WO1995009910A1 - Gene that identifies sterile plant cytoplasm and process for preparing hybrid plant by using the same - Google Patents

Abstract

A novel gene that identifies a male sterile cytoplasm of a plant such as a crucifer, and a process for preparing a hybrid plant by using the same. This gene is useful as a novel cms cytoplasm gene usable in producing hybrid seeds of a plant and also in discriminating rapidly a Kosena ( Raphanus sativus ) cms cytoplasm which is a novel cytoplasm exhibiting a character useful for breeding. It is possible to add cms to not only a crucifer but also any plant in general by introducing the obtained gene into a nuclear genome or directly into a mitochondrial genome.

Description

 Description Genes that identify plant sterile cytoplasm

 And method for producing hybrid plant using the same

The present invention is used plants such crucifers, relates to a method to create a gene and Haipuri' de plants using the same identifying sterile cytoplasm, in particular for the development of F ₁ varieties definitive plants The present invention relates to a male sterile cytoplasmic gene and a method for producing a hybrid plant using the same.

 Background art

 —Hybrid hybrids are used in many major crops such as cereals and vegetables. The first-generation hybrid varieties are characterized by 1) excellent agricultural traits due to heterosis, 2) uniformity of crops, and 3) the separation of genetic traits in the next generation, thereby protecting the interests of breeders.

 In Brassicaceae, F using self-incompatibility is widely used. However, in oilseed rape without stable self-incompatibility, fibrosis using cytoplasmic male sterility (hereinafter abbreviated as “c ms”) is used. A seeding system was required. At present, a seeding system using the polymer cms has been put to practical use, but improvement is required in that male sterility is unstable, and that the shape of the vase is bad and affects the yield.

In recent years, ogura cms derived from radish has been used in rapeseed instead of polymer cms. Ogura cms is stable in male sterility and can be restored to fertility by a single fertility restoring gene (hereinafter abbreviated as “Rf gene”). The Ogura R f gene has already been introduced into rape from radish. In addition, it was found that the radish cms and Rf genes introduced into rapeseed could be used without problems in rapeseed.

 The cms cytoplasm may not only render the pollen sterile but also affect other traits of the plant. T-cms cytoplasm, a kind of corn cytoplasm, was once widely used for seeding F !, but its cytoplasm was susceptible to two major diseases, sesame leaf blight and yellow leafbright. They were also vulnerable to damage. In 1970, sesame leaf blight broke out on first-generation hybrid corn, which was hit hard. This has made it very dangerous to use only one type of cytoplasm for seed collection.

 The cms cytoplasm can affect flower morphology. In oilseed rape there may be mentioned examples of the polymer cms cytoplasm. Rape with polymer cms cytoplasm is known to have large gaps at the base of petals. Because this bee sucks nectar, there are few flowers left for pollination, and the polymer cms has a problem in terms of seed yield. Ogura ems cytoplasm is smaller in radish than in fertile flowers and secretes less nectar. This makes it difficult for insects to visit, and radish with ogra cm s cytoplasm is problematic in terms of seed yield. On the other hand, when the cm s cytoplasm possessed by Kosena radish is used, the seed cultivation of radish is larger than when using the cms cytoplasm. This is thought to be due to genetic differences in the cytoplasm of Kosena from Ogura. In other words, the interaction of nuclear genes with mitochondria and chloroplasts, which are cytoplasmic genetic factors, causes phenotypic differences. By introducing this cytoplasm into useful crops other than radish by crossing or cell fusion, it was thought that the possibility of selecting varieties with more excellent morphological characteristics than using ogra cms would be increased.

In addition, the cytoplasm and nuclei generated when the cms cytoplasm is introduced into other species The negative effects of harmonization can be partially resolved by cell fusion. Cytoplasmic hybrids made by cell fusion (Saipuri' de) cytoplasm genome of the plant (chloroplasts and mitochondria) is, by using the _c This phenomenon often with a recombinant between parents genome, only cms gene What is necessary is to sort out the introduced hybrids. However, even in this work, it was thought that the introduction of cms cytoplasm, which originally had no problem with petals and nectar quantity, would increase the probability of obtaining a breeding advantage in breeding.

 Purpose of the invention

 At present, only radish cytoplasm introduced into rapeseed is ogra cms cytoplasm. However, given the precedent of corn, it was desired to use cytoplasmic genetically different from ogra cms for breeding.

 Therefore, the present inventors have conducted a search for cytoplasm that is genetically different from ogra cms, and as a result, have found that cms derived from Kosena radish is extremely useful for the development of plant species, and obtained the gene. The present invention has been completed.

 That is, an object of the present invention is to provide a gene encoding the polypeptide represented by the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing, and a method for producing a hybrid plant using the same.

 BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a photograph instead of a drawing showing pollen development in cms-KA, cms-KAC and cms-OGU. In the figure, KAC indicates cms-KAC, KA indicates cms-KA, and 〇 GURA indicates cms-0 GU. FIG. 2 is a photograph replacing the drawing in which the identification of the cms cytoplasm by the PCR method is represented by an electrophoresis pattern. In the figure, SW18 is cms rape, OGU RA is cms- OGU, KAC is cms- KAC, KOS B is Kose Nadaikon normal mitochondria, KA stands for cms-KA.

 FIG. 3 is a photograph replacing the drawing in which Southern hybridization of mitochondrial DNA of cms-KA and cms-KAC using rrn26 as a probe is represented by an electrophoresis pattern. In the figure, KA represents cms-KA, and KAC represents cms-KAC.

 FIG. 4 is a photograph replacing the drawing in which Northern hybridization of cms-KA and cms-KAC using rrn26 as a probe is represented by an electrophoresis pattern. In the figure, KA indicates cms-KA, KAC indicates cms-KAC, and F and S indicate fertility and sterility, respectively.

