07 Novozymes A/S Baker's yeast expressing anti-staling/freshness amylases
WO2019043088A1 (en) 2017-08-31 2019-03-07 Novozymes A/S Polypeptides having d-psicose 3-epimerase activity and polynucleotides encoding same
WO2019046703A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Methods for improving genome editing in fungi
WO2019043191A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Animal feed additives comprising a polypeptide having protease activity and uses thereof
WO2019043189A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Animal feed additives comprising polypeptide having protease activity and uses thereof
WO2019050754A1 (en) 2017-09-11 2019-03-14 Danisco Us Inc Glucoamylase and methods of use, thereof
WO2019063499A1 (en) 2017-09-27 2019-04-04 Novozymes A/S Lipase variants and microcapsule compositions comprising such lipase variants
WO2019067390A1 (en) 2017-09-27 2019-04-04 The Procter & Gamble Company Detergent compositions comprising lipases
WO2019068713A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019068715A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019070883A1 (en) 2017-10-04 2019-04-11 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2019083818A1 (en) 2017-10-23 2019-05-02 Novozymes A/S Improving expression of a protease by co-expression with propeptide
WO2019081724A1 (en) 2017-10-27 2019-05-02 Novozymes A/S Dnase variants
WO2019081721A1 (en) 2017-10-27 2019-05-02 Novozymes A/S Dnase variants
WO2019084350A1 (en) 2017-10-27 2019-05-02 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
WO2019084349A1 (en) 2017-10-27 2019-05-02 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
WO2019086526A1 (en) 2017-11-01 2019-05-09 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins iii
DE102017125559A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE II
DE102017125558A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANING COMPOSITIONS CONTAINING DISPERSINE I
WO2019086521A1 (en) 2017-11-01 2019-05-09 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins ii
DE102017125560A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE III
WO2019086520A1 (en) 2017-11-01 2019-05-09 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins i
WO2019092042A1 (en) 2017-11-10 2019-05-16 Novozymes A/S Temperature-sensitive cas9 protein
WO2019092201A2 (en) 2017-11-10 2019-05-16 Defensin Therapeutics Aps Maturation of mucosal defense and gut/lung function in the preterm infant
WO2019099235A1 (en) 2017-11-14 2019-05-23 Danisco Us Inc Alpha-amylase, composition and method
WO2019096903A1 (en) 2017-11-20 2019-05-23 Novozymes A/S New galactanases (ec 3.2.1.89) for use in soy processing
WO2019101773A2 (en) 2017-11-24 2019-05-31 Defensin Therapeutics Aps Prevention and treatment of graft-versus-host-disease with defensins
WO2019110462A1 (en) 2017-12-04 2019-06-13 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2019113415A1 (en) 2017-12-08 2019-06-13 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2019113413A1 (en) 2017-12-08 2019-06-13 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2019125804A1 (en) 2017-12-20 2019-06-27 Basf Se Nucleases and methods for making and using them
WO2019122083A1 (en) 2017-12-22 2019-06-27 Novozymes A/S Wheat milling process and gh8 xylanases
US11667941B2 (en) 2018-01-12 2023-06-06 Camena Bioscience Limited Compositions and methods for template-free geometric enzymatic nucleic acid synthesis
WO2019148192A1 (en) 2018-01-29 2019-08-01 Novozymes A/S Microorganisms with improved nitrogen utilization for ethanol production
WO2019154955A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019154954A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019154951A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipases, lipase variants and compositions thereof
WO2019154952A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019168650A1 (en) 2018-02-28 2019-09-06 The Procter & Gamble Company Methods of cleaning
US11525151B2 (en) 2018-03-09 2022-12-13 Danisco Us Inc. Glucoamylases and methods of use, thereof
WO2019173424A1 (en) 2018-03-09 2019-09-12 Danisco Us Inc Glucoamylases and methods of use thereof
