US20030175747A1 - Electrophoretic tag libraries - Google Patents

Electrophoretic tag libraries Download PDF

Info

Publication number
US20030175747A1
US20030175747A1 US10/267,411 US26741102A US2003175747A1 US 20030175747 A1 US20030175747 A1 US 20030175747A1 US 26741102 A US26741102 A US 26741102A US 2003175747 A1 US2003175747 A1 US 2003175747A1
Authority
US
United States
Prior art keywords
target
tag
tags
binding
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/267,411
Inventor
Sharat Singh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/303,029 external-priority patent/US6322980B1/en
Priority claimed from US09/561,579 external-priority patent/US6682887B1/en
Application filed by Individual filed Critical Individual
Priority to US10/267,411 priority Critical patent/US20030175747A1/en
Publication of US20030175747A1 publication Critical patent/US20030175747A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/14—Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support
    • C40B50/16—Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support involving encoding steps
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals
    • C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B20/00—Methods specially adapted for identifying library members
    • C40B20/08—Direct analysis of the library members per se by physical methods, e.g. spectroscopy
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B70/00—Tags or labels specially adapted for combinatorial chemistry or libraries, e.g. fluorescent tags or bar codes
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries

Definitions

  • the field of this invention is electrophoretically separable compositions for use in multiplex detection.
  • the snp's will be in non-coding regions, primarily between genes, but will also be present in exons and introns. In addition, the great proportion of the snp's will not affect the phenotype of the individual, but will clearly affect the genotype.
  • the snp's have a number of properties of interest. Since the snp's will be inherited, individual snp's and/or snp patterns may be related to genetic defects, such as detections, insertions and mutations involving one or more bases in genes. Rather than isolating and sequencing the target gene, it will be sufficient to identify the snp's involved.
  • the snp's may be used in forensic medicine to identify individuals. While other genetic markers are available, the large number of snp's and their extensive distribution in the chromosomes, make the snp's an attractive target. Also, by determining a plurality of snp's associated with a specific phenotype, one may use the snp pattern as an indication of the phenotype, rather than requiring a determination of the genes associated with the phenotype.
  • nucleic acid sequences provide extreme diversity for situations that may be of biological or other interest, there are other types of compounds, such as proteins in proteomics that may also offer opportunities for multiplexed determinations.
  • Holland Proc. Natl. Acad. Sci. USA (1991) 88:7276 discloses that the exonuclease activity of the thermostable enzyme Thermus aquaticus DNA polymerase in PCR amplification to generate specific detectable signal concomitantly with amplification.
  • Marino, Electrophoresis ( 1996) 17:1499 describes low-stringency-sequence specific PCR (LSSP-PCR).
  • LSSP-PCR low-stringency-sequence specific PCR
  • a PCR amplified sequence is subjected to single primer amplification under conditions of low stringency to produce a range of different length amplicons. Different patterns are obtained when there are differences in sequence. The patterns are unique to an individual and of possible value for identity testing.
  • SSCP Single strand conformational polymorphism
  • Pastinen, Clin. Chem. (1996) 42:1391 amplifies the target DNA and immobilizes the amplicons.
  • Multiple primers are then allowed to hybridize to sites 3′ and contiguous to an SNP site of interest. Each primer has a different size that serves as a code.
  • the hybridized primers are extended by one base using a fluorescently labeled dideoxynucleoside triphosphate. The size of each of the fluorescent products that is produced, determined by gel clectrophoresis, indicates the sequence and, thus, the location of the SNP. The identity of the base at the SNP site is defined by the triphosphate that is used.
  • a similar approach is taken by Haff, Nucleic Acids Res.
  • Hacia, Nat. Genet. (1996) 14:441 uses a high density array of oligonucleotides. Labeled DNA samples were allowed to bind to 96,600 20-base oligonucleotides and the binding patterns produced from different individuals were compared. The method is attractive in that SNP's can be directly identified, but the cost of the arrays is high and non-specific hybridization may confound the accuracy of the genetic information.
  • U.S. Pat. No. 5,807,682 describes probe compositions for detecting a plurality of nucleic acid targets.
  • Systems comprising libraries of compositions for linking to or linked to assay reagents for performing simultaneous determinations in a single container.
  • the systems combine entities that comprise e-tags (electrophoretic tags capable of being separated electrophoretically with the entities to which they are attached in a specific determination) that include mobility-identifying regions comprising a first functionality bonded to an assay reagent and a second functionality bonded to or for bonding to a detectable label, with a sample under conditions which produce an analyte-dependent detectable change in the mobility of the entities, means for moving the modified entities to an electrophoretic device, and a data processor for processing the data from the electrophoretic device.
  • e-tags epidermatitis
  • Libraries are employed comprising a plurality of e-tag containing compositions, where the e-tags are joined to assay reagents, a unit of an assay reagent or provide a functionality for linking to an assay reagent, where the linkage may be cleavable.
  • the assays employ reagents for homogeneous (no required separation step) or heterogeneous (a separation step required) protocols.
  • the libraries comprise entities comprising electrophoretic tags that are small molecules (molecular weight of 150 to 5,000), usually other than oligomers, which can be used in any measurement technique that permits identification by mass, e.g. mass spectrometry, and or mass/charge ratio, as in mobility in electrophoresis.
  • Simple variations in mass and/or mobility of the c-tag leads to generation of a library of e-tags, that can then be used to detect a plurality of individual events associated with different molecular species, generally related species.
  • the e-tags are designed to be easily and rapidly separated, particularly in free solution without the need for a polymeric separation media. Quantitation is achieved using internal controls. Enhanced separation of the e-tags comprising a nucleotide in electrophoresis is achieved by modifying the tags with positively charged moieties.
  • FIGS. 1A, B and C depict the specific sequences of the snp detection sequences for the two alleles, the optical characteristics of the fluorescent dyes, and the cleaved fragments from the snp detection sequences, respectively;
  • FIGS. 2A and B depict the CE separation of the reaction products of Allele 1 after 0 and 40 cycles.
  • CE instrument Beckman P/ACE/ 5000 with LIF detection.
  • BGE 2.5% LLD 30, 7M urea, 1 ⁇ TBE.
  • Injection 5 s at 2.0 kV.
  • FIGS. 3A and B depict the CE separation of the reaction products of Allele 1 after 0 and 40 cycles. Experimental conditions are the same as FIG. 2, except for BGE composition; 2% LDD30, 1 ⁇ TBE;
  • FIG. 4 is a graph of the CE separation of a 1:1 mixture of the 40 cycles products of Alleles 1 and 2, with experimental conditions as described for FIG. 2;
  • FIG. 5 is a graph of the CE separation of a 1:10 mixture of the 40 cycles products of Alleles 1 and 2, with experimental conditions as described for FIG. 2;
  • FIG. 6 is an electopherogram of e-tags, which involved a separation involving a 1000-fold difference in concentration
  • FIGS. 7 a , 7 b are the electropherograms of the analysis of 5 snps of the cystic fibrosis genes using multiplexed PCR and the subject e-tag probes.
  • FIG. 7 c is the electropherogram of the analysis of single snps and triple x snps for the cystic fibrosis genes using multiplexed PCR and the subject e-tag probes along with an agarose gel separation of the triple x PCR;
  • FIG. 8 is an electropherogram of a separation of 9 negatively charged e-tag probes.
  • FIGS. 9A and 9B are electropherograms of probes employing a penultimate thiophosphate linkage in the e-tag probes to discourage cleavage after the first phosphate linkage;
  • FIG. 10 is a cartoon of a system for performing multiplexed determinations using e-tags.
  • a system for the simultaneous multiplexed determination of a plurality of events employing electrophoresis to distinguish the events, comprising an electrophoretic device for electrophoretic separation and detection, a container containing a first set of first agents, referred to as “e-tags,” comprising differing mobility regions and a second reagent composition comprising at least one active second agent, under conditions where said second agent modifies at least one member of said first agent set resulting in a change of electrophoretic mobility of said at least one member to provide a modified member retaining said mobility region, and transfer of said at least one modified member to said electrophoretic device for separation and detection of said at least one modified member.
  • the electrophoretic device may be connected to a data processor for receiving and processing data from the device, as well as operating the electrophoretic device
  • the systems are based on having libraries available comprising a plurality of e-tags that comprise at least a plurality of different mobility-identifying regions, so as to be separable in an electrophoresis with the entities to which the mobility-identifying regions are attached.
  • the mobility-identifying regions are retained in the product of the reaction, where the product is modified by the gain and/or loss of a group that changes the mass and may also change the charge of the product, as compared to the starting material.
  • the mobility-identifying region may be joined to a target-binding region by a cleavable bond, so that the mobility-identifying region is released for analysis subsequent to the modification of the target-binding region, e.g. complex formation.
  • the subject invention provides compositions and methods for improved analysis of complex mixtures, where one is interested in the simultaneous identification of a plurality of entities, such as nucleic acid or amino acid sequences, snps, alleles, mutations, proteins, haptens, protein family members, expression products, etc., analysis of the response of a plurality of entities to an agent that can affect the mobility of the entities, and the like.
  • Libraries of differentiable compounds are provided, where the compounds comprise a mobility-identifying region (including mass-identifying region) (“mir”), that provides for ready identification by electrophoresis or mass spectrometry (differentiation by mobility in an electrical field or magnetic field), by itself or in conjunction with a detectable label.
  • the product may also include one or more nucleotides or their equivalent, one or more amino acids or their equivalent, a functionality resulting from the release of the target-binding region or a modified functionality as a result of the action of an agent on the target-binding region.
  • the methodology involves employing detectable tags that can be differentiated by electrophoretic mobility or mass.
  • the tags comprise mobility-identifying regions joined to a moiety that will undergo a change to produce a product.
  • the change may involve a change in mass and/or charge of the mir, the release of the mir from all or a portion of the target-binding region or may provide for the ability to sequester the mir from the starting material for preferential release of the mir.
  • the differentiable tags, whether identified by electrophoresis or mass spectrometry, comprising the mir, with or without the detectable label and a portion of the target-binding region will be referred to as “e-tags.”
  • the subject invention employs a variety of reagent systems, where a binding event results in a change in mobility of the e-tag.
  • the binding event is between a target-binding region and a target, and the reagent system recognizes this event and changes the nature of the e-tag containing target-binding region, so that the mobility and/or mass of the product is different from the starting material.
  • the reagent system will frequently involve an enzyme and the reagent system may comprise the target.
  • the effect of the reagent system is to make or break a bond by physical, chemical or enzymatic means.
  • Each of the products of the different e-tag containing target-binding regions can be accurately detected, so as to determine the occurrence of the binding event.
  • the subject invention may be used for a variety of multiplexed analyses involving the action of one or more agents on a plurality of reagents comprising the mir and a target-binding region that undergoes a change as a result of a chemical reaction, resulting in a change in mobility of the product as compared to the starting material.
  • the reaction may be the result of addition or deletion in relation to the target-binding region, so that the resulting product may be sequestered from the starting material.
  • the subject systems find use in nucleic acid and protein analyses, reactions, particularly enzyme reactions, where one or more enzymes are acting on a group of different potential or actual substrates, and the like.
  • the e-tags are a group of reagents having a mir that with the other regions to which the mir is attached during separation provide for unique identification of an entity of interest.
  • the mir of the e-tags can vary from a bond to about 100 atoms in a chain, usually not more than about 60 atoms, more usually not more than about 30 atoms, where the atoms are carbon, oxygen, nitrogen, phosphorous, boron and sulfur.
  • the mir will have from 0 to 40, more usually from 0 to 30 heteroatoms, which in addition to the heteroatoms indicated above will include halogen or other heteroatom.
  • the total number of atoms other than hydrogen will generally be fewer than 200 atoms, usually fewer than 100 atoms.
  • various cations may be associated with the acid group.
  • the acids may be organic or inorganic, including carboxyl, thionocarboxyl, thiocarboxyl, hydroxamic, phosphate, phosphite, phosphonate, sulfonate, sulfinate, boronic, nitric, nitrous, etc.