 FIG. 5 is a drawing showing a physical map of a mitochondrial DNA region containing 0 rf 125 or orf 138. In the figure, 0 gura indicates the approximately 2.5 kb N_co_I DNA fragment of the ogla radish cms-type mitochondria, and Kosena indicates the approximately 2.5 kb NcoI DNA fragment of the kosena radish cms-type mitochondria. Cybrid is a DNA fragment of about 3.2 kb containing 0 rf 125 of the mitochondria of cms rape, 125 represents orf 125, 138 represents orf 138, B represents 0 rf B, and N c Represents the restriction site of NcoI, Hc represents HincII, and Xb represents the restriction site of XbaI. The arrow indicates the part where the difference in the 0 rf 125 region between cms rape and Kosena radish occurs. The base sequence downstream from the 34th base downstream of the stop codon of 0 rf 125 indicated by the arrow is different between the two.

FIG. 6 is a photograph replacing the drawing in which the identification of the mitochondrial genome by the PCR method is represented by an electrophoresis pattern. A shows the results obtained by PCR using SEQ ID NOS: 3 and 6 in the sequence listing as primers, and B shows the results obtained by PCR using SEQ ID NOs: 3 and 5 in the sequence listing as primers. In the figure, 1 is cms—KA (fertile), 2 is cms-KA (sterility), 3 is cms—KAC (fertility), 4 is cms—KAC (sterility), 5 is normal mitochondria of Kosena radish, 6 is SW18, 7 is SW12, and 8 is FW18, 9 Represents normal rapeseed mitochondria, 10 represents pKOS2.5, 11 represents pSW18X1.7, and M represents a size marker. FIG. 7 is a photograph instead of a drawing in which each mitochondrial DNA is cut with a restriction enzyme Nc0I, and Southern hybridization using 0 rf 125 as a probe is represented by an electrophoresis pattern. In the figure, KOSB is Kosena radish with normal mitochondria, KA is cms-KA, KAC is cms-KAC, SW18 is cms rape, FW18 is rapeseed fertility return line, and SW12 is cms-rape. Wes represents rapeseed with normal mitochondria.

 FIG. 8 is a photograph instead of a drawing in which Northern hybridization using 0 rf 125 as a probe is represented by an electrophoresis pattern. In the figure, KOSB is Kosena radish with normal mitochondria, KA is cms—KA, KAC is cms—KAC, SW18 is cms rape, Wes is rape with normal mitochondria, and F and S are each acceptable. Represents fertility and sterility.

 FIG. 9 is a photograph instead of a drawing showing the result of Western analysis of mitochondrial proteins using a pit against 0 rί125. Α is an analysis of all mitochondrial proteins. In the figure, SW18 is a cms rape, WES is a fertile rape with normal mitochondria, and FW18 is a rapeseed return line. B shows the analysis of the mitochondrial protein of cms rape. In the figure, TOTAL represents the total mitochondria, SOL represents the soluble fraction, and MB represents the protein of the membrane fraction.

FIG. 10 is a diagram showing the structure of the binary vector used for the transformation. A is the binary vector pKM424. pKCMl 25 and P KCMD 125 is obtained by linking the promoter sequence, gene, and terminator sequence shown in B to the HindIII (H) and EcoRI (E) cleavage sites of the multiple cloning site (MCS) of PKM424. In the figure, 35S is the force reflower mosaic virus 35S promoter sequence, 125 is the 0 rf125 gene, D is the mitochondrial translocation sequence, NOS and NOST are the nopaline synthase gene terminator sequence, RB is the light border sequence, NPT II is a neomycin phosphotransferase gene, NOSP is a nopaline synthase gene promoter sequence, SpecR is a spectinomycin resistance gene, and TcR is a tetracycline resistance gene.

 Disclosure of the invention

 Hereinafter, the present invention will be described in detail.

 First, the genetic characteristics of the cms cytoplasm and the Rf gene of a population of Kosena radish (Rat> hasnusativs.cv.Kosena) are investigated by crossing. For example, male sterile (cms) kosena radish (R. sativus, CMS 1 ine) can be arbitrarily selected, and fertile cosena radish or cultivated radish varieties, such as sono (R. sati Vus, cv. nhong) etc. are used as pollen parents. The fertility of the next-generation individuals obtained as a result of mating between the sterile and fertile individuals is examined. Among the crosses that were crossed to sterile Kosena radish, the pollen parents of the next generation that were all fertile were considered to have the R f gene homozygously, so such pollen parents were assumed to be R f strains. I do.

Next, arbitrarily select a plurality of male sterile individuals of the Kosena radish population, and cross the same sterile individuals with a plurality of Rf lines estimated from the above results to examine fertility of the next generation. This reveals the correspondence between the cms cytoplasm and the Rf gene. Therefore, the cms of Kosena radish is introduced into a plant having the Rf gene whose correspondence has been clarified as described above, for example, by cell fusion (Japanese Patent Application Laid-Open No. 11-218530).

 Next, fertilization was completely restored with a single nuclear gene by performing a mating experiment and analyzing the number of chromosomes from plants in which a part of the mitochondria of Kosena radish was introduced by cell fusion to cms. Plants to be selected.

 Next, the gene that identifies Kosena radish CMS type cytoplasm is isolated. Specifically, mitochondria are extracted from young plants germinated from seeds of R. sativa rs (CMS line) having cms cytoplasm in accordance with a conventional method, and further DNA is extracted from the mitochondria in a conventional manner. Extract according to. After the obtained mitochondrial DNA is cleaved with an appropriate restriction enzyme, it is ligated to a cloning vector such as pUC19, which is then introduced into a competent cell of Escherichia coli. The grown E. coli colonies are copied onto a nylon membrane or the like, and colonies that hybridize when a fragment of the ogra cms cytoplasmic gene (W92 / 05251) is used as a probe are selected. Plasmid DNA is extracted from such colonies according to a conventional method, and the nucleotide sequence of the desired DNA fragment can be determined by using the dideoxy method of Sanger et al. The nucleotide sequence of the DNA fragment thus obtained includes, for example, those encoding the polypeptide represented by the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing, and preferably the nucleotide sequence shown in the sequence listing. It is represented by an array. The DNA fragment is derived from radish and modified by removing, inserting, modifying, or adding some bases within a range that does not impair the function of restoring the fertility of plants, especially cruciferous plants. No problem.

Furthermore, the cms mitochoncon, which has the property that fertility is restored by a single nuclear gene, Find genes specific to such mitochondrial genomes to distinguish doria from others. As a result, it is possible to develop a method that can easily distinguish the cytoplasm using such a gene.