WO2019175240A1 (en) 2018-03-13 2019-09-19 Novozymes A/S Microencapsulation using amino sugar oligomers
WO2019185726A1 (en) 2018-03-29 2019-10-03 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2019197318A1 (en) 2018-04-09 2019-10-17 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2019201785A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019201783A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019229228A1 (en) 2018-05-31 2019-12-05 Novozymes A/S Method for treating dissolving pulp using lytic polysaccharide monooxygenase
WO2020002494A1 (en) 2018-06-27 2020-01-02 Boehringer Ingelheim Rcv Gmbh & Co Kg Means and methods for increased protein expression by use of transcription factors
WO2020002575A1 (en) 2018-06-28 2020-01-02 Novozymes A/S Polypeptides having pectin lyase activity and polynucleotides encoding same
WO2020010101A2 (en) 2018-07-04 2020-01-09 Danisco Us Inc Glucoamylases and methods of use, thereof
WO2020023411A1 (en) 2018-07-25 2020-01-30 Novozymes A/S Enzyme-expressing yeast for ethanol production
WO2020043836A1 (en) 2018-08-31 2020-03-05 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2020070199A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same
WO2020076697A1 (en) 2018-10-08 2020-04-16 Novozymes A/S Enzyme-expressing yeast for ethanol production
WO2020092608A1 (en) 2018-10-31 2020-05-07 Novozymes A/S Genome editing by guided endonuclease and single-stranded oligonucleotide
WO2020123463A1 (en) 2018-12-12 2020-06-18 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2020127796A2 (en) 2018-12-21 2020-06-25 Novozymes A/S Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same
WO2020160126A1 (en) 2019-01-31 2020-08-06 Novozymes A/S Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed
WO2020188095A1 (en) 2019-03-21 2020-09-24 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
US11059909B2 (en) 2019-03-27 2021-07-13 Umc Utrecht Holding B.V. Engineered IgA antibodies and methods of use
WO2020197400A1 (en) 2019-03-27 2020-10-01 Umc Utrecht Holding B.V. Engineered iga antibodies and methods of use
US11091562B2 (en) 2019-03-27 2021-08-17 Umc Utrecht Holding B.V. Engineered IGA antibodies and methods of use
WO2020201403A1 (en) 2019-04-03 2020-10-08 Novozymes A/S Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions
WO2020207944A1 (en) 2019-04-10 2020-10-15 Novozymes A/S Polypeptide variants
WO2020208056A1 (en) 2019-04-12 2020-10-15 Novozymes A/S Stabilized glycoside hydrolase variants
WO2020229191A1 (en) 2019-05-15 2020-11-19 Novozymes A/S Temperature-sensitive rna-guided endonuclease
WO2020264552A1 (en) 2019-06-24 2020-12-30 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2020260223A1 (en) 2019-06-24 2020-12-30 Novozymes A/S Alpha-amylase variants
WO2021001400A1 (en) 2019-07-02 2021-01-07 Novozymes A/S Lipase variants and compositions thereof
WO2021013464A1 (en) 2019-07-25 2021-01-28 Novozymes A/S Filamentous fungal expression system
WO2021018751A1 (en) 2019-07-26 2021-02-04 Novozymes A/S Enzymatic treatment of paper pulp
WO2021021458A1 (en) 2019-07-26 2021-02-04 Novozymes A/S Microorganisms with improved nitrogen transport for ethanol production
WO2021025872A1 (en) 2019-08-06 2021-02-11 Novozymes A/S Fusion proteins for improved enzyme expression
WO2021032881A1 (en) 2019-08-22 2021-02-25 Basf Se Amylase variants
WO2021055395A1 (en) 2019-09-16 2021-03-25 Novozymes A/S Polypeptides having beta-glucanase activity and polynucleotides encoding same
WO2021064068A1 (en) 2019-10-03 2021-04-08 Novozymes A/S Polypeptides comprising at least two carbohydrate binding domains
WO2021119304A1 (en) 2019-12-10 2021-06-17 Novozymes A/S Microorganism for improved pentose fermentation
WO2021122867A2 (en) 2019-12-19 2021-06-24 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2021123184A2 (en) 2019-12-19 2021-06-24 Novozymes A/S Alpha-amylase variants
WO2021127319A1 (en) 2019-12-19 2021-06-24 The Procter & Gamble Company Cleaning compositions comprising polypeptides having alpha amylase activity
WO2021123307A2 (en) 2019-12-20 2021-06-24 Novozymes A/S Polypeptides having proteolytic activity and use thereof