  • substituents will include amino (includes ammonium), phosphonium, sulfonium, oxonium, etc., where substituents will generally be aliphatic of from about 1-6 carbon atoms, the total number of carbon atoms per heteroatom, usually be less than about 12, usually less than about 9.
  • the mir may be neutral or charged depending on the other regions to which the mir is attached, at least one of the regions having at least one charge.
  • Neutral mirs will generally be polymethylene, halo- or polyhaloalkylene or aralkylene (a combination of aromatic—includes heterocycleic—and aliphatic groups), where halogen will generally be fluorine, chlorine, bromine or iodine, polyethers, particularly, polyoxyalkylene, wherein alkyl is of from 2-3 carbon atoms, polyesters, e.g. polyglycolide and polylactide, dendrimers, comprising ethers or thioethers, oligomers of addition and condensation monomers, e.g. acrylates, diacids and diols, etc.
  • the side chains include amines, ammonium salts, hydroxyl groups, including phenolic groups, carboxyl groups, esters, amides, phosphates, heterocycles, particularly nitrogen heterocycles, such as the nucleoside bases and the amino acid side chains, such as imidazole and quinoline, thioethers, thiols, or other groups of interest to change the mobility of the e-tag.
  • the mir may be a homooligomer or a heterooligomer, having different monomers of the same or different chemical characteristics, e.g., nucleotides and amino acids. Desirably neutral mass differentiating groups will be combined with short charged sequences to provide the mir.
  • the charged mirs will generally have only negative or positive charges, although, one may have a combination of charges, particularly where a region to which the mir is attached is charged and the mir has the opposite charge.
  • the mirs may have a single monomer that provides the different functionalities for oligomerization and carry a charge or two monomers may be employed, generally two monomers.
  • One may use substituted diols, where the substituents are charged and dibasic acids.
  • Illustrative of such oligomers are the combination of diols or diamino, such as 2,3-dihydroxypropionic acid, 2,3-dihydroxysuccinic acid, 2,3-diaminosuccinic acid, 2,4-dihydroxyglutaric acid, etc.
  • diols or diamino compounds can be linked by dibasic acids, which dibasic acids include the inorganic dibasic acids indicated above, as well as dibasic acids, such as oxalic acid, malonic acid, succinic acid, maleic acid, furmaric acid, carbonic acid, etc.
  • dibasic acids include the inorganic dibasic acids indicated above, as well as dibasic acids, such as oxalic acid, malonic acid, succinic acid, maleic acid, furmaric acid, carbonic acid, etc.
  • esters one may use amides, where amino acids or diamines and diacids may be employed.
  • oligomers By employing monomers that have substituents that provide for charges or which may be modified to provide charges, one can provide for mirs having the desired mass/charge ratio. For example, by using serine or threonine, one may modify the hydroxyl groups with phosphate to provide negatively charged mirs. With arginine, lysine and histidine, one provides for positively charged mirs. Oligomerization may be performed in conventional ways to provide the appropriately sized mir. The different mirs having different orders of oligomers, generally having from 1 to 20 monomeric units, more usually about 1 to 12, where a unit intends a repetitive unit that may have from 1 to 2 different monomers. For the most part, oligomers will be used with other than nucleic acid target-binding regions.
  • the polyfunctionality of the monomeric units provides for functionalities at the termini that may be used for conjugation to other moieties, so that one may use the available functionality for reaction to provide a different functionality. For example, one may react a carboxyl group with an aminoethylthiol, to replace the carboxyl group with a thiol functionality for reaction with an activated olefin.
  • monomers that have 1-3 charges By using monomers that have 1-3 charges, one may employ a low number of monomers and provide for mobility variation with changes in molecular weight.
  • polyolpolycarboxylic acids having from about two to four of each functionality, such as tartaric acid, 2,3-dihydroxyterephthalic acid, 3,4-dihydroxyphthalic acid, ⁇ 5 -tetrahydro-3,4-dihydroxyphthalic acid, etc.
  • these monomers may be oligomerized with a dibasic acid, such as a phosphoric acid derivative to form the phosphate diester.
  • the carboxylic acids could be used with a diamine to form a polyamide, while the hydroxyl groups could be used to form esters, such as phosphate esters, or ethers such as the ether of glycolic acid, etc.
  • esters such as phosphate esters, or ethers such as the ether of glycolic acid, etc.
  • various aliphatic groups of differing molecular weight may be employed, such as polymethylenes, polyoxyalkylenes, polyhaloaliphatic or—aromatic groups, polyols, e.g. sugars, where the mobility will differ by at least about 0.01, more usually at least about 0.02 and more usually at least about 0.5.
  • the libraries may include oligopeptides for providing the charge, particularly oligopeptides of from 2-6, usually 2-4 monomers, either positive charges resulting from lysine, arginine and histidine or negative charges, resulting from aspartic and glutamic acid.
  • oligopeptides for providing the charge
  • the libraries may include oligopeptides for providing the charge, particularly oligopeptides of from 2-6, usually 2-4 monomers, either positive charges resulting from lysine, arginine and histidine or negative charges, resulting from aspartic and glutamic acid.
  • oligopeptides for providing the charge
  • oligopeptides of from 2-6 usually 2-4 monomers, either positive charges resulting from lysine, arginine and histidine or negative charges, resulting from aspartic and glutamic acid.
  • unnatural or-synthetic amino acids such as taurine, phosphate substituted serine or threonine, S- ⁇ -succiny
  • the e-tags are used for mass detection, as with mass spectrometry, the e-tags need not be charged but merely differ in mass, since a charge will be imparted to the e-tags by the mass spectrometer.
  • the e-tags need not be charged but merely differ in mass, since a charge will be imparted to the e-tags by the mass spectrometer.
  • the functionalities would be neutral or made neutral, such as esters and amides of carboxylic acids.
  • the libraries will ordinarily have at least about 5 members, usually at least about 10 members, and may have 100 members or more, for convenience generally having about 50-75 members. Some members may be combined in a single container or be provided in individual containers, depending upon the region to which the mir is attached.
  • the members of the library will be selected to provide clean separations in electrophoresis, when capillary clectrophoresis is the analytical method. To that extent, mobilities will differ as described above, where the separations may be greater, the larger the larger the number of molecules in the band to be analyzed. Particularly, non-sieving media may be employed in the separation.
  • An e-tag will be a molecule, which is labeled with a directly detectable label or can be made so by having a functionality that can be used for bonding to a detectable label, if such label is required for detection.
  • the e-tags will be differentiated by their electrophoretic mobility, usually their mass/charge ratio, to provide different mobilities for each e-tag. Although in some instances the e-tags may have identical mass/charge ratios, such as oligonucleotides, but differ in size or shape and therefore exhibit different electrophoretic mobilities under appropriate conditions. Therefore, the tags will be amenable to electrophoretic separation and detection, although other methods of differentiating the tags may also find use.
  • the e-tag may be joined to any convenient site on the target binding reagent, without interfering with the synthesis, release and binding of the e-tag labeled reagent.
  • the e-tag may be bound to a site on the base, either an annular carbon atom or a hydroxyl or amino substituent.
  • the e-tag may be linked by a stable bond or one, which may be cleavable, thermally, photolytically or chemically.
  • cleavage of the target-binding region results in significant cleavage at other than the desired site of cleavage, resulting in satellite cleavage products, such as di- and higher oligonucleotides and this family of products interferes with the separation and detection of the e-tags.
  • the tags rather than requiring an additional step in the identification of the tags by releasing them from the base to which they are attached, one can modify the target binding sequence to minimize obtaining cleavage at other than the desired bond, for example, the ultimate or penultimate phosphate link in a nucleic acid sequence.
  • bonding of the e-tag will usually be through a cleavable bond to a convenient functionality, such as carboxy, hydroxy, amino or thiol, particularly as associated with proteins, lipids and saccharides.
  • cleavable link resulting in release of the e-tag may be varied widely. Numerous linkages are available, which are thermally, photolytically or chemically labile. See, for example, U.S. Pat. No. 5,721,099. Where detachment of the product from all or a portion of the target-binding region is desired, there are numerous functionalities and reactants, which may be used. Conveniently, ethers may be used, where substituted benzyl ether or derivatives thereof, e.g. benzhydryl ether, indanyl ether, etc. may be cleaved by acidic or mild reductive conditions.
  • beta-elimination where a mild base may serve to release the product.
  • Acetals including the thio analogs thereof, may be employed, where mild acid, particularly in the presence of a capturing carbonyl compound, may serve.
  • an ⁇ -chloroether is formed. This may then be coupled with an hydroxy functionality to form the acetal.
  • Various photolabile linkages may be employed, such as o-nitrobenzyl, 7-nitroindanyl, 2-nitrobenzhydryl ethers or esters, etc.
  • Various functionalities for cleavage are illustrated by: silyl groups being cleaved with fluoride, oxidation, acid, bromine or chlorine; o-nitrobenzyl with light; catechols with cerium salts; olefins with ozone, permanganate or osmium tetroxide; sulfides with singlet oxygen or enzyme catalyzed oxidative cleavage with hydrogen peroxide, where the resulting sulfone can undergo elimination; furans with oxygen or bromine in methanol; tertiary alcohols with acid; ketals and acetals with acid; ⁇ - and ⁇ -substituted ethers and esters with base, where the substituent is an electron withdrawing group, e.g., sulfone, sulfoxide, ketone, etc., and the like
  • the mir will link the target-binding region and the detectable label molecule, usually a fluorescer, or a functionality, which may be used for linking to a detectable label molecule.
  • a fluorescer usually a fluorescer
  • a functionality which may be used for linking to a detectable label molecule.
  • the mir may be an oligomer, where the monomers may differ as to mass and charge.
  • monomers will generally be commercially available, but if desired, they may be originally synthesized.
  • Monomers which are commercially available and readily lend themselves to oligomerization include amino acids, both natural and synthetic, monosaccharides, both natural and synthetic, while other monomers include hydroxyacids, where the acids may be organic or inorganic, e.g. carboxylic, phosphoric, boric, sulfonic, etc., and amino acids, where the acid is inorganic, and the like.
  • nucleotides, natural or synthetic may find use.
  • the monomers may be neutral, negatively charged or positively charged or modified to be charged or neutral, e.g. sugars that are phosphorylated, amino acids that are acylated.
  • the charges of the monomers in the mir will be the same, so that in referring to the mass/charge ratio, it will be related to the same charge. Where the label has a different charge from the mir, this will be treated as if the number of charges is reduced by the number of charges on the mir.
  • the positive charges may be obtained from lysine, arginine and histidine, while the negative charges may be obtained from aspartic and glutamic acid.
  • nucleotides the charges will be obtained from the phosphate and any substituents that may be present or introduced onto the base.
  • sialic acid and uronic acids of the various sugars, or substituted sugars may be employed.
  • the mir may be joined in any convenient manner to the unit of the target-binding region, such as the base of the nucleoside or the amino acid of a protein.
  • Various functionalities which may be used include alkylamine, amidine, thioamide, ether, urea, thiourea, guanidine, azo, thioether and carboxylate, sulfonate, and phosphate esters, amides and thioesters.
  • the mir will usually be an oligomer, where the mir may be synthesized on a support or produced by cloning or expression in an appropriate host.
  • polypeptides can be produced where there is only one cysteine or serine/threonine/tyrosine, aspartic/glutamic acid, or lysine/arginine/histidine, other than an end group, so that there is a unique functionality, which may be differentially functionalized.
  • protective groups one can distinguish a side chain functionality from a terminal amino acid functionality.
  • the e-tag which is detected, will comprise the mir, generally a label, and optionally a portion of the target-binding region, all of the target-binding region when the target is an enzyme and the target-binding region is the substrate.
  • the e-tag will have a charge/mass ratio in the range of about ⁇ 0.0001 to 1, usually in the range of about ⁇ 0.001 to about 0.5.