 In the present invention, a recombinant mitochondrial genome can be obtained by introducing the gene obtained as described above into a nuclear genome by a known method, or by directly introducing the gene into the mitochondrial genome. Can be. Furthermore, a transformed plant or a cytoplasmic hybrid plant containing a male sterile cytoplasm having the mitochondrial genome can be obtained, and a hybrid plant can be produced using the plant. For example, when the plant is rape, a method for introducing and regenerating DNA via agrobacterium as a transformation method (Japanese Patent Laid-Open Publication No. Hei 11-500718) is a method for transforming protoplasts into a protoplast using a cytoplasmic hybrid. A method of introducing a DNA with a shion and regenerating a plant through culture is known (Plant Science, 5_2, 111-116, 1987).

 Plants to be transformed include cruciferous plants, solanaceous plants, etc., preferably rape, tobacco, etc., and more preferably rape. The hybrid plant is, for example, a method described in EP-A-599042, in which the transformed plant or the cytoplasmic hybrid plant is used as a pollination line, and the pollen fertility is restored to the cytoplasmic male sterility of the plant. This can be obtained by crossing a plant into which a fertility restoring gene has been introduced as a pollination line by a known method.

 BEST MODE FOR CARRYING OUT THE INVENTION

 Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to the following examples unless it exceeds the gist of the present invention.

Example 1 Analysis of hereditary mode of cms of Kosena radish Kosena radish (R. sativus, cv. Kosena C MS 1 ine; KosA) is arbitrarily selected, and 10 fertile cosena radish (R. sati vu s. c. v. Ko sen a) or cultivated radish varieties, R. sati vu s, c v. Y uanhong, zo, R. sati vu s., c v. X in 1 imei The parents crossed each other. The 16 individuals who were pollen parents obtained seeds by self-pollination. Next, fertility was examined for 9 to 25 individuals of the next generation of 16 cross combinations of cms kosena radish and fertile radish. Table 1 shows the results. Here the pollen parents of all combinations that were fertile, namely Kos 6, Kos 8, Xinl, Xin2, Xin4, Xin8, Yuan 1 Yuan 6 Yuan7 , Yu. An8, Yuan l0, and Yuan 13 were considered to have the Rf gene homozygously, and were designated as Rf strains.

! Table 1 mode of inheritance mating combination F of the generation of fertile fertile individual's genotype sterile X fertility ² of the recovery gene for male sterility Kosenadaikon) not稳: fertility (estimated)

K 0 s A 2 x Ko s 1 7 15 R f r f

Ko s A 11 x Ko s 5 25 0 r f r f

Kos A 11 x Kos 6 0 22 R f R f

Kos A 8 x Kos 7 6 3 R f r f

Kos A 8 x Kos 8 o 18 R f R f

Kos A 2 x X in 1 o 25 R f R f

K o s A 1 x X in 2 o 25 R f R f

Kos A 7 x X in 4 0 25 R f R f

Ko s A 11 x X i n 8 0 25 R f R f

K o s A 2 x Y u a n 1 o 25 f R f

K os A 5 x Y u a n 6 0 25 R f R f

Kos A 1 x Y u a n 7 0 25 R f R f

Ko s A 12 x Yu a n 8 0 25 R f R f

Ko s A 13 x Yu a n 9 11 14 R f r f

Kos A 14 x Yu a n 10 0 25 R f R f

Kos A 15 x Yu a n 13 0 25 R f R f

1) Ko s A: The cms line of Kosena radish (R. sativus, cv. Kosena). -

2) Shows a strain that has a gene that restores the cytoplasm of Kosena cms. Ko s: Kosena radish (R. sati vu s, cv. Ko sen a), X in: Shintomi (R. sati vu s, cv. X inl ime i) Yuan: Sono (R. _ s— at vu) s, cv. Yu anhong) ₀ Next, arbitrarily selected cms radish, Ko s 6 and Yu a η 10 were selected and crossed from the R に よ り line confirmed by the above experiment, and fertility of the next generation was examined. As a result, the fertility of the next generation is restored only by crossing with Yua η10. The next generation of cms cytoplasm (hereinafter abbreviated as “cms—KACJ”) and the crossing of both Yuan 10 and Kos 6 It was clarified that there was a cms cytoplasm (hereinafter abbreviated as “cms-KAJ”) whose fertility was fully restored.

Next, Kos 6 and Yu an 10 were crossed with an ogla radish sterile line (R. sativus, cv. 0 gura CMS line). As a result, the fertility of the next generation was completely restored in the cross with Yu an 10, but the fertility of the next generation was not restored in the cross with Ko s 6, and it was a cm s-KA recovered line. Kos 6 was found not to have the Rί gene for ogra cms. From this, it was found that in the Kosena cm s cytoplasm, there is a cytoplasm cm s-KA that is genetically different from the conventional ogra cytoplasm (hereinafter abbreviated as “cms-OGU”). Table 2 summarizes the above results.

Table 2 Results of genetic analysis of Kosena cytoplasmic male sterile cytoplasm showing a genetically different mode of recovery and the recovery gene Genetic isolation of fertile individuals in mating combination generations Genotype small 稳 X Possible Fertility Sterility ( Estimated) cms-KAC X Yu an 10 10 0 R f 1 R f 2 cms -KA XY uan 10 5 0 R f 1 R f 2 cms -OGU XY uan 10 10 0 R f 1 R f 2 cms -KAC X Ko s 6 0 8 rf 1 R f 2 cms -KA X Ko s 6 25 0 rf 1 R f 2 cms OGU X Ko s 6 0 15 rf 1 R f 2

cms-KA and cms-KAC also differed in pollen regression time from cms-OGU (Fig. 1). In Fig. 1, bud length and pollen development of radish with each cytoplasm were examined by acetocamin staining, and it was shown whether pollen regression time and the degree of development differed depending on cytoplasm and genomic composition of different nuclei. cms represents cytoplasm, and Nuc represents nuclear genomic composition. The genomic composition of the nucleus is as follows. Table 3

 Cytoplasm Nuclear symbol Nuclear genome cms-KAC kos / yuan kosena 6 x yuanhong 10 kos kosena 6 cms-KA kos kosena 5 cms-OGU kos / ogu kosena 6 x ogura 3

 The numbers shown in the ogu ogura 3 nuclear genome are the individual numbers in the original population (see Table 1). In cm s—OGU, pollen degeneration had already progressed at a bud length of 3 mm. In contrast, in cm s- KA and cm s- KAC, pollen degeneration occurs at a bud length of 4.5 mm, and this difference was the same even when the genomic composition of the nucleus was changed. The difference was thought to be due to cytoplasmic factors.

Example 2 Search for cms cytoplasm whose fertility is restored by one gene

Conventionally, attempts have been made to introduce kosena radish cm s into rapeseed (B. ^ apus) by cell fusion (JP-A-11-218530, JP-A-2-303426). This rape does not restore fertility with the genes present in the rape. The fertility of this rape was restored by crossing with radish having the Rί gene, but the number of R f genes introduced from radish was reduced. And the mode of inheritance had not been investigated. Therefore, it was determined whether or not the rapeseed cytoplasm was a cms cytoplasm recovered by a single R 、 gene, by examining the rapeseed rapeseed with the kosena radish produced by cell fusion and the mitochondrial genome of rapeseed (hereinafter “cms (Abbreviated as "rapeseed").

 Among the haploids obtained by crossing the Kosena radish R f strain Yu an 10 with the cms rape, the individual with restored fertility (hereinafter abbreviated as “cms / Rf rape”) was given the cms cytoplasm. The backcrossing of the fertile native cultivar Westar (B. napus, cv. Westar) was repeated twice. After that, extremely fertile individuals were selected and crossed with cms rape (Japanese Patent Application No. 4-1 276069). Table 4 shows the results. Table 4 Genetic analysis of Kosena recovery gene using cms rape.

 . Ding Min: A

SW18 X RF 138 84 89

 SW18 x RF 88 80 71

As a result, in the next generation, sterility and fertility appeared at a ratio of approximately 1: 1. In addition, when the chromosome of the c ms / R f rape was stained with acetocarmine and examined, the number of backcrosses was 38, the same as that of native rape. At this point, it was found that the Rms gene of cms / Rf rape was integrated into the rapeseed genome by translocation. Here, multiple R f genes are translocated to the same chromosome Was considered very unlikely. Therefore, the cms cytoplasm of this cms rape was considered to be restored to fertility by one gene, and it was revealed that the cms cytoplasm was excellent in breeding.

Example 3 Identification of cms cytoplasm by mitochondrial gene

This gene specifically present in the Ogura cms cytoplasm to (hereinafter, abbreviated as "orf 138") was carried out the isolation of homologous genes in isolated and are (WO 92/05251 discloses) _c where Kosenadaikon.

 (1) Mitochondrial DNA extraction

5 g of seeds of cosena radish (R. sativus, CMS 1 ine) having cms cytoplasm are germinated in the dark, and after 5 days, the seedlings are subjected to a mitochondrial extraction buffer [2 ml per tissue lg: 0.4 M Sorbitol ImM EDTA / 0.1% BSAZO. 1M Tris-HC 1 (pH 8.0)] and an appropriate amount of sea sand C were added, and the mixture was ground using an ice-cooled pestle and mortar. The lysate was centrifuged at 200 xg at 4 ° C for 5 minutes, and the supernatant was transferred to a new centrifuge tube. This was centrifuged at 1,500 xg, 4 ° C for 5 minutes, and the supernatant was transferred to a new centrifuge tube. This operation was repeated twice more. Then, mitochondria were precipitated by centrifugation at 15,000 Ox g at 4 ° C for 5 minutes. This precipitate was washed with a buffer solution containing 10 g of desoxyribonuclease per 1 g of young plants [0.3 M sucrose / ^ δΟπιΜ Tris—HC 1 (pH 7.5) / 1 OmM MgC 12] 2 m gently, and left at 4 ° C for 30 minutes. Put this mitochondrial suspension on top of 15 ml of She 1 f buffer [0.6 M sucrose 20 mM EDTA / 1 OmM Tris-HC 1 (pH 7.2)] at 15,000 xg, 4 ° C. Centrifuged at C for 5 minutes. The precipitated mitochondria were gently suspended again in 15 ml of Shelf buffer, and then centrifuged at 15, OOO x gs at 4 ° C for 5 minutes. Precipitated mitochondria After adding 1.5 ml of a DNA extraction buffer [1% N-lauroyl sarcosine 2 OmM EDTA / 5 OmM Tris-HC1 (pH 8.0)] to the well CsC1 was added and dissolved. After adding a bromide solution to 200 βg / m 1 and mixing, the mixture was centrifuged at 350 × 00 × g for 14 hours. The fraction containing mitochondrial DNA was collected, the bromide was removed with n-butanol, and dialyzed against a buffer of 10 mM Tris-HCl, lmM EDTA (pH 8.0) to remove CsC1. Removed.

 (2) Isolation of DNA specific to Kosena cms-type mitochondria

After mitochondrial DNA was cut with Nc0I to make it blunt-ended, it was ligated to the SmaI cleavage site of plasmid vector pUC19. This was introduced into a competent cell of Escherichia coli DH5 and cultured on an LB agar medium containing 50 g Zm1 of ampicillin. The grown E. coli colonies are transferred to a nylon membrane, lysed with 10% SDS for 5 minutes on a filter paper containing each solution, denatured with alkaline solution (1.5M NaC1 / 0.5M NaOH), After neutralization (3M sodium acetate, pH 5.2), the sample is dried at 80 ° C for 10 minutes, and then 6 XSSC (lx SSC: l5OmM NaCl, 15mM sodium citrate) For 30 minutes. The surface of the membrane was wiped lightly with a JK wiper containing 6 XSSC, washed with shaking in 6 x SSC, and completely dried at 80 ° C. Next, about 0.7 kb of the Hinc II fragment containing the Ogra cms cytoplasm-specific gene 0 rf 138 was labeled using a random primer, and used as a probe for hybridization. The hybridization was 5 XSSCP (lxSSCP: 50 mM sodium phosphate (pH 6.8), 120 mM NaC 15 mM sodium citrate), 50% formamide, 100 (ig / m 1 heat-denatured salmon sperm DNA, 0.o% skim milk, 0.5% SDS) at 42 ° C for 16 hours. Then shake the membrane in 2 x SSC at 42 ° C for 15 minutes After washing three times while washing, the plate was washed for 30 minutes at 65 ° C. Radioactivity remaining on the membrane was detected with an X-ray film, and a part of the colony where a strong signal was detected was used to culture E. coli. The plasmid DNA was extracted and contained a DNA fragment of about 2.5 kb (hereinafter abbreviated as “pKOS2.5”). Cleavage with H inc II and Southern hybridization using the above probe detected a band of about 0.65 kb.Then, the 0.65 kb H inc II fragment was converted to a plasmid vector Bluescript. II (S tratagene) was ligated to the Sma I cleavage site.Next, the nucleotide sequence of this Hinc II DNA fragment was sequenced by the dideoxy method. Constant to obtain a nucleotide sequence of 659 bp (SEQ ID NO: 1).

 A gene consisting of 125 amino acids (hereinafter referred to as “orf 125”) was present in this nucleotide sequence. 0 rf 125 had 39 bases deleted in the nucleotide sequence of 0 rf 138 of Ogura. This deletion was part of the repeated DNA sequence of 0 r f 138. Primers (SEQ ID NOS: 2 and 3 in the Sequence Listing) were prepared to detect the length of this repetitive sequence, and all of cms-KA, cms-KAC, cosena radish with normal cytoplasm, cms rape and cms-OGU were prepared. A PCR reaction was performed using 40 cycles of DNA at 94 ° C for 25 seconds, 52 ° C for 30 seconds, and 72 ° C for 1 minute and 30 seconds (Am. J. Hum. Genet., 37, 172 ( 1985)).

The migration pattern is shown in FIG. A band of 278 bp was detected in the Ogura type cms cytoplasm, and a 239 bp band was detected in the Kosena type cms cytoplasm. As a result, orf 125 is not present in the normal mitochondria of Kosena radish and cms-OGU Although not present, it was found to be present in cms-KA, cms-KAC and cms rape. From these results, it was found that 0 rf 125 is a gene that specifies the c ms mitochondria of radish.

 (3) cms—KA and cms—KAC discrimination

 Since cms-KA and cms-KAC are genetically different cytoplasms, it was thought that there was some difference in the mitochondrial genome, so two cms-type mitochondrial DNAs were extracted. Using a DNA fragment containing the tochondrial gene region, differences were detected by the Southern hybridization method. The DNA fragments used for the probe are as follows. atp A (endow), atp 9 (endow), atp 6 (enotera), cob (corn), cox I, rps l3 and nad1 (enotera), cox ll (corn), cox III (enotera) ), Rrn5, rrnl8 and nad5 (Enotera), and rrn26 (endu). Hybridization was performed under the conditions described above. As a result, a cms-KA-specific band of about 6.0 kb was detected only when a 0.5 kb EcoRI-SalI DNA fragment containing endo rrn 26 was used as a probe (Fig. 3).

Next, total RNA was extracted from the buds of fertile and sterile individuals in plants having cms-KA and cms-KAC mitochondria, respectively. RNA was extracted by the following method. After crushing 1 g of buds with a mortar and pestle in liquid nitrogen, the RNA extraction buffer [4M guanidine ocyanate Z25 mM sodium citrate (pH 7.0) /0.5% N-lauroyl sarcosine acid Sodium 0.1 M EDTA] 10 ml was mixed, transferred to a centrifuge tube, added with 1 ml of 2 M sodium acetate (pH 4.6), mixed, and further mixed with 10 ml of water-saturated phenol and 2τ1 of cloform formisoamyl alcohol ( Two 4: 1) was added and mixed well. After centrifuging at 1, 500 xg and 4 ° C for 20 minutes to separate the upper layer, extract twice with chloroform-formylisoamyl alcohol, and separate the upper layer twice. RNA was precipitated with isopropyl alcohol. After centrifugation at 15,000 xg and 4 ° C for 10 minutes, the precipitate was dissolved well by adding 1 ml of RNA extraction buffer, and 0.1 ml of 2 M sodium acetate (pH 4.6) was added. 1 ml of water-saturated phenol and 0.2 ml of clo-form Zisoamyl alcohol were added, mixed well, and centrifuged at 7,500 × 4 ° C. for 20 minutes. After the upper layer was separated and extracted twice with chloroform / isoamyl alcohol, RNA was precipitated with 2 volumes of ethanol. RNA was collected by centrifugation at 15,000 X gs at 4 ° C for 10 minutes, and then dissolved in sterile water. Next, 10 // g of each RNA was electrophoresed on a formaldehyde denaturing gel, and Northern hybridization was performed using rrn26 as a probe. Hybridization was performed under the above conditions. As a result, the same 113-1: eight. 1113-1: Plants with an 80-type mitochondria had different hybridization patterns. Regardless of fertility or sterility, cm s-KAC detected an approximately 4.5 kb band not found in cm s-KA (Fig. 4). These results indicate that cms-KA and cms-KAC differ in the mitochondrial genomic region having homology to r.rn26, and that rrn26 can be used as a probe for Southern or Northern hybridizations. I knew it could be identified.

 (4) Fertility is restored by a single Kosena Rf gene DNA fragment that identifies the cms cytoplasm of cms rape

Furthermore, in order to identify cms rape cells whose fertility was restored by a single Kosena Rf gene, a mitochondrial genome region specific to the cms rape was searched. Extract mitochondrial DNA from cms rape and limit Cleavage with the enzymes NcoI, HincII and XbaI, a DNA fragment of about 0.33 kb including the 5 ′ side of orf125 H incll—XbaI of about 0.33 kb including the Xbal and 3 ′ side — Southern hybridization was performed using each of the Hincl I fragments as a probe. As a result, the physical map of the region containing 0 rf 125 of cms rape (Fig. 5) was found to be different from that of Kosena radish. In the cms-type mitochondria of ogla radish, there is 0 rf 138 and 0 rf B immediately downstream. In Kosena radish, orf B is present immediately downstream of orf 125 in the 2.5 kb Nc I DNA fragment containing 0 rf 125 of either cms-KA or cms-KAC mitochondria (Fig. 5 ). On the other hand, the downstream of 0 rf 125 is different from that of Kosena radish in cms rape. Kosen radish cms-type mitochondrial DNA was digested with H inc II, and the Southern hybridization was carried out using an Xb a I-H inc II fragment of about 0.33 kb including the 3 'side of orf 125 as a probe. A band of about 650 b was detected, but a 2.5 kb band was detected in cms rape. The 2.5 kb HincII DNA fragment containing 0 rf 125 shown in FIG. 5 is specific to the mitochondria of cms rape, and the cytoplasm of cms rape can be identified depending on whether or not it is present.

 (5) Determination of the nucleotide sequence of the DNA fragment identifying the cms cytoplasm of the rape

The mitochondrial DNA of cms rape (line SW18) was digested with the restriction enzyme XbaI, ligated to the XbaI site of the plasmid vector ρBluescript (Stratagene), and introduced into a combinatorial cell of Escherichia coli DH5. And transformed. 0 Colony hybridization was performed using the coding region of rf125 as a probe, and the two positive Buclone was obtained. Plasmid DNA was extracted from them and a physical map was created using restriction enzymes.As a result, the two clones were PSWX2.8 containing the 5 'side of 0 rf125 and pSWXl. Containing the 3' side of orf125. It turns out to be 7

 Next, after cutting pSWXl.7 with the restriction enzyme EcoRV, it was subcloned into pBluescript II (Stratagene) and clone pSWVO.7 containing orf 125 and p containing the downstream sequence SWV0.2 was obtained. Next, the nucleotide sequences of the cloned DNA fragment and the HincII-XbaI fragment of pSWX2.8 containing the N-terminal region of 0 rf 125 were determined by the dideoxy method (SEQ ID NO: 4 in the sequence listing). . The 0 rf 125 region of the cms rape line SW18 had a sequence completely different from that of Kosena radish at the 34th base or less downstream of the stop codon of orf 125, and 0 rfB did not exist. Hereinafter, the 0 rf 125 region of the above-mentioned cms rape is referred to as or ί 125 c.

Next, the mitochondrial DNA of the cms rape was examined by PCR to determine whether or not the orf 125 region of the mitochondria of the cms radish (FIG. 5) exists in addition to 0 rf 125 c. A combination of two primers was used for PCR. One is the nucleotide sequence 5 'in the coding region of orf 125 — GACATCTAGAGAAGTTAAAAAAT— 3' (SEQ ID NO: 3 in the sequence listing) and the nucleotide sequence 5 'in the downstream region of 0 rf 125 c of pSWVO. 7 — TCTGACAGCTTACGATG— 3' (SEQ ID NO: 5 in the sequence listing). The other is a combination of SEQ ID NO: 3 in the above sequence listing and the base sequence 5′-CTAC C AGAGGTATC TATAGAAT—3 ′ downstream of 0 rf B found in pKOS2.5 (SEQ ID NO: 6 in the sequence listing). c ms rape line SW18 is about 0.55k with the former primer combination Band b was detected, but no band was detected in the latter combination (lane 6 in FIG. 6). On the other hand, in cms kosena radish and cms rape line SW12, a band of 0.55 kb was detected in the former combination, which was the same as that of line SW18, and a band of about 0.9 kb was detected in the latter combination (Fig. 6, lanes 1-4 and lane 7). Lane). This confirmed that 0 rf 125 c of the cms rape line SW18 was derived from Kosena radish cms-type mitochondria. Based on the above, the mitochondrial genome of cms rape line SW18 is the one in which 0r r125c was selectively introduced during cell fusion with Kosena radish, and it can be easily distinguished from the cms-type mitochondrial genome of Kosena radish by PCR. I knew I could do it.

 (6) Relationship between 0 r f 125 and male sterility

 All mitochondrial RNAs were extracted from the buds of cms radish and rapeseed rape by the method described above, and Northern hybridization was performed by the method described above using the coding region of 0 rf 125 as a probe. A 1.4 kb band was detected in cm sap radish and a 1.2 kb band in cms rape (FIG. 8), indicating that 0 rf 125 c was transcribed in the mitochondria of cms rape.

A completely fertile individual was found in a next-generation plant population obtained by crossing the rapeseed pollen with normal cytoplasm and no R f in the cms rape line SW18. All the self-pollinated progeny of this individual had fertility, and this was designated as rapeseed fertility reverting line FW18. Examination of the presence of 0 rf 125 in the mitochondrial genome of this strain FW18 by PCR and Southern hybridization revealed that 0 rf 125 was not detected by either method (lane 8 in Figure 6). , Figure 7). From the above results, it was clarified that oril 25 is a causative gene of CMS. (7) Plant transformation with orf 125 gene

 Mitochondria were purified from the seedlings 5 days after germination and growth in the dark, and about 1 O ^ g of mitochondrial total protein was fractionated on a 12% SDS-polyacrylamide gel. Western analysis using an antibody to the 15th amino acid sequence from the 78th to the 92nd amino acid sequence revealed that cms rape showed about 17 motility, which was not found in fertile rapeseed with normal mitochondria and rapeseed revertible line. A specific band of kDa was detected (Fig. 9A). Next, the mitochondrial protein purified from cms rape was separated into a soluble fraction and a membrane fraction, and Western analysis was performed using the above antibodies.As a result, 17 kDa polypeptide was present in the membrane fraction of cms rape (Fig. 9B). orf 125, like the previously reported maize cms gene product urf 13 protein, is thought to inhibit the normal function of mitochondria by being present in the mitochondrial membrane (Proc. Nat USA, 8, 5374-5378 (1987); Science, 2_3_9, 293-295 (1988); Proc. Natl. Ac ad. Sci. USA, 8_6, 4435-4439 (1989); EMBO J., 9_, 339-347 (1990)).