WO2021148278A1 (en) 2020-01-24 2021-07-29 Novozymes A/S Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide
WO2021152123A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021152120A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021163011A2 (en) 2020-02-10 2021-08-19 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2021163015A1 (en) 2020-02-10 2021-08-19 Novozymes A/S Process for producing ethanol from raw starch using alpha-amylase variants
WO2021163030A2 (en) 2020-02-10 2021-08-19 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2021170559A1 (en) 2020-02-26 2021-09-02 Novozymes A/S Polypeptide variants
WO2021204838A1 (en) 2020-04-08 2021-10-14 Novozymes A/S Carbohydrate binding module variants
WO2021212095A1 (en) 2020-04-17 2021-10-21 Danisco Us Inc. Glucoamylase and methods of use thereof
WO2021214059A1 (en) 2020-04-21 2021-10-28 Novozymes A/S Cleaning compositions comprising polypeptides having fructan degrading activity
WO2022037836A1 (en) 2020-08-18 2022-02-24 Novozymes A/S Dispersins expressed with amylase signal peptides
WO2022043321A2 (en) 2020-08-25 2022-03-03 Novozymes A/S Variants of a family 44 xyloglucanase
WO2022043547A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Protease variants with improved solubility
WO2022043563A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Polyester degrading protease variants
WO2022053706A1 (en) 2020-09-14 2022-03-17 Aesculus Bio Aps Defensin fragment derived lipopeptides for treatment of drug-resistant microorganisms
WO2022074037A2 (en) 2020-10-07 2022-04-14 Novozymes A/S Alpha-amylase variants
WO2022078910A1 (en) 2020-10-13 2022-04-21 Novozymes A/S Glycosyltransferase variants for improved protein production
WO2022090320A1 (en) 2020-10-28 2022-05-05 Novozymes A/S Use of lipoxygenase
WO2022090361A2 (en) 2020-10-29 2022-05-05 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2022090564A1 (en) 2020-11-02 2022-05-05 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2022090555A1 (en) 2020-11-02 2022-05-05 Novozymes A/S Leader peptides and polynucleotides encoding the same
WO2022106400A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of immunochemically different proteases
WO2022106404A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of proteases
WO2022129166A1 (en) 2020-12-15 2022-06-23 Novozymes A/S Mutated host cells with reduced cell motility
WO2022162043A1 (en) 2021-01-28 2022-08-04 Novozymes A/S Lipase with low malodor generation
WO2022171780A2 (en) 2021-02-12 2022-08-18 Novozymes A/S Alpha-amylase variants
WO2022175440A1 (en) 2021-02-18 2022-08-25 Novozymes A/S Inactive heme polypeptides
EP4047088A1 (en) 2021-02-22 2022-08-24 Basf Se Amylase variants
WO2022175435A1 (en) 2021-02-22 2022-08-25 Basf Se Amylase variants
WO2022189521A1 (en) 2021-03-12 2022-09-15 Novozymes A/S Polypeptide variants
WO2022197512A1 (en) 2021-03-15 2022-09-22 The Procter & Gamble Company Cleaning compositions containing polypeptide variants
WO2022194668A1 (en) 2021-03-15 2022-09-22 Novozymes A/S Polypeptide variants
EP4060036A1 (en) 2021-03-15 2022-09-21 Novozymes A/S Polypeptide variants
WO2022194673A1 (en) 2021-03-15 2022-09-22 Novozymes A/S Dnase variants
EP4060010A2 (en) 2021-03-15 2022-09-21 The Procter & Gamble Company Cleaning compositions containing polypeptide variants
WO2022199418A1 (en) 2021-03-26 2022-09-29 Novozymes A/S Detergent composition with reduced polymer content
WO2022218863A1 (en) 2021-04-12 2022-10-20 Novozymes A/S Method for producing a meat analogue product
WO2022251056A1 (en) 2021-05-27 2022-12-01 Novozymes A/S Transcriptional regulators and polynucleotides encoding the same
WO2022261003A1 (en) 2021-06-07 2022-12-15 Novozymes A/S Engineered microorganism for improved ethanol fermentation
WO2022263553A1 (en) 2021-06-16 2022-12-22 Novozymes A/S Method for controlling slime in a pulp or paper making process
WO2023285348A1 (en) 2021-07-13 2023-01-19 Novozymes A/S Recombinant cutinase expression
WO2023288294A1 (en) 2021-07-16 2023-01-19 Novozymes A/S Compositions and methods for improving the rainfastness of proteins on plant surfaces