  • Mobility is proportional to q/M 2 ⁇ 3 , where q is the charge on the molecule and M is the mass of the molecule.
  • the difference in mobility under the conditions of the determination between the closest electrophoretic labels will be at least about 0.001, usually 0.002, more usually at least about 0.01, and may be 0.02 or more.
  • e-tag there may be a single e-tag or a plurality of e-tags, generally ranging from about 1-100, more usually ranging from about 1-40, more particularly ranging from about 1-20.
  • the number of e-tags bonded to a single target-binding region will depend upon the sensitivity required, the solubility of the e-tag conjugate, the effect on the assay of a plurality of e-tags, and the like.
  • oligomers or polymers such as nucleic acids and poly(amino acids), e.g. peptides and proteins
  • the e-tag for use in electrophoresis may be represented by the formula:
  • R is a label, particularly a fluorescer
  • L is a mir, a bond or a linking group as described previously, where L and the regions to which L is attached provide for the variation in mobility of the e-tags.
  • T comprises a portion of the target-binding region, particularly a nucleoside base, purine or pyrimidine, and is the base, a nucleoside, nucleotide or nucleotide triphosphate, an amino acid, either naturally occurring or synthetic, or other functionality that may serve to participate in the synthesis of an oligomer, when T is retained, and is otherwise a functionality resulting from the cleavage between L, the mir, and the target-binding region.
  • L provides a major factor in the differences in mobility between the different e-tags, in combination with the label and any residual entity, which remain with the mir. L may or may not include a cleavable bond, depending upon whether the terminal entity to which L is attached is to be retained or completely removed.
  • L has been substantially described as the mir and as indicated previously may include charged groups, uncharged polar groups or be non-polar.
  • the groups may be alkylene and substituted alkylenes, oxyalkylene and polyoxyalkylene, particularly alkylene of from 2 to 3 carbon atoms, arylenes and substituted arylenes, polyamides, polyethers, polyalkylene amines, etc.
  • Substituents may include heteroatoms, such as halo, phosphorous, nitrogen, oxygen, sulfur, etc., where the substituent may be halo, nitro, cyano, non-oxo-carbonyl, e.g. ester, acid and amide, oxo-carbonyl, e.g.
  • L will be joined to the label and the target-binding region by any convenient functionality, such as carboxy, amino, oxy, phospo, thio, iminoether, etc., where in many cases the label and the target-binding region will have a convenient functionality for linkage.
  • the number of heteroatoms in L is sufficient to impart the desired charge to the label conjugate, usually from about 1 to about 200, more usually from about 2 to 100, heteroatoms.
  • the heteroatoms in L may be substituted with atoms other than hydrogen.
  • the charge-imparting moieties of L may be, for example, amino acids, tetraalkylammonium, phosphonium, phosphate diesters, carboxylic acids, thioacids, sulfonic acids, sulfate groups, phosphate monoesters, and the like and combinations of one or more of the above.
  • the number of the above components of L is such as to achieve the desired number of different charge-imparting moieties.
  • the amino acids may be, for example, lysine, aspartic acid, alanine, gamma-aminobutyric acid, glycine, ⁇ -alanine, cysteine, glutamic acid, homocysteine, ⁇ -alanine and the like.
  • the phosphate diesters include, for example, dimethyl phosphate diester, ethylene glycol linked phosphate diester, and so forth.
  • the thioacids include, by way of example, thioacetic acid, thiopropionic acid, thiobutyric acid and so forth.
  • the carboxylic acids preferably have from 1 to 30 carbon atoms, more preferably, from 2 to 15 carbon atoms and preferably comprise one or more heteroatoms and may be, for example, acetic acid derivatives, formic acid derivatives, succinic acid derivatives, citric acid derivatives, phytic acid derivatives and the like.
  • the label conjugates having different charge to mass ratios may comprise fluorescent compounds, each of which are linked to molecules that impart a charge to the fluorescent compound conjugate.
  • the linking group has an overall negative charge, preferably having in the case of a plurality of groups, groups of the same charge, where the total charge may be reduced by having one or more oppositely charged moiety.
  • L Of particular interest for L is to have two sub-regions, a common charged sub-region, which will be common to a group of e-tags, and a varying uncharged, a non-polar or polar sub-region, that will vary the mass/charge ratio.
  • dibasic acids that are substituted with functionalities that permit low orders of oligomerization, such as hydroxy and amino, where amino will usually be present as neutral amide.
  • These charge imparting groups provide aqueous solubility and allow for various levels of hydrophobicity in the other sub-region.
  • the uncharged sub-region could employ substituted dihydroxybenzenes, diaminobenzenes, or aminophenols, with one or greater number of aromatic rings, fused or non-fused, where substituents may be halo, nitro, cyano, alkyl, etc., allowing for great variation in molecular weight by using a common building block.
  • substituents may be halo, nitro, cyano, alkyl, etc., allowing for great variation in molecular weight by using a common building block.
  • L may be neutral.
  • the e-tag results in an available functionality that can be used to react with a detectable label, there will be no need for R to be a functionality.
  • the release of the e-tag can provide an hydroxyl, amino, carboxy or thiol group, where each may serve as the site for conjugation to the detectable label. To the extent that the e-tag is released free of a component of the target-binding region, this opportunity will be present.
  • R is the unreactive (under the conditions of the conjugation) terminus of L and T is a functionality for release of the e-tag that may be joined to all or a portion of the target-binding region or may be available for binding to all or a portion of the target-binding region.
  • Combinations of particular interest comprise a fluorescent compound and a different amino acid or combinations thereof in the form of a peptide or combinations of amino acids and thioacids or other carboxylic acids.
  • Such compounds are represented by the formula:
  • R′ is a fluorescer
  • L′ is is an amino acid or a peptide or combinations of amino acids and thioacids or other carboxylic acids
  • T′ is a functionality for linking to a nucleoside base or is a nucleoside, nucleotide or nucleotide triphosphate or other moiety as described above for T.
  • the charge-imparting moiety is conveniently composed primarily of amino acids but also may include thioacids and other carboxylic acids having from one to five carbon atoms.
  • the charge-imparting moiety may have from 1 to 30, preferably 1 to 20, more preferably, 1 to 10 amino acids per moiety and may also comprise 1 to 3 thioacids or other carboxylic acids. Howeever, when used with an uncharged sub-region, the charged sub-region will generally have from 1-4, frequently 1-3 amino acids. As mentioned above, any amino acid, both naturally occurring and synthetic may be employed.
  • the label conjugates may be represented by the formula:
  • L′′ is a bond or a linking group of from 1 to 20 atoms other than hydrogen
  • n is 1 to 20
  • T′′ comprises a nucleoside base, purine or pyrimidine, including a base, a nucleoside, a nucleotide or nucleotide triphosphates, an amino acid, or functionality for linking to the target-binding region.
  • An example of label conjugates in this embodiment is one in which the fluorescer is fluorescein, L′′ is a bond in the form of an amide linkage involving the meta-carboxyl of the fluorescein and the terminal amine group of lysine, and T′′ is a nucleotide triphosphate.
  • X is as set forth in Table 1. TABLE 1 No. X Charge 1 OH ⁇ 2 2 NH-lysine ⁇ 1 3 NH-(lysine) 2 neutral 4 NH-alanine ⁇ 3 5 NH-aspartic acid ⁇ 4 6 NH-(aspartic acid) 2 ⁇ 5 7 NH-(aspartic acid) 3 ⁇ 6 8 NH-(aspartic acid) 4 ⁇ 7 9 NH-(aspartic acid) 5 ⁇ 8 10 NH-(aspartic acid) 6 ⁇ 9 11 NH-(aspartic acid) 7 ⁇ 10 12 NH-alanine-lysine ⁇ 2 (unique q/M) 13 NH-aspartic acid-lysine ⁇ 3 (unique q/M) 14 NH-(aspartic acid) 2 -lysine ⁇ 4 (unique q/M) 15 NH-(aspartic acid) 3 -lysine ⁇
  • Table 2 shows various characteristics for the label conjugates.
  • M Mass
  • Mobility 1 744.82 0 82.16765 0 0 2 877.02 0 91.62336 0 0 3 828.71 ⁇ 1 88.22704 ⁇ 0.01133 ⁇ 0.16546 4 970.71 ⁇ 1 98.03767 ⁇ 0.0102 ⁇ 0.1489 5 700.82 ⁇ 2 78.89891 ⁇ 0.02535 ⁇ 0.37004 6 842.83 ⁇ 2 89.22639 ⁇ 0.2241 ⁇ 0.32721 7 815.92 ⁇ 3 87.31692 ⁇ 0.03436 ⁇ 0.50155 8 957.92 ⁇ 3 97.17461 ⁇ 0.03087 ⁇ 0.45067 9 931.02 ⁇ 4 95.34677 ⁇ 0.04195 ⁇ 0.61242 10 1073.02 ⁇ 4 104.8106 ⁇ 0.03816 ⁇ 0.55712 11 1046 ⁇
  • Another group of e-tags has a mir which is dependent on using an alkylene or aralkylene (comprising a divalent aliphatic group having 1-2 aliphatic regions and 1-2 aromatic regions, generally benzene), where the groups may be substituted or unsubstituted, usually unsubstituted, of from 2-16, more usually 2-12, carbon atoms, where the mir may link the same or different fluorescers to a monomeric unit, e.g. a nucleotide.
  • the mir may terminate in a carboxy, hydroxy or amino group, being present as an ester or amide.
  • a thiosuccinimide group may be employed to join alkylene or aralkylene groups at the nitrogen and sulfur, so that the total number of carbon atoms may be in the range of about 2-30, more usually 2-20.
  • alkyleneoxy groups may be used.
  • the label conjugates may be prepared utilizing conjugating techniques that are well known in the art.
  • the charge-imparting moiety L may be synthesized from smaller molecules that have functional groups that provide for linking of the molecules to one another, usually in a linear chain. Such functional groups include carboxylic acids, amines, and hydroxy- or thiol-groups.
  • the charge-imparting moiety may have one or more side groups pending from the core chain. The side groups have a functionality to provide for linking to a label or to another molecule of the charge-imparting moiety.
  • these methods comprise the sequential addition of one or more amino acids, or suitably protected amino acids, to a growing peptide chain.
  • a suitable protecting group protects either the amino or carboxyl group of the first amino acid.
  • the protected or derivatized amino acid can then be either attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complementary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage.
  • the protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth.
  • any remaining protecting groups are removed sequentially or concurrently, to afford the final peptide.
  • the protecting groups are removed, as desired, according to known methods depending on the particular protecting group utilized.
  • the protecting group may be removed by reduction with hydrogen and palladium on charcoal, sodium in liquid ammonia, etc.; hydrolysis with trifluoroacetic acid, hydrofluoric acid, and the like.
  • the peptide is removed from the resin by conventional means such as ammonolysis, acidolysis and the like.
  • the fully deprotected peptide may then be purified by techniques known in the art such as chromatography, for example, adsorption chromatography; ion exchange chromatography, partition chromatography, high performance liquid chromatography, thin layer chromatography, and so forth.
  • the selected peptide representing a charge-imparting moiety may be synthesized separately and then attached to the label either directly or by means of a linking group.
  • the peptide may be synthesized as a growing chain on the label.
  • the linking of the peptide or amino acid to the label may be carried out using one or more of the techniques described above for the synthesis of peptides or for linking moieties to labels.
  • e-tags comprising nucleotides can be easily and effectively achieved via assembly on solid phase support during probe synthesis using standard phosphoramidite chemistries.
  • the e-tags are assembled at the 5 end of probes after coupling of a final nucleosidic residue, which becomes part of the e-tag during the assay.
  • the e-tag is constructed sequentially from a single or several monomeric phosphoramidite building blocks (one containing a dye residue), which are chosen to generate tags with unique electrophoretic mobilities based on their mass to charge ratio.
  • the e-tag is thus composed of monomeric units of variable charge to mass ratios bridged by phosphate linkers ( Figure A).
  • the separation of e-tags, which differ by 9 mass units (Table 3) has been demonstrated.
  • C 3 , C 6 , C 9 , C 18 are commercially available phosphoramidite spacers from Glen Research, Sterling VA. The units are derivatives of N,N-diisopropyl, O-cyanoethyl phosphoramidite, which in the following formulas will be indicated by “Q”.
  • C 3 is DMT (dimethoxytrityl)oxypropyl Q;
  • C 6 is DMToxyhexyl Q;
  • C 9 is DMToxy(triethyleneoxy) Q;
  • C 12 is DMToxydodecyl Q;
  • C 18 is DMToxy(hexaethyleneoxy) Q.
  • the aforementioned label conjugates with different electrophoretic mobility permit a multiplexed amplification and detection of multiple targets, e.g. nucleic acid targets.
  • the label conjugates are linked to oligonucleotides in a manner similar to that for labels in general, by means of linkages that are enzymatically cleavable. It is, of course, within the purview of the present invention to prepare any number of label conjugates for performing multiplexed determinations. Accordingly, for example, with 40 to 50 different label conjugates separated in a single separation channel and 96 different amplification reactions with 96 separation channels on a single plastic chip, one can detect 4000 to 5000 single nucleotide polymorphisms.
  • maleimide derivatized e-tags have also been synthesized. These compounds were subsequently bioconjugated to 5′-thiol adorned DNA sequences and subjected to the 5′-nuclease assay. The species formed upon cleavage are depicted in Table 7. TABLE 7 E-tags derived from maleimide linked precursors. 1 2 3 4 5 6 7 8 9 10
  • kits can comprise in packaged combination a target-binding region, e.g. oligonucleotide primer for each polynucleotide suspected of being in said set wherein each of said primers is hybridizable to a first sequence of a respective polynucleotide if present, a template dependent polynucleotide polymerase, nucleoside triphosphates, and a set of oligonucleotide snp detection sequences, each of said oligonucleotide probes having a fluorescent label at its 5′-end and having a sequence at its 5′-end that is hybridizable to a respective polynucleotide wherein each of said labels is cleavable from said oligonucleotide probe.
  • the target-binding region may be an antibody for detecting ligands or enzyme substrate
  • the kit may further comprise a device for conducting capillary electrophoresis.
  • the e-tag is releasable by a template dependent polynucleotide polymerase having 5′ to 3′ exonuclease activity.
  • the kit can further include various buffered media, some of which may contain one or more of the above reagents.
  • kits can be varied widely to provide for concentrations of the reagents necessary to achieve the objects of the present invention.
  • one or more of the reagents in the kit can be provided as a dry powder, usually lyophilized, including excipients, which on dissolution will provide for a reagent solution having the appropriate concentrations for performing a method or assay in accordance with the present invention.
  • Each reagent can be packaged in separate containers or some reagents can be combined in one container where cross-reactivity and shelf life permit.
  • the kits may also include a written description of a method in accordance with the present invention as described above.
  • the e-tags are fluorescent conjugates represented by the formula:
  • R is a fluorescer
  • L is a mir, as described previously
  • T is a functionality for binding to a nucleoside base, purine or pyrimidine, or a nucleoside base, a nucleoside, nucleotide or nucleotide triphosphates, or other member of the target-binding region.
  • the e-tags are fluorescent conjugates represented by the formula:
  • R′ is a fluorescer
  • L′ is a bond, , a combination of a neutral sub-region and a charged sub-region, an amino acid or a peptide or combinations of amino acids and thioacids or other carboxylic acids
  • T′ is a nucleotide, nucleotide triphosphates or functionality for binding to a member of the target-binding region.
  • the e-tag is a fluorescent conjugate represented by the formula:
  • L′′ with (amino acid) n is a mir, where L′′ isa bond or a linking group of from 1 to 20 atoms in the chain and n is 1 to 100, usually 1 to 20, more usually 1 to 10.
  • the fluorescer may be fluorescein
  • the amino acid may be lysine
  • L′′ may be a bond in the form of an amide linkage involving the meta-carboxyl of the fluorescein and the terminal amine group of lysine.
  • the e-tag is a label conjugate represented by the formula:
  • X is selected from the group consisting of: OH, NH-lysine, NH-(lysine) 2 , NH-alanine, NH-aspartic acid, NH-(aspartic acid) 2 , NH-(aspartic acid) 3 , NH-(aspartic acid) 4 , NH-(aspartic acid) 5 , NH-(aspartic acid) 6 , NH-(aspartic acid) 7 , NH-alanine-lysine, NH-aspartic acid-lysine, NH-(aspartic acid) 2 -lysine, NH-(aspartic acid) 3 -lysine, NH-(aspartic acid) 4 -lysine, NH-(aspartic acid) 5 -lysine, NH-(aspartic acid) 6 -lysine, NH-(aspartic acid) 7 -lysine, NH
  • kits will usually have at least about 5 different e-tags for conjugation, more usually at least about 10, frequently at least about 25 and may have 50 or more, usually not more than about 1,000.
  • the e-tags will differ as to mobility, including mass/charge ratio and nature of charge, e.g. overall positive or negative, detectable moiety, e.g. fluorophore, electrochemical, etc, or functionality for linking a detectable moiety, e.g. maleimide, mercaptan, aldehyde, ketone, etc.
  • e-tags described above may terminate in an appropriate functionality for linking to a nucleotide, nucleotide triphosphate or other molecule of interest or may terminate in such moieties.
  • heterogeneous and homogeneous techniques involve heterogeneous and homogeneous techniques, where heterogeneous normally involves a separation step, where unbound label is separated from bound label, where homogeneous assays do not require, but may employ a separation step.
  • One group of assays will involve nucleic acid detection, which includes sequence recognition, snp detection and scoring, transcription analysis, allele determinations, HLA determinations, or other determination associated with variations in sequence.
  • the use of the determination may be forensic, mRNA determinations, mutation determinations, allele determinations, MHC determinations, haplotype determinations, single nucleotide polymorphism determinations, etc.
  • the methodology may include assays dependent on 5′-nuclease activity, as in the use of the polymerase chain reaction or in Invader technology, 3′-nuclease activity, restriction enzymes and ribonuclease H, all of these methods involving catalytic cleavage of a phosphate linkage, where one to two oligonucleotides are bound to the target template.
  • one may use channeling, where first and second agents are bound to first and second oligonucleotides, which bind proximally to the same target nucleic acid template.
  • the e-tag By having a label generating a mediator active in the cleavage of a bond present in the second agent to which an e-tag is linked, the e-tag will be released only when the two agents are proximally bound to the target template.
  • the mediator may be physical, e.g. electromagnetic radiation or chemical, e.g. singlet oxygen or hydrogen peroxide.
  • nucleic acid pairing instead of nucleic acid pairing, one may employ specific binding member pairing.
  • specific binding pairs associated with receptors, such as antibodies, poly- and monoclonal, enzymes, surface membrane receptors, lectins, etc., and ligands for the receptors, which may be naturally occurring or synthetic molecules, protein or non-protein, such as drugs, hormones, enzymes, ligands, etc.
  • the specific binding pair has many similarities to the binding of homologous nucleic acids, significant differences being that one normally cannot cycle between the target and the agent and one does not have convenient phosphate bonds to cleave.
  • the binding of the specific binding pair is employed to separate the bound from the unbound e-tag bonded agents, while with homogeneous assays, the proximity of the specific binding pairs allow for release of the e-tags from the complex.
  • Recognition event leads to generation or modification of e-tags.
  • Recognition Event e-tag Activation Amplification Mode Format Binding Assays (solution Phase Multiplexed assays (2-1000) e-tag generation followed by leading to release of library of e- separation by CE, HPLC or Mass tags. Every e-tag codes for a Spectra) unique binding event or assay. Hybridization followed by 5′ Nuclease assay PCR, Invader Sequence recognition for example enzyme recognition or multiplexed gene expression, SNP's scoring etc . . .
  • Every e-tag codes for a Spectra) unique binding event or assay.
  • Hybridization Light; Enzymes As an alternative to Branched chain Sequence recognition for example Capture of Target on solid Singlet oxygen, Hydrogen assay; Digene's RNA:DNA duplex; for gene expression, SNP's Surface.
  • a number of e-tag Peroxide Fluoride, High Sensitivity sequence scoring; Pathogen detection; etc . . . labeled probes are hybridized to Reducing agents, Mass identification assay. Can be carried out on Patches in the target. Unhybridized e-tag Spectra Others Amplification due to release of Microfluidic channels - - - labeled probes are removed.
  • E-tag multiple e-tags (10 to 100,000) per Integrated assay and separation is released and separated and binding event 3 device identified.
  • the cleavage of the nucleic acid bound to the template results in a change in the melting temperature of the e-tag residue with release of the e-tag.
  • the primer and/or protocol one can retain the primer bound to the template and the e-tag containing sequence can be cleaved and released from the template to be replaced by an c-tag containing probe.
  • target polynucleotides T1, T2, T3 and T4 are employed.
  • Oligonucleotide primers PR1, PR2, PR3 and PR4 are employed, each respectively capable of hybridizing to a sequence in the respective target polynucleotides.
  • oligonucleotide snp detection sequences PB1, PB2, PB3 and PB4.
  • Each of the snp detection sequences comprises a fluorescent label F1, F2, F3 and F4, respectively.
  • the reaction medium comprising the above reagents and nucleoside triphosphates and a template dependent polynucleotide polymerase having 5′ to 3 40 exonuclease activity is treated under amplification conditions.
  • Primers PR1, PR2, PR3 and PR4 hybridize to their respective target polynucleotides and are extended to yield extended primers EPR1, EPR2, EPR3 and EPR4.
  • snp detection sequences PB1, PB3 and PB4 which hybridize with their respective target polynucleotides, are acted upon by the exonuclease to cleave a single nucleotide bearing the respective fluorescent label.
  • PB2 which does not bind to the target polynucleotide, is not cleaved.
  • Cleaved fragments F1, F3 and F4 are injected into a separation channel in a chip for conducting electroseparation.
  • the labels are identified by their specific mobility and fluorescence upon irradiation.
  • the separated labels are related to the presence and amount of the respective target polynucleotide.
  • One, usually a plurality, of snp's is simultaneously determined by combining target DNA with one or a plurality, respectively, of reagent pairs under conditions of primer extension.
  • Each pair of reagents includes a primer which binds to target DNA and a snp detection sequence, normally labeled, which binds to the site of the snp and has an e-tag, usually at its 5′-end and the base complementary to the snp, usually at other than a terminus of the snp detection sequence.
  • the conditions of primer extension employ a polymerase having 5′-3′ exonuclease activity, dNTP's and auxiliary reagents to permit efficient primer extension.
  • the primer extension is performed, whereby detector sequences bound to the target DNA are degraded with release of the e-tag.
  • detector sequences bound to the target DNA are degraded with release of the e-tag.
  • the pairs of reagents are DNA sequences, which are related to a snp site.
  • the primer binds to the target DNA upstream from the snp site in the direction of extension.
  • the labeled detector sequence binds downstream from the primer in the direction of extension and binds to a sequence, which includes the snp.
  • the primer sequence will usually be at least about 12 bases long, more usually at least 18 bases long and usually fewer than 100 bases, and more usually fewer than 60 bases.
  • the primer will be chosen to bind substantially uniquely to a target sequence under the conditions of primer extension, so that the sequence will normally be one that is conserved or the primer is long enough to bind in the presence of a few mismatches, usually fewer than about 10 number % mismatches.
  • the primer should bind reasonably close to the snp, usually not more than about 200 bases away, more usually not more than about 100 bases away, and preferably within about 50 bases.
  • the primer will be at least about 5 bases away from the snp.
  • the number of reagent pairs may be varied widely, from a single pair to two or more pairs, usually at least about 5 pairs, more usually at least about 9 pairs and may be 20 pairs or more.
  • the subject pairs may be used to perform multiplexed operations in a single vessel, where a family of snps may be identified.
  • the total number of different reagent pairs or different target sequences in a single determination will be under 200, more usually under 100 and in many cases will not exceed 50
  • the primer includes the complementary base of the snp.
  • This protocol is referred to as “Invader” technology and is described in U.S. Pat. No. 6,001,567.
  • the protocol involves providing: (a) (i) a cleavage means, which is normally an enzyme, referred to as a cleavase, that recognizes a triplex consisting of the target sequence, a primer which binds to the target sequence and terminates at the snp position and a labeled probe that binds immediately adjacent to the primer and is displaced from the target at the snp position, when a snp is present; the cleavase clips the labeled probe at the site of displacement, releasing the label; ii) a source of target nucleic acid, the target nucleic acid having a first region, a second region and a third region, wherein the first region is downstream from the second region and the second region is contiguous to and downstream from the third region
  • attachment of an e-tag to the 5′ end of the detector sequence results in the formation of e-tag labeled nucleotide when target sequence is present.
  • the e-tag labeled nucleotide is separated and detected.
  • snp detection protocol an alternative method of cleavage is used and various detectable tags may be employed, the most common using a fluorescent label.
  • the tagged snp detection sequence will be chosen to bind to the target sequence comprising the snp.
  • the length of the snp detector sequence is in part related to the length and binding affinity of the primer. The two sequences act together to ensure that the pair of reagents bind to the proper target sequence. The greater the fidelity of binding of one member of the pair, the less fidelity that is required for the other member of the pair.
  • each member serves as a check on the other member for production of the signal.
  • both members of the pair will provide for unique binding to their respective target sequences. Therefore, the length of the snp detector sequence will come within the parameters indicated for the primer, but the total number of bases for the two pair members will usually be at least 36, more usually at least about 40.
  • Each snp detection sequence will have at least one nucleotide modified with an e-tag, which is labeled, which is fluorescent or can be subsequently made fluorescent, or can be detected electrochemically or by other convenient detection methodologies.
  • the modified nucleotide will be at the 5′-end of the sequence, but the modified nucleotide may be anywhere in the sequence, particularly where there is a single nuclease susceptible linkage in the detection sequence. Since the determination is based on the at least partial degradation of the snp detector sequence, having the modified nucleotide at the end ensures that if degradation occurs, the e-tag will be released.
  • nucleases may clip at other than the terminal phosphate link, it is desirable to prevent cleavage at other than the terminal phosphate link. In this way one avoids the confusion of having the same e-tag joined to different numbers of nucleotides after cleavage. Cleavage at the terminal phosphate can be relatively assured by using a linker at the penultimate nucleoside, which is not cleaved by the nuclease, more particularly having only the ultimate linkage susceptible to hydrolysis by a nuclease.
  • a linker at the penultimate nucleoside which is not cleaved by the nuclease, more particularly having only the ultimate linkage susceptible to hydrolysis by a nuclease.
  • a linker at the penultimate nucleoside which is not cleaved by the nuclease, more particularly having only the ultimate linkage susceptible to hydrolysis by a nuclease.
  • the snp detection sequence may have a combination of a quencher and a fluorescer.
  • the fluorescer would be in proximity to the nucleoside to which the linker is bonded, as well as the quencher, so that in the primer extension mixture, fluorescence from fluorescer bound to the snp detection sequence would be quenched.
  • fluorescer is released from the snp detection sequence and, therefore, removed from the quencher, it would then be capable of fluorescence.
  • By monitoring the primer extension mixture for fluorescence one would be able to determine when there would probably be a sufficient amount of individual e-tags to provide a detectable signal for analysis.
  • the snp detection sequence may be further modified to improve separation and detection of the e-tags.
  • the snp detection sequences will also have different mobilities.
  • these molecules will be present in much larger amounts than the released e-tags, so that they may obscure detection of the released e-tags.
  • a ligand on the snp detection sequence molecule to which a positively charged molecule can bind
  • one need only add the positively charged molecule to change the electrostatic nature of the snp detection sequence molecule.
  • one will usually have a ligand of under about 1 kDal. This may be exemplified by the use of biotin as the ligand and avidin, which is highly positively charged, as the receptor/positively charged molecule.
  • biotin/avidin one may have other pairs, where the receptor, e.g. antibody, is naturally positively charged or is made so by conjugation with one or more positively charged entities, such as arginine, lysine or histidine, ammonium, etc.
  • the presence of the positively charged moiety has many advantages in substantially removing the snp detection sequence molecules from the electropherogram. In carrying out the process, the positively charged moiety is added at or after the completion of the digestion.
  • the receptor may be used to physically sequester the molecules to which it binds, removing entirely intact e-tags containing the target-binding region or modified target-binding regions retaining the ligand.
  • modified target-binding regions may be as a result of degradation of the starting material, contaminants during the preparation, aberrant cleavage, etc. or other nonspecific degradation products of the target binding sequence.
  • a ligand exemplified by biotin, is attached to the target-binding region, e.g. the penultimate nucleoside, so as to be separated from the e-tag upon cleavage.
  • avidin a receptor for the ligand, for biotin exemplified by strept/avidin
  • Other receptors include natural or synthetic receptors, such as immunoglobulins, lectins, enzymes, etc.
  • the receptor is positively charged, naturally as in the case of avidin, or is made so, by the addition of a positively charged moiety or moieties, such as ammonium groups, basic amino acids, etc.
  • Avidin binds to the biotin attached to the detection probe and its degradation products. Avidin is positively charged, while the cleaved e-tag is negatively charged.
  • the separation of the cleaved e-tag from, not only uncleaved probe, but also its degradation products, is easily achieved by using conventional separation methods.
  • the receptor may be bound to a solid support or high molecular weight macromolecule, such as a vessel wall, particles, e.g. magnetic particles, cellulose, agarose, etc., and separated by physical separation or centrifugation, dialysis, etc. This method further enhances the specificity of the assay and allows for a higher degree of multiplexing.
  • the ligand may be present at a position other than the penultimate position and one may make the ultimate linkage nuclease resistant, so that cleavage is directed to the penultimate linkage, this will not be as efficient as having cleavage at the ultimate linkage. The efficiency would be even worse where the ligand is at a more distant nucleotide from the e-tag. Therefore, while such protocols are feasible, and may be used, they will not be preferred.
  • one ligand can be used for sequestering e-tags bound to target-binding region retaining the first ligand from products lacking the first ligand. Isolation and concentration of the e-tags bound to a modified target-binding region lacking the first ligand would then be performed.
  • the target-binding region containing the first ligand is bound to the first receptor, with the second receptor, which would serve to isolate or enrich for modified target-binding region lacking the first ligand, but retaining the second ligand.
  • the second ligand could be the detectable label; a small molecule for which a receptor is available, e.g. a hapten, or a portion of the e-tag could serve as the second ligand.
  • the e-tag could be released by denaturation of the receptor, displacement of the product, high salt concentrations and/or organic solvents, etc.
  • improvements include employing a blocking linkage between nucleotides in the sequence, particularly at least one of the links between the second to fourth nucleotides to inhibit cleavage at this or subsequent sites, and using control sequences for quantitation. Further improvements in the e-tags provide for having a positively multicharged moiety joined to the e-tag probe during separation.
  • the complementary base to the snp may be anywhere in the detector sequence, desirably at other than the terminal nucleoside to enhance the fidelity of binding.
  • the snp detector sequence will be designed to include adjacent nucleotides, which provide the desired affinity for the hybridization conditions.
  • the snp detection sequence may be synthesized by any convenient means, such as described in Matthews, et al., Anal Biochem. (1988) 169:1 - 25; Keller, et al., “DNA Probes,” 2 nd edition (1993) Stockton Press, New York, N.Y.; and Wetmur, Critical Reviews in Biochemistry and Molecular Biology (1991) 26:227-259.
  • the extension reaction is performed by bringing together the necessary combination of reagents and subjecting the mixture to conditions for carrying out the desired primer extension. Such conditions depend on the nature of the extension, e.g., PCR, single primer amplification, LCR, NASBA, 3SR and so forth, where the enzyme which is used for the extension has 5′-3′ nuclease activity.
  • the extension reaction may be carried out as to both strands or as to only a single strand. Where pairs of primer and snp detection sequence are used for both strands, conveniently, the e-tag will be the same, but the bases will be different.
  • the reaction will be carried out by using amplifying conditions, so as to provide an amplified signal for each snp.
  • Amplification conditions normally employ thermial cycling, where after the primer extension and release of e-tags associated with snps which are present, the mixture is heated to denature the double-stranded DNA, cooled, where the primer and snp detection sequence can rehybridize and the extension repeated.
  • the e-tags or e-tag will be separated from a portion or substantially all of the detection sequence, usually retaining not more than about 3 nucleotides, more usually not more than about 2 nucleotides and preferably from 0 to 1 nucleotide.
  • the e-tag may be freed of all the nucleotides.
  • a nuclease resistant penultimate link a single nucleotide may be bonded to the e-tag.
  • Reagents for conducting the primer extension are substantially the same reaction materials for carrying out an amplification, such as an amplification indicated above. The nature and amounts of these reagents are dependent on the type of amplification conducted.
  • the reagents also comprise nucleoside triphosphates and a nucleotide polymerase having 5′-3′ nuclease activity.
  • nucleoside triphosphates employed as reagents in an amplification reaction include deoxyribonucleoside triphosphates such as the four common deoxyribonucleoside triphosphates dATP, dCTP, dGTP and dTTP.
  • deoxyribonucleoside triphosphates such as the four common deoxyribonucleoside triphosphates dATP, dCTP, dGTP and dTTP.
  • nucleoside triphosphates also includes derivatives and analogs thereof, which are exemplified by those derivatives that are recognized and polymerized in a similar manner to the underivatized nucleoside triphosphates.
  • the nucleotide polymerase employed is a catalyst, usually an enzyme, for forming an extension of an oligonucleotide primer along a polynucleotide such as a DNA template, where the extension is complementary thereto.
  • the nucleotide polymerase is a template dependent polynucleotide polymerase and utilizes nucleoside triphosphates as building blocks for extending the 3′-end of a polynucleotide to provide a sequence complementary with the polynucleotide template.
  • the catalysts are enzymes, such as DNA polymerases, for example, prokaryotic DNA polymerase (I, II, or III), T4 DNA polymerase, T7 DNA polymerase, Vent DNA polymerase, Pfu DNA polymerase, Taq DNA polymerase, and the like.
  • Polymerase enzymes may be derived from any source, such as eukaryotic or prokaryotic cells, bacteria such as E. coli , plants, animals, virus, thermophilic bacteria, genetically modified enzymes, and so forth.
  • the conditions for the various amplification procedures are well known to those skilled in the art.
  • thermal cycling conditions as discussed above are employed to amplify the polynucleotides.
  • the combination of reagents is subjected to conditions under which the oligonucleotide primer hybridizes to the priming sequence of, and is extended along, the corresponding polynucleotide.
  • the exact temperatures can be varied depending on the salt concentration, pH, solvents used, length of and composition of the target polynucleotide sequence and the oligonucleotide primers.
  • Thermal cycling conditions are employed for conducting an amplification involving temperature or thermal cycling and primer extension, such as in PCR or single primer amplification, and the like.
  • the pH and the temperature are selected so as to cause, either simultaneously or sequentially, dissociation of any internally hybridized sequences, hybridization or annealing of the oligonucleotide primer and the snp detection sequence with the target polynucleotide sequence, extension of the primer, release of the e-tag from snp detection sequence bound to the target polynucleotide sequence and dissociation of the extended primer.
  • This usually involves cycling the reaction medium between two or more temperatures. In conducting such a method, the medium is cycled between two to three temperatures.
  • the temperatures for thermal cycling generally range from about 50° C.
  • Relatively low temperatures of from about 30° C. to about 65° C. can be employed for the extension steps, while denaturation and hybridization can be carried out at a temperature of from about 50° C. to about 105° C.
  • the reaction medium is initially at about 20° C. to about 45° C., preferably, about 25° C. to about 35° C.
  • Relatively low temperatures of from about 50° C. to about 80° C., preferably, 50° C. to about 60° C. are employed for the hybridization or annealing steps, while denaturation is carried out at a temperature of from about 80° C. to about 100° C., preferably, 90° C.
  • extension is carried out at a temperature of from about 70° C. to about 80° C., usually about 72° C. to about 74° C.
  • the duration of each cycle may vary and is usually about 1 to 120 seconds, preferably, about 5 to 60 seconds for the denaturation steps, and usually about 1 to 15 seconds, preferably, about 1 to 5 seconds, for the extension steps. It is to be understood that the actual temperature and duration of the cycles employed are dependent on the particular amplification conducted and are well within the knowledge of those skilled in the art.
  • an aqueous medium is employed.
  • Other polar cosolvents may also be employed, usually oxygenated organic solvents of from 1-6, more usually from 1-4, carbon atoms, including alcohols, ethers, formamide and the like.
  • oxygenated organic solvents usually from 1-6, more usually from 1-4, carbon atoms, including alcohols, ethers, formamide and the like.
  • these cosolvents, if used, are present in less than about 70 weight percent, more usually in less than about 30 weight percent.
  • the pH for the medium is usually in the range of about 4.5 to 9.5, more usually in the range of about 5.5 to 8.5, and preferably in the range of about 6 to 8.
  • Various buffers may be used to achieve the desired pH and maintain the pH during the determination.
  • Illustrative buffers include borate, phosphate, carbonate, Tris, barbital and the like.
  • the particular buffer employed is not critical to this invention but in individual methods one buffer may be preferred over another.
  • the medium may also contain materials required for enzyme activity such as a divalent metal ion (usually magnesium).
  • the selection of the snp detection sequence will affect the stringency employed during the primer extension, particularly at the stage of hybridization. Since in a substantial number of samples, the DNA will be heterozygous for snps, rather than homozygous, one does not wish to have false positives, where the snp detection sequence may bond to the sequence comprising the prevalent nucleotide, as well as the sequence comprising the snp. Where the DNA sample is homozygous for the prevalent sequence, it is also important that the snp detection sequence does not bind to give a false positive. Therefore, the difference in T m between the snp containing sequence and the wild-type sequence will usually be at least about 3° C., more usually at least about 5° C., under the conditions of the primer extension.
  • the medium may also comprise stabilizers for the medium and the reaction components.
  • the medium may also include proteins such as albumins, quaternary ammonium salts, polycations such as spermine, surfactants, particularly non-ionic surfactants, binding enhancers, e.g., polyalkylene glycols, or the like.
  • the reaction is conducted for a time sufficient to produce the desired number of copies of each of the polynucleotides suspected of being present as discussed below.
  • the time period for conducting the entire method will be from about 10 to 200 minutes. As mentioned above, it is usually desirable to minimize the time period.
  • the concentration of the nucleotide polymerase is usually determined empirically. Preferably, a concentration is used that is sufficient such that the amplification is robust.
  • the primary limiting factor generally is the cost of the reagent.
  • Such enzymes include Pfu DNA polymerase (native and recombinant) from Stratagene, La Jolla, Calif., Ultma DNA polymerase from Perkin Elmer, Foster City, Calif., rBst DNA polymerase from Epicentre Technologies, Madison, Wis., VENT DNA polymerase from New England Biolabs, Beverly, Mass., Tli DNA polymerase from Promega Corp., Madison, Wis., and Pwo DNA polymerase from Boehringer Mannheim, Indianapolis; Ind., and the like.
  • the initial concentration of each of the polynucleotides containing the respective target snps can be as low as about 50 pg/ml in a sample.
  • the concentration of each polynucleotide should be at least about 10 picomolar, generally in the range of about 10 pM to about 10 nM, usually from about 10 to 10 10 , more usually from about 10 3 to 10 8 molecules in a sample preferably at least 10 ⁇ 21 M in the sample and may be 10 ⁇ 10 to 10 ⁇ 19 M, more usually 10 ⁇ 14 to 10 ⁇ 19 M.
  • the reagents for the reaction are provided in amounts to achieve extension of the oligonucleotide primers.
  • the concentration of the oligonucleotide primer(s) will be about 1 to about 20 ⁇ M and is usually about 1 to about 10 ⁇ M, preferably, about 1 to about 4 ⁇ M, for a sample size that is about 10 fM.
  • the concentration of the oligonucleotide primer(s) is substantially in excess over, preferably at least about 10 7 to about 10 10 times greater than, more preferably, at least about 10 9 times greater than, the concentration of the corresponding target polynucleotides.
  • the amount of the oligonucleotide probes will be 10 to about 500 nM and is usually about 50 to about 200 nM for a sample size that is about 10 fM (10 fg/ ⁇ l).
  • the concentration of the oligonucleotide probes is substantially in excess over, preferably at least about 10 7 times greater than, more preferably, at least about 10 8 times greater than, the concentration of each of the target polynucleotides.
  • the concentration of the nucleoside triphosphates in the medium can vary widely; preferably, these reagents are present in an excess amount.
  • the nucleoside triphosphates are usually present in about 100 M to about 1 mM, preferably, about 20 to about 400 M
  • the order of combining of the various reagents to form the combination may vary. Usually, the sample containing the polynucleotides is combined with a pre-prepared combination of nucleoside triphosphates and nucleotide polymerase.
  • the oligonucleotide primers and the snp detection sequences may be included in the prepared combination or may be added subsequently. However, simultaneous addition of all of the above, as well as other step-wise or sequential orders of addition, may be employed provided that all of the reagents described above are combined prior to the start of the reactions.
  • the oligonucleotide pairs may be added to the combination of the reagents at or prior to the initiation of the primer extension reaction and may be replenished from tine-to-time during the primer extension reaction.
  • controls which provide a signal in relation to the amount of the target that is present or is introduced.
  • mRNA in a lysate one may use the known amounts of one or more different mRNAs in the particular cell types as the standards.
  • the consistent ratio of mRNAs occurring naturally will result in a large margin of error, so that one would usually rely on synthetic targets.
  • control system will comprise at least two control sequences, usually at least 3 control sequences and generally not more than about 6 control sequences, where the upper limit is primarily one of convenience and economy, since additional control sequences will usually not add significant additional precision.
  • control sequences will usually be at least about 50 nucleotides, more usually at least about 10 nucleotides.
  • the control sequences will have a common primer sequence and different control detection sequences, which are intended to parallel the primer sequence and snp detection sequence in size, spacing and response to the primer extension conditions.
  • the mixture may now be analyzed.
  • fluorescers activated by the same light source and emitting at different detectable labels may be used. With improvements, five or more different fluorescers will be available, where an additional light source may be required. Electrochemical detection is described in U.S. Pat. No. 6,045,676.
  • the subject assays are predicated on having a reagent that has a high affinity for a reciprocal binding member, the analyte.
  • the binding affinity will be at least about 10 ⁇ 7 M ⁇ 1 , more usually, at least about 10 ⁇ 8 M ⁇ 1 .
  • the reagents will be receptors, which includes antibodies, IgA, IgD, IgG, IgE and IgM and subtypes thereof, enzymes, lectins, nucleic acids, nucleic acid binding proteins, or any other molecule that provides the desired specificity for the analyte in the assay, one of the members normally being a protein.
  • the antibodies may be polyclonal or monoclonal or mixtures of monoclonal antibodies depending on the nature of the target composition and the targets.
  • the targets or analytes may be any molecule, such as small organic molecules of from about 100 to 2500 Dal, poly(amino acids) including peptides of from about 3 to 100 amino acids and proteins of from about 100 to 50,000 or more amino acids, saccharides, lipids, nucleic acids, etc., where the analytes may be part of a larger assemblage, such as a cell, microsome, organelle, virus, protein complex, chromosome or fragment thereof, nucleosome, etc.
  • the subject heterogeneous assays require that the unbound labeled reagent be separable from the bound labeled reagent.
  • This can be achieved in a variety of ways. Each way requires that a reagent that distinguishes between the complex of labeled reagent and target be bound to a solid support.
  • the solid support may be a vessel wall, e.g. microtiter well plate well, capillary, plate, slide, beads, including magnetic beads, liposomes, or the like.
  • the primary characteristics of the solid support is that it permits segregation of the bound labeled specific binding member from unbound and does not interfere with the formation of the binding complex, nor the other operations of the determination.
  • the solid support may have the complex directly bound to the support or indirectly bound.
  • directly bound one may have the binding member covalently or non-covalently bound to the support.
  • proteins many surfaces provide non-diffusible binding of a protein to the support, so that one adds the protein to the support and allows the protein to bind, washes away weakly bound protein and then adds an innocuous protein to coat any actively binding areas that are still available.
  • the surface may be activated with various functionalities that will form covalent bonds with a binding member. These groups may include imino halides, activated carboxyl groups, e.g. mixed anhydrides or acyl halides, amino groups, ⁇ -halo or pseudohaloketones, etc.
  • the specific binding member bound to the surface of the support may be any molecule which permits the binding portion of the molecule, e.g. epitope, to be available for binding by the reciprocal member.
  • the binding member is polyepitopic, e.g. proteins
  • this is usually less of a problem, since the protein will be polyepitopic and even with random binding of the protein to the surface, the desired epitope will be available for most of the bound molecules.
  • For smaller molecules, particularly under 5 kDal one will usually have an active functionality on the specific binding member that preserves the binding site, where the active functionality reacts with a functionality on the surface of the support.
  • the same functionalities described above may find use. Conveniently, one may use the same site for preparing the conjugate immunogen to produce antibodies, as the site for the active functionality for linking to the surface.
  • the assays may be performed in a competitive mode or a sandwich mode.
  • the competitive mode one has the target competing with a labeled binding member for the reciprocal member, which reciprocal member is bound to the support, either during the complex formation or after, e.g. where antibody is a specific binding member and anti(Ig H ) is bound to the support.
  • the binding sites of the reciprocal binding member become at least partially filled by the target, reducing the number of available binding sites for the labeled reciprocal binding member.
  • the number of labeled binding members that bind to the reciprocal binding member will be in direct proportion to the number of target molecules present.
  • the target is able to bind at the same time to different binding members; a first support bound member and a second member which binds at a site of the target molecule different from the site at which the support bound member binds.
  • the resulting complex has three components, where the target serves to link the labeled binding member to the support.
  • the components are combined, usually with the target composition added first and then the labeled members in the competitive mode and in any order in the sandwich mode.
  • the labeled member in the competitive mode will be equal to at least 50% of the highest number of target molecules anticipated, preferably at least equal and may be in 2-10 fold excess or greater.
  • the particular ratio of target molecules to labeled molecules will depend on the binding affinities, the length of time the mixture is incubated, the off rates for the target molecule with its reciprocal binding member, the size of the sample and the like.
  • the sandwich assays one will have at least an equal amount of the labeled binding member to the highest expected amount of the target molecules, usually at least 1.5 fold excess, more usually at least 2 fold excess and may have 10 fold excess or more.
  • the components are combined under binding conditions, usually in an aqueous medium, generally at a pH in the range of 5-10, with buffer at a concentration in the range of about 10 to 200 mM.
  • buffers may be used, such as phosphate, carbonate, HEPES, MOPS, Tris, borate, etc., as well as other conventional additives, such as salts, stabilizers, organic solvents, etc.
  • the unbound labeled binding member will be removed by washing the bound labeled binding member. Where particles or beads are employed, these may be separated from the supernatant before washing, by filtration, centrifugation, magnetic separation, etc.
  • the support may be combined with a liquid into which the e-tags are to be released and/or the functionality of the e-tags is reacted with the detectable label, followed by or preceded by release.
  • the liquid may include reagents for the cleavage. Where reagents for cleavage are not required, the liquid is conveniently an electrophoretic buffer.
  • the support may be irradiated with light of appropriate wavelength to release the e-tags.
  • detectable labels are not present on the e-tags, the e-tags may be reacted with the detectable labels.
  • the detectable label may be part of the reagent cleaving the cleavable bond, e.g. a disulfide with a thiol.
  • the different labels will have functionalities that react with one of the functionalities.
  • the different labels may be added together or individually in a sequential manner.
  • the labels could have activated olefins, alcohols, amines and thiol groups, respectively.
  • the protective groups may be removed stepwise and the labels added stepwise. In this way cross-reactivity may be avoided.
  • the detectable label present initially or one adds the detectable label is not critical to this invention and will frequently be governed by the nature of the target composition, the nature of the labeled binding members, and the nature of the detectable labels. For the most part, it will be a matter of convenience as to the particular method one chooses for providing the detectable labeled e-tag.
  • the e-tags may be required to be separated from the reagent solution, where the reagent interferes with the electrophoretic analysis.
  • the reagent interferes with the electrophoretic analysis.
  • the solution may be analyzed electrophoretically.
  • the analysis may employ capillary electrophoresis devices, microfluidic devices or other devices that can separate a plurality of compounds electrophoretically, providing resolved bands of the individual e-tags.
  • the protocols for the subject homogeneous assays will follow the procedures for the analogous assays, which may or may not include a releasable tag. These protocols employ a signal producing system that includes the label on one of the binding members, the cleavable bond associated with the e-tag, electromagnetic radiation or other reagents involved in the reaction or for diminishing background signal.
  • a signal producing system that includes the label on one of the binding members, the cleavable bond associated with the e-tag, electromagnetic radiation or other reagents involved in the reaction or for diminishing background signal.
  • assays involving the production of hydrogen peroxide one may wish to have a molecule in solution that degrades hydrogen peroxide to prevent reaction between hydrogen peroxide produced by a label bound to an analyte molecule and an e-tag labeled binding member that is not bound to the same analyte molecule.
  • the concentrations of the various agents involved with the signal producing system will vary with the concentration range of the individual analytes in the samples to be analyzed, generally being in the range of about 10 nM to 10 mM. Buffers will ordinarily be employed at a concentration in the range of about 10 to 200 mM. The concentration of each analyte will generally be in the range of about 1 pM to about 100 ⁇ M, more usually in the range of about 100 pM to 10 ⁇ M.
  • concentrations may be higher or lower, depending on the nature of the analyte, the affinity of the reciprocal binding members, the efficiency of release of the e-tags, the sensitivity with which the e-tags are detected, and the number of analytes, as well as other considerations.
  • the enzymes may be sequestered and the e-tags released to define those compounds that may serve as suicide inhibitors and, therefore, preferentially bind to the active site of the enzyme.
  • active substrates for each of the enzymes to be evaluated where each of the substrates would have its own e-tag.
  • the amount of product would be diminished in relation to the amount of product in the absence of the candidate compound.
  • the product would have a different mobility from the substrate, so that the substrates and products could be readily distinguished by electrophoresis.
  • electropherograms showing the effect of the candidate compound on the activity of the different enzymes.
  • the mixture may be added to functionalized fluorescent tags to label the e-tag with a fluorescer.
  • a fluorescer could have an activated ethylene, such as maleic acid to form the thioether.
  • activated halogen or pseudohalogen for forming an ether, such as an ⁇ -haloketone.
  • carboxyl groups carbodiimide and appropriate amines or alcohols would form amides and esters, respectively.
  • oligopeptides For an amine, one could use activated carboxylic acids, aldehydes under reducing condtions, activated halogen or pseudohalogen, etc. When synthesizing oligopeptides, protective groups are used. These could be retained while the fluorescent moiety is attached to an available functionality on the oligopeptide.
  • electroseparation involves the separation of components in a liquid by application of an electric field, preferably, by electrokinesis (electrokinetic flow), electrophoretic flow, electroosmotic flow or combination thereof, with the separation of the e-tag mixture into individual fractions or bands. Electroseparation involving the migration and separation of molecules in an electric field is based on differences in mobility. Various forms of electroseparation include, by way of example and not limitation, free zone electrophoresis, gel electrophoresis, isoelectric focusing and isotachophoresis.
  • Capillary electroseparation involves electroseparation, preferably by electrokinetic flow, including electrophoretic, dielectrophoretic and/or electroosmotic flow, conducted in a tube or channel of about 1-200 ⁇ m, usually, about 10-100 ⁇ m cross-sectional dimensions.
  • the capillary may be a long independent capillary tube or a channel in a wafer or film comprised of silicon, quartz, glass or plastic.
  • capillary electroseparation an aliquot of the reaction mixture containing the e-tag products is subjected to electroseparation by introducing the mixture or an aliquot into an electroseparation channel that may be part of, or linked to, a capillary device in which the amplification and other reactions are performed. An electric potential is then applied to the electrically conductive medium contained within the channel to effectuate migration of the components within the combination. Generally, the electric potential applied is sufficient to achieve electroseparation of the desired components according to practices well known in the art.
  • One skilled in the art will be capable of determining the suitable electric potentials for a given set of reagents used in the present invention and/or the nature of the cleaved labels, the nature of the reaction medium and so forth.
  • the parameters for the electroseparation including those for the medium and the electric potential are usually optimized to achieve maximum separation of the desired components. This may be achieved empirically and is well within the purview of the skilled artisan.
  • Capillary devices are known for carrying out amplification reactions such as PCR. See, for example, Analytical Chemistry (1996) 68:4081-4086. Devices are also known that provide functional integration of PCR amplification and capillary electrophoresis in a microfabricated DNA analysis device. One such device is described by Woolley, et al., in Anal. Chem. (1996) 68:4081-4086.
  • the device provides a microfabricated silicon PCR reactor and glass capillary electrophoresis chips.
  • a PCR chamber and a capillary electrophoresis chip are directly linked through a photolithographically fabricated channel filled with a sieving matrix such as hydroxyethylcellulose. Electrophoretic injection directly from the PCR chamber through the cross injection channel is used as an “electrophoretic valve” to couple the PCR and capillary electrophoresis devices on a chip.
  • the capillary electrophoresis chip contains a sufficient number of main or secondary electrophoretic channels to receive the desired number of aliquots from the PCR reaction medium or the solutions containing the e-tags, etc., at the intervals chosen.
  • CCD charge coupled device
  • Excitation sources include, for example, filtered lamps, LED's, laser diodes, gas, liquid and solid state lasers, and so forth.
  • the detection may be laser scanned excitation, CCD camera detection, coaxial fiber optics, confocal back or forward fluorescence detection in single or array configurations, and the like.
  • Detection may be by any of the known methods associated with the analysis of capillary electrophoresis columns including the methods shown in U.S. Pat. Nos. 5,560,811 (column 11, lines 19-30), 4,675,300, 4,274,240 and 5,324,401, the relevant disclosures of which are incorporated herein by reference.
  • the entire apparatus may be fabricated from a plastic material that is optically transparent, which generally allows light of wavelengths ranging from 180 to 1500 nm, usually 220 to 800 nm, more usually 450 to 700 nm, to have low transmission losses.
  • Suitable materials include fused silica, plastics, quartz, glass, and so forth.
  • the e-tags may be different from the e-tags used in electrophoresis, since the c-tags do not require a label, nor a charge. Thus, these e-tags may be differentiated solely by mass, which can be a result of atoms of different elements, isotopes of such elements, and numbers of such atoms. In the subject invention, such use of e-tags will be coupled with a process for removing the iterative extensions of the nucleic acid sequence, where degradation or cleavage has occurred at a site other than the ultimate linkage.
  • FIG. 10 illustrates a system ( 100 ) for the simultaneous, multiplexed determination of a plurality of events. Each event is distinguished from the others by electrophoresis.
  • a snp locus may be characterized using a pair of reagents, each specific for one allele of the locus. Each reagent is bonded to an e-tag with a unique electrophoretic mobility and an associated label.
  • the reagent is combined with a sample of interest in a reaction vessel ( 101 )
  • the associated e-tag is modified in a manner that changes its electrophoretic mobility if its specific target is present.
  • the mixture is moved ( 102 ) onto an electrophoretic device ( 103 ) for separation of the e-tags contained in the mixture.
  • a power control box ( 104 ) is used in conjunction with the device to control injection of the sample into the separation channel ( 105 ).
  • Each e-tag species migrates down the separation channel of the device with a mobility unique to that tag, moving past a detector ( 106 ) that monitors its presence by its associated label.
  • the data collected by the detector is sent to a data processor ( 107 ), which determines the presence of each snp allele in the sample based on the mobility of its corresponding e-tag.
  • a group of snp loci may be monitored in a multiplexed reaction.
  • a plurality of pairs of e-tag reagents corresponding to the snp loci are combined with the sample in a single reaction vessel under conditions where the e-tag is released from at least a portion of the oligonucleotides sequence to which it is bonded when a pair is bonded to its target.
  • the e-tags are either labeled for detection or the label is added by means of a reactive functionality present on the e-tag.
  • the labeled c-tag products of the reaction are resolved from one another on the electrophoretic device, and again are monitored as they move past the detector.
  • the level of multiplexing possible in this system is limited only by the degree of resolution that can be obtained between a designated set of e-tags on the electrophoretic device.
  • each e-tag may already contain a detectable label when introduced to the reaction.
  • an e-tag may contain a functionality allowing it to bind to a label after reaction with the sample is complete ( 108 ).
  • an e-tag comprising a functionality for binding to a detectable label is combined with a sample ( 101 ). After a reaction to modify the mobility of the e-tag if its target is present in the sample, additional reagents are combined in a sample vessel ( 109 ) with the products of the first reaction, which will react with the modified e-tag(s) to add a detectable label.
  • Tris HCl Tris(hydroxymethyl)aminomethane-HCl (a 10X solution) from BioWhittaker, Walkersville, Md.
  • BSA bovine serum albumin from Sigma Chemical Company, St. Louis, Mo.
  • TAMRA tetramethyl rhodamine
  • TET and FAMRA were purchased from Perkin Elmer (Foster City, Calif.) as were conjugates of TET, FAM and TAMRA with oligonucleotides.
  • Plasmid Allele 1 Probe 2.0 ⁇ M (200 nM per reaction)
  • Target DNA [0209]
  • reaction mixtures were kept at 50° C. for 2 minutes for optimal AmpErase UNG activity.
  • the 10 minute, 95° C. step was required to activate AmpliTaq Gold DNA Polymerase.
  • reaction mixtures are kept at 50° C. for 2 minutes for optimal AmpErase UNG activity.
  • the 10 minute, 95° C. step is required to activate AmpliTaq Gold DNA Polymerase.
  • Each of the 40 cycles is performed in the following fashion Melt Anneal/Extend/Cleave 15 seconds 60 seconds 95° C. 60° C.
  • reaction mixtures were kept at 50° C. for 2 minutes for optimal AmpErase UNG activity.
  • the 10 minute 95° C. step was required to activate AmpliTaq Gold DNA Polymerase.
  • Each of the 40 cycles is performed in the following fashion Melt Anneal/Extend/Cleave 15 seconds 60 seconds 95° C. 60° C.
  • Label conjugates comprising fluorescein linked to three different peptides, namely, KKAA, KKKA and KKKK were prepared as follows: The protected tetrapeptide was prepared on resin using Merrifield reagents. The N-terminus of the last aminoacid was reacted with fluorescein N-hydroxysuccinimide (Molecular Probes). The peptides were cleaved from the resin and purified by high performance liquid chromatography (HPLC).
  • HPLC high performance liquid chromatography
  • the following example demonstrates separation in a gel based capillary electrophoresis of cleavage of a probe.
  • the conditions employed were: Gel: 2.5% LDD30 in 1XTBE with 7M urea; CE: PE ABI 310; Capillary: 47 cm long; 36 cm to window; 75um ID; Running Buffer: 1X TBE.
  • LDD30 is a linear copolymer of N,N-diethyl acrylamide and N,N-dimethylacrylamide, 70:30).
  • the ABI3 10 was set up in accordance with the directions of the manufacturer. The parameters used were: Inj Secs 5; Inj kV 2.0; Run kV 9.4; Run C 45; Run Time 10 min. To determine the relationship of where each probe separated, a spike in system was used. First one digested probe was separated and its peak site determined, then a second probe was spiked into the first probe, and the two separated. Then, a third probe was spiked in and separated, and so on till the sites of all the six probes was determined. The single plex PCR runs were first separated followed by separation of the multiplex PCR, which was compared to the S1 digested separation. Type of Probe conc.
  • Taq DNA Polymerase exhibits 5′ to 3′ exonuclease activity in which hybridized probes on the template DNA are cleaved during PCR.
  • sequence specific probes with fluoroscent dye attached to the 5′ were employed.
  • PCR was performed with these probes in a reaction and then separation performed in a gel based capillary electrophoresis to determine the cleavage of the probe.
  • the reaction involved a plurality of probes in the same PCR reaction mixture for different snps in CFTR.
  • sequence specific probes with fluorescent dye attached to the 5′ terminus of the probe were employed.
  • PCR was performed with these probes and then separation performed in gel based capillary electrophoresis to determine the cleavage of the probe.
  • the following table indicates the fragment, the mutation reference and the specific nucleotide difference and number inb the sequence.
  • FIG. 9 a Demonstrates the formation of 5 different cleavage products in the PCR amplification of ANF with electrophoretic tag labeled at the 5′ end of the sequence detection probe.
  • phosphate group at 2,3,4 and 5 position is converted into thiophosphate group.
  • PCR amplification of ANF using thiophospate modified sequence detection probe yield only one cleavage product.
  • FIG. 9 b Demonstrates the formation of 3 different cleavage products in the PCR amplification of GAPDH with e-tag labeled at the 5′ end of the sequence detection probe.
  • phosphate group at 2 and 3 position is converted into thiophosphate group.
  • PCR amplification of ANF using thiophospate modified sequence detection probe yield only one predominant cleavage product.
  • a single detectable entity (a single electrophoretic tag: FIG. 9 a and 9 b ) is generated as a consequence of amplification reaction.
  • the subject invention provides an accurate, efficient and sensitive process, as well as compositions for use in the process, to perform multiplexed reactions.
  • the protocols provide for great flexibility in the manner in which determinations are carried out and maybe applied to a wide variety of situations involving hpatens, antigens, nucleic acids, cells, etc., where one may simultaneously perform a number of determinations on a single or plurality of samples and interrogate the samples for a plurality of events.
  • the events may vary from differences in nucleic acid sequence to proteomics to enzyme activities.
  • the results of the determination are readily read in a simple manner using electrophoresis or mass spectrometry. Systems are provided where the entire process, after addition of the sample and reagents, maybe performed under the control of a data processor with the results automatically recorded.

Abstract

Methods and compositions are provided for detecting target molecules, e.g. DNA sequences, particularly single nucleotide polymorphisms, using a pair of nucleotide sequences, a primer and a snp detection sequence, where the snp detection sequence binds downstream from the primer to the target DNA in the direction of primer extension, or ligands and receptors. The methods employ e-tags comprising a mobility-identifying region joined to a detectable label and a target-binding region. The result of the binding of the target-binding region to the target is to have a bond cleaved in the starting material with the production of a detectable product with a different mobility from the starting material, where the different e-tags can be separated and detected

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a continuation-in-part of application Ser. No. 09/561,579, filed Apr. 28, 2000, which is a continuation-in-part of application Ser. No. 09/303,029, filed Apr. 30, 1999, which disclosure is incorporated herein by reference.[0001]
    • INTRODUCTION
  • 1. Field of the Invention [0002]
  • The field of this invention is electrophoretically separable compositions for use in multiplex detection. [0003]
  • 2. Background of the Invention [0004]
  • As the human genome is elucidated, there will be numerous opportunities for performing assays to determine the presence of specific sequences, distinguishing between alleles in homozygotes and heterozygotes, determining the presence of mutations, evaluating cellular expression patterns, etc. In many of these cases one will wish to determine in a single reaction, a number of different characteristics of the same sample. Also, there will be an interest in determining the presence of one or more pathogens, their antibiotic resistance genes, genetic subtype and the like. [0005]
  • In many assays, there will be an interest in determining the presence of specific sequences, whether genomic, synthetic or cDNA. These sequences may be associated particularly with genes, regulatory sequences, repeats, multimeric regions, expression patterns, and the like [0006]
  • There is and will continue to be comparisons of the sequences of different individuals. It is believed that there will be about one polymorphism per 1,000 bases, so that one may anticipate that there will be an extensive number of differences between individuals. By single nucleotide polymorphism (snp's) is intended that there will be a prevalent nucleotide at the site, with one or more of the remaining bases being present in substantially smaller percent of the population. [0007]
  • For the most part, the snp's will be in non-coding regions, primarily between genes, but will also be present in exons and introns. In addition, the great proportion of the snp's will not affect the phenotype of the individual, but will clearly affect the genotype. The snp's have a number of properties of interest. Since the snp's will be inherited, individual snp's and/or snp patterns may be related to genetic defects, such as detections, insertions and mutations involving one or more bases in genes. Rather than isolating and sequencing the target gene, it will be sufficient to identify the snp's involved. [0008]
  • In addition, the snp's may be used in forensic medicine to identify individuals. While other genetic markers are available, the large number of snp's and their extensive distribution in the chromosomes, make the snp's an attractive target. Also, by determining a plurality of snp's associated with a specific phenotype, one may use the snp pattern as an indication of the phenotype, rather than requiring a determination of the genes associated with the phenotype. [0009]
  • The need to determine many analytes or nucleic acid sequences (for example multiple pathogens or multiple genes or multiple genetic variants) in blood or other biological fluids has become increasingly apparent in many branches of medicine. The need to study differential expression of multiple genes to determine toxicologically-relevant outcomes or the need to screen transfused blood for viral contaminants with high sensitivity is clearly evident. [0010]
  • Thus most multi-analyte assays or assays which detect multiple nucleic acid sequences involve mutiple steps, have poor sensitivity and poor dynamic range (2 to 100-fold differences in concentration of the analytes is determined) and some require sophisticated instrumentation. [0011]
  • Some of the known classical methods for multianalyte assays include the following: [0012]
  • a. The use of two different radioisotope labels to distinguish two different analytes. [0013]
  • b. The use of two or more different fluorescent labels to distinguish two or more analytes. [0014]
  • c. The use of lanthanide chelates where both lifetime and wavelength are used to distinguish two or more analytes. [0015]
  • d. The use of fluorescent and chemiluminescent labels to distinguish two or more analytes. [0016]
  • e. The use of two different enzymes to distinguish two or more analytes. [0017]
  • f. The use of enzyme and acridinium esters to distinguish two or more analytes. [0018]
  • g. Spatial resolution of different analytes, for example, on arrays to identify and quantify multiple analytes. [0019]
  • h. The use of acridinium ester labels where lifetime or dioxetanone formation is used to quantify two different viral targets. [0020]
  • Thus an assay that has higher sensitivity, large dynamic range (10[0021] 3 to 104 - fold differences in target nucleic acids levels), greater degree of multiplexing, and fewer and more stable reagents would increase the simplicity and reliability of multianalyte assays.
  • The need to identify and quantify a large number of bases or sequences potentially distributed over centimorgans of DNA offers a major challenge. Any method should be accurate, reasonably economical in limiting the amount of reagents required and providing for a single assay, which allows for differentiation of the different snp's or differentiation and quantitation of multiple genes. [0022]
  • Finally, while nucleic acid sequences provide extreme diversity for situations that may be of biological or other interest, there are other types of compounds, such as proteins in proteomics that may also offer opportunities for multiplexed determinations. [0023]
    • BRIEF DESCRIPTION OF THE RELATED ART
  • Holland ([0024] Proc. Natl. Acad. Sci. USA (1991) 88:7276) discloses that the exonuclease activity of the thermostable enzyme Thermus aquaticus DNA polymerase in PCR amplification to generate specific detectable signal concomitantly with amplification.
  • The TaqMan assay is discussed by Lee in [0025] Nucleic Acid Research (1993) 21:16 3761).
  • White (Trends Biotechnology (1996) 14(12):478-483) discusses the problems of multiplexing in the Taqman assay. [0026]
  • Marino, [0027] Electrophoresis (1996) 17:1499 describes low-stringency-sequence specific PCR (LSSP-PCR). A PCR amplified sequence is subjected to single primer amplification under conditions of low stringency to produce a range of different length amplicons. Different patterns are obtained when there are differences in sequence. The patterns are unique to an individual and of possible value for identity testing.
  • Single strand conformational polymorphism (SSCP) yields similar results. In this method the PCR amplified DNA is denatured and sequence dependent conformations of the single strands are detected by their differing rates of migration during gel electrophoresis. As with LSSP-PCR above, different patterns are obtained that signal differences in sequence. However, neither LSSP-PCR nor SSCP gives specific sequence information and both depend on the questionable assumption that any base that is changed in a sequence will give rise to a conformational change that can be detected. [0028]
  • Pastinen, [0029] Clin. Chem. (1996) 42:1391 amplifies the target DNA and immobilizes the amplicons. Multiple primers are then allowed to hybridize to sites 3′ and contiguous to an SNP site of interest. Each primer has a different size that serves as a code. The hybridized primers are extended by one base using a fluorescently labeled dideoxynucleoside triphosphate. The size of each of the fluorescent products that is produced, determined by gel clectrophoresis, indicates the sequence and, thus, the location of the SNP. The identity of the base at the SNP site is defined by the triphosphate that is used. A similar approach is taken by Haff, Nucleic Acids Res. (1997) 25:3749 except that the sizing is carried out by mass spectroscopy and thus avoids the need for a label. However, both methods have the serious limitation that screening for a large number of sites will require large, very pure primers that can have troublesome secondary structures and be very expensive to synthesize.
  • Hacia, [0030] Nat. Genet. (1996) 14:441 uses a high density array of oligonucleotides. Labeled DNA samples were allowed to bind to 96,600 20-base oligonucleotides and the binding patterns produced from different individuals were compared. The method is attractive in that SNP's can be directly identified, but the cost of the arrays is high and non-specific hybridization may confound the accuracy of the genetic information.
  • Fan (1997, October 6-8, IBC, Annapolis Md.) has reported results of a large scale screening of human sequence-tagged sites. The accuracy of single nucleotide polymorphism screening was determined by conventional ABI resequencing. [0031]
  • Allele specific oligonucleotide hybridization along with mass spectroscopy has been discussed by Ross in [0032] Anal. Chem. (1997) 69:4197.
  • Holland, et al., PNAS USA (1991) 88, 7276-7280, describes use of [0033] DNA polymerase 5′-3′ exonuclease activity for detection of PCR products.
  • U.S. Pat. No. 5,807,682 describes probe compositions for detecting a plurality of nucleic acid targets. [0034]
    • SUMMARY OF THE INVENTION
  • Systems are provided comprising libraries of compositions for linking to or linked to assay reagents for performing simultaneous determinations in a single container. The systems combine entities that comprise e-tags (electrophoretic tags capable of being separated electrophoretically with the entities to which they are attached in a specific determination) that include mobility-identifying regions comprising a first functionality bonded to an assay reagent and a second functionality bonded to or for bonding to a detectable label, with a sample under conditions which produce an analyte-dependent detectable change in the mobility of the entities, means for moving the modified entities to an electrophoretic device, and a data processor for processing the data from the electrophoretic device. Libraries are employed comprising a plurality of e-tag containing compositions, where the e-tags are joined to assay reagents, a unit of an assay reagent or provide a functionality for linking to an assay reagent, where the linkage may be cleavable. The assays employ reagents for homogeneous (no required separation step) or heterogeneous (a separation step required) protocols. [0035]
  • The libraries