Thus, orf 125 was introduced into tobacco by the agrobacterium method, and the effect of 0 rf 125 on plant cells was investigated. 0 rf125 gene, or F. of sweet potato. The transfer sequence of the Fi ATPase S subunit to the mitochondrial dryer (Plant Cell Physiol., 3_4, 177-183 (1993)) was added to the chimeric gene added to orf 125 to cauliflower mosaic virus 35, respectively. S promoter (35S) and nopaline synthase gene terminator (NOST) The vector was ligated to the HindIII and EcoRI cleavage sites of the multiple cloning site of the vector pKM424 to obtain pKCM125 and pKCMD125, respectively (FIGS. 10A and 10B). For control experiments, pLAN411 containing 35 S, ^ -glucuronidase gene (GUS) and NOST was used (P1antcell Rep., _1_0, 286-290 (1991)). Next, each of the binary vectors was introduced into Agrobacterium EHA101 strain by a freeze / thaw method. Transformation of tobacco was performed as follows according to the method of Rogers et al. (Methods Enzymo 1., 11_8. 627-640 (1 986)). EHA101 into which the binary vector was introduced was cultured with shaking at 27 ° C. for about 16 hours in a YEB medium containing 50 gZm1 spectinomycin, 2.5 g / 1 tetracycline and 50βg / 1 kanamycin. Approximately 1 cm square cut tobacco aseptic leaves are floated on an MS medium containing 3% sucrose (about 20 per experiment), and the above-mentioned agrobacterium culture solution is added to the MS medium at 1Z50 volume and added at 27 ° C. For 2 days and nights for co-culture. The co-cultured tobacco leaf sections were placed on an MS medium containing 0.2 mg / 16-benzylaminopurine, 200 gZm 1 kanamycin, 500 gZm 1 claforan, 3% sucrose and 0.2% gel light, and placed at 27 ° C. C for about 20 days. The regeneration rate of the plant by this method was determined by calculating the number of adventitious buds formed / the number of whole leaf sections. Table 5 shows the results.

Table 5 Effect of transformation of orf 125 on adventitious bud formation in plants

—Adventitious bud formation rate per leaf section

Experiment times

 p LAN4 pKCMl 25 pKCMD 125

0.46 0.32 0.14

2 0.83 0.13 0.02

 3 0.33 0.12

 4 1.10

 5 0.67

As a result, in the transformation with pLAN411, the adventitious bud formation rate per leaf section was 0.68 on average, whereas it was 0.22 for PKCM125 and 0.07 for 10? ^ 0125. In addition, the leaf section of tapaco with adventitious buds was transplanted to a new MS medium having the above composition, and cultivation was continued. When the adventitious buds reached 1-2 cm, the leaf section was cut off, and kanamycin and 6-benzylaminopurine were removed. When grown on the above-mentioned MS medium without containing and examined for the morphology of the subsequent plants, most of the GUS-introduced plants showed a normal morphology, whereas the plants into which 0 rf 125 had been introduced exhibited a glass-like morphology. Plants showing abnormalities appeared frequently (Table 6). Table 6 Effects of orf 125 on the morphology of regenerated plants

 Vector reproduction population

 %% P LAN411 30 0 0 pKCMl 25 16 3 19 pKCMD 125 30 13 81

The above results indicate that the presence of orfl 25 in mitochondria affects the morphogenesis of plant cells, and that 0 rf 125 was introduced into plants by a transformation method to transform male sterile plants. It indicated that production was possible.

 The invention's effect

 INDUSTRIAL APPLICABILITY The cytoplasmic gene of the present invention is effective as a new cms cytoplasmic gene that can be used for hybrid seed production of plants, for example, cruciferous plants, and quickly recognizes a cosena cms cytoplasm, which is a new cytoplasm exhibiting a trait useful for breeding. Useful to distinguish.

In addition, by introducing the obtained gene into the nuclear genome or directly into the mitochondrial genome, it is possible to add CMS to plants as well as crucifers. Sequence listing

SEQ ID NO: 1

Array length: 6 5 9

Sequence type: nucleic acid

Number of chains: double strand

 Topology: linear

Sequence type: Genomic DNA Organism name: Raphanus sativus

 Stock name: Kosena radish

 Organelle name: mitochondria

Array features

 Characteristic symbol: CDS

 Location: 1 6 2.. 5 3 6

 How the features were determined: S

Array

 AACTCATCAG GCTCATGACC TGAAGATTAC AGGTTCAAAT CCTGTCCCCG CACCGTAGTT 60 TCATTCTGCA TCACTCTCCC TGTCGTTATC GACCTCGCAA GGTTTTTGAA ACGGCCGAAA 120 CGGGAAGTGA CAATACCGCT TTTCTTCAGC ATATAAATGC A ATG ATT ACC TTTTC

 Met lie Thr Phe Phe 1 5

GAA AAA TTG TCC ACT TTT TGT CAT AAT CTC ACT CCT ACT GAA TGT AAA 224 Glu Lys Leu Ser Thr Phe Cys His Asn Leu Thr Pro Thr Glu Cys Lys

 10 15 20

GTT AGT GTA ATA AGT TTC TTT CTT TTA GCT TTT TTA CTA ATG GCC CAT 272 Val Ser Val lie Ser Phe Phe Leu Leu Ala Phe Leu Leu Met Ala His

25 30 35

ATT TGG CTA AGC TGG TTT TCT AAC AAC CAA CAT TGT TTA CGA ACC ATG 320 lie Trp Leu Ser Trp Phe Ser Asn Asn Gin His Cys Leu Arg Thr Met

 40 45 50

 AGA CAT CTA GAG AAG TTA AAA ATT CCA TAT GAA TTT CAG TAT GGG TGG 368 Arg His Leu Glu Lys Leu Lys lie Pro Tyr Glu Phe Gin Tyr Gly Trp

 55 60 65

 CTA GGT GTC AAA ATT ACA ATA AAA TCA AAT GTA CCT AAC GAT GAA GTG 416 Leu Gly Val Lys lie Thr lie Lys Ser Asn Val Pro Asn Asp Glu Val 70 75 80 85

ACG AAA AAA GTC TCA CCT ATC ATT AAA GGG GAA ATA GAG GGG AAA GAG 464 Thr Lys Lys Val Ser Pro lie lie Lys Gly Glu He Glu Gly Lys Glu

 90 95 100

 GAA AAA AAA GAG GGG AAA GGG GAA ATA GAG GGG AAA GAG GAA AAA AAA 512 Glu Lys Lys Glu Gly Lys Gly Glu lie Glu Gly Lys Glu Glu Lys Lys

 105 110 115

 GAG GTG GAA AAT GGA CCG AGA AAA TAATGCTTTG TGAACCCAAT TGCTTTGACA 566 Glu Val Glu Asn Gly Pro Arg Lys Stop

 120 125

AAAATAAAGA AAGAAGCAAA ATCTCATTCA ATTTGAAATA GAAGAGATCT CTATGCCCCC 626 TGTTCTTGGT TTTCTCCCAT GCTTTTGTTG GTC 659 SEQ ID NO: 2

Array length: 2 2

Sequence type: nucleic acid Number of chains: single strand

 Topology: linear

Sequence type: Other nucleic acid Synthetic DNA

Array

 GACATCTAGA GAAGTTAAAA AT 22 SEQ ID NO: 3

Array. Length: 22

Sequence type: nucleic acid

Number of chains: single strand

 Topology: linear

Sequence type: Other nucleic acid Synthetic DNA

Array

 AGCAATTGAA TTCACAAAGC AT 22 SEQ ID NO: 4

Sequence length: 1242

Sequence type: nucleic acid

Number of chains: double strand

 Topology: linear

Sequence type: Genom i c DNA

Origin

 Organism name: Brassica naps. (Brassic acanapus) Strain name: SW18

 Organelle name: mitochondria

Array

AACTCATCAG GCTCATGACC TGAAGATTAC AGGTTCAAAT CCTGTCCCCG CACCGTAGTT 60 TCATTCTGCA TCACTCTCCC TGTCGTTATC GACCTCGCAA GGTTTTTGAA ACGGCCGAAA 120 CGGGAAGTGA CAATACCGCT TTTCTTCAGC ATATAAATGC AATGATTACC TTTTTCGAAA 180

AATTGTCCAC TTTTTGTCAT AATCTCACTC CTACTGAATG TAAAGTTAGT GTAATAAGTT 240

TCTTTCTTTT AGCTTTTTTA CTAATGGCCC ATATTTGGCT AAGCTGGTTT TCTAACAACC 300

AACATTGTTT ACGAACCATG AGACATCTAG AGAAGTTAAA AATTCCATAT GAATTTCAGT 360

ATGGGTGGCT AGGTGTCAAA ATTACAATAA AATCAAATGT ACCTAACGAT GAAGTGACGA 420

AAAAAGTCTC ACCTATCATT AAAGGGGAAA TAGAGGGGAA AGAGGCAAAA AAAGAGGGGA 480

AAGGGGAAAT AGAGGGGAAA GAGGAAAAAA AAGAGGTGGA AAATGGACCG AGAAAATAAT 540

GCTTTGTGAA CCCAATTGCT TTGACAAAAA TATATGAAGA ATCAGTGCTA TTGAGGAACA 600

TTTTATAGAA AGAAAAGAAA AAGAAGCAAT AGTAAAGGAG GGCTTTCCCA GTGCATGAAG 660

GGAGGGTGAA GCAGGGTAAG TCATAAGAAT CCGCTTTGTT ACAAAGACCT CCTGCTATGC 720

TAATGAGGGG TCTTAAGCAA ACAAAGTACC AAGAACTTTG GATATTATCC GTTTTTCTAT 780

TATATCCCAT TTTATCCTTC CGCTTTAGGA TTAGCCCAGC TTTTTCGAAA CGGACGGAAG 840

GCCTAACTAG AAGCTATTTG GCGCCTTCCC CTCGATGAAT ACTTGGAAAT TTGTCTTGCA 900

TCGTAAGCTG TCAGAAGAAA GTAAGACTTA GAAAGAAGAC AGTAAGTAAG AGAACTACGA 960

TTTACTTGAT TCCCAAAGTG GTACGTAGGC AGCCAAGGAC GAATCCTTAT CCAGTTCTTT 1020

GTTAGTAAGT GAGGAAAAGA TATCAAACTT TTTTTTGAAA AAAGTTCGTA GTTAATCTAC 1080

CTCGGACGTA CCCATGGCGT GTGGGGTTCG CGTGGGGAAC CGAGTAACCA AAGTCACGAT 1140

CAGTCTAAGG TTGAAATCTG GATGGTCTTT TTGCCAGACG CGCTGGTTCG AGTCCAGCTC 1200

GTGACAAAAG GCTACCCTTT CTCTTAAGAG AATCTCGATA TC 1242 SEQ ID NO: 5

Array length: 1 7

Sequence type: nucleic acid

Number of chains: single strand

Topology: linear Sequence type: Other nucleic acid Synthetic DNA

Array

 TCTGACAGCT TACGATG 17 SEQ ID NO: 6

Array length: 22

Sequence type: nucleic acid

Number of chains: single strand

 Topology: linear

Sequence type: Other nucleic acid Synthetic DNA

Array

 CTACCAGAGG TATCTATAGA AT 22

Claims

The scope of the claims

1. A gene encoding a polypeptide represented by the amino acid sequence described in SEQ ID NO: 1 in the sequence listing.

 2. The gene according to claim 1, which is represented by the nucleotide sequence of SEQ ID NO: 1 in the sequence listing.

 3. The gene c according to claim 2, which is derived from Kosena radish.

4. A DNA fragment comprising the gene encoding the polypeptide of claim 3, which is represented by the nucleotide sequence of SEQ ID NO: 4 in the sequence listing.

 5. A transformed plant or a hybrid cell plant into which the gene according to claim 1 has been introduced.

 6. A transformed plant or cytoplasmic hybrid plant into which the DNA fragment according to claim 4 has been introduced.

 7. The transformed plant or cytoplasmic hybrid plant according to claim 6, wherein the plant is a Brassicaceae plant.

 8. The transformed plant or cytoplasmic hybrid plant according to claim 7, wherein the plant is rape.

 9. A transgenic plant or a cytoplasmic hybrid plant having the cytoplasmic male sterility trait according to claim 5 to claim 8 as a pollinating line, and fertility for restoring pollen fertility to the cytoplasmic male sterility. A method for producing a hybrid plant, comprising breeding a plant into which a recovery gene has been introduced as a pollination line.

 10. A hybrid plant obtained by the method according to claim 9.