WO2023061928A1 (en) 2021-10-12 2023-04-20 Novozymes A/S Endoglucanase with improved stability
WO2023064905A1 (en) 2021-10-15 2023-04-20 Danisco Us Inc. Glucoamylase variants and methods for use thereof
WO2023104846A1 (en) 2021-12-10 2023-06-15 Novozymes A/S Improved protein production in recombinant bacteria
WO2023118436A1 (en) 2021-12-22 2023-06-29 Novozymes A/S Method of producing a milk-based product
WO2023118565A1 (en) 2021-12-23 2023-06-29 Novozymes A/S Reduction of residual dna in microbial fermentation products
WO2023152220A1 (en) 2022-02-10 2023-08-17 Novozymes A/S Improved expression of recombinant proteins
WO2023161245A1 (en) 2022-02-22 2023-08-31 Novozymes A/S Oral care composition comprising enzymes
WO2023165507A1 (en) 2022-03-02 2023-09-07 Novozymes A/S Use of xyloglucanase for improvement of sustainability of detergents
EP4242303A1 (en) 2022-03-08 2023-09-13 Novozymes A/S Fusion polypeptides with deamidase inhibitor and deamidase domains
WO2023170177A1 (en) 2022-03-08 2023-09-14 Novozymes A/S Fusion polypeptides with deamidase inhibitor and deamidase domains
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
WO2023222648A2 (en) 2022-05-17 2023-11-23 Novozymes A/S Process for reducing free fatty acids
WO2023247348A1 (en) 2022-06-21 2023-12-28 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2023247514A1 (en) 2022-06-22 2023-12-28 Novozymes A/S Recombinant mannanase expression
WO2023247664A2 (en) 2022-06-24 2023-12-28 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2024003143A1 (en) 2022-06-30 2024-01-04 Novozymes A/S Mutanases and oral care compositions comprising same
WO2024012912A1 (en) 2022-07-15 2024-01-18 Novozymes A/S Polypeptides having deamidase inhibitor activity
WO2024033133A2 (en) 2022-08-11 2024-02-15 Basf Se Enzyme compositions comprising an amylase
WO2024033134A1 (en) 2022-08-11 2024-02-15 Basf Se Enzyme compositions comprising protease, mannanase, and/or cellulase
WO2024056643A1 (en) 2022-09-15 2024-03-21 Novozymes A/S Fungal signal peptides
EP4273249A2 (en) 2023-07-07 2023-11-08 Novozymes A/S Improved expression of recombinant proteins

Also Published As

Publication number Publication date
DE4343591A1 (en) 1995-06-22

Similar Documents

Publication Publication Date Title
WO1995017413A1 (en) Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
DE19953854C2 (en) Process for the production of biopolymers with modified properties
EP2175021B1 (en) Method for producing polymers
DE3687287T3 (en) Process for the amplification of nucleic acid sequences.
DE19826758C1 (en) Production of closed, double-stranded DNA molecules for use in gene therapy or genetic vaccination
EP1314783B1 (en) Nucleic acid linkers and their use in gene synthesis
DE69432586T2 (en) METHOD FOR GENERATING SINGLE-STRENGTH DNA MOLECULES
DE69830395T2 (en) ITERATIVE RESEQUENCING
EP1005574A2 (en) Method for producing nucleic acid polymers
EP1181395B1 (en) Method for the synthesis of dna fragments
EP1685261B1 (en) Highly parallel dna synthesiser based on matrices
DE102006039479A1 (en) Programmable oligonucleotide synthesis
WO1989011211A2 (en) Oligonucleotide bank and process for dna sequencing
CN109868268A (en) A method of optimization DNA encoding library of compounds Start Fragment
DE60312507T3 (en) A METHOD FOR THE IN VITRO MOLECULAR EVOLUTION OF THE PROTEIN FUNCTION
DE60110926T2 (en) A METHOD FOR THE IN VITRO MOLECULAR EVOLUTION OF THE PROTEIN FUNCTION
DE60300389T2 (en) METHOD FOR THE SELECTIVE RANDOM MUTAGENESIS OF POLYNUCLEOTIDES
EP1668126A1 (en) Method for in vitro evolution of polypeptides
DE69730558T2 (en) Method of forming macromolecular micro-polymers
DE4428651C1 (en) Process for the production and amplification of nucleic acids
DE69827998T2 (en) short PNA oligonucleotides in triplex complexes
EP1015640B1 (en) Method for synthesising and amplifying nucleic acids
EP1234056B1 (en) Dynamic determination of analytes using arrays on internal surfaces
EP1266027A2 (en) Dynamic sequencing by hybridization
EP1511842A2 (en) Method for creating polynucleotide molecules

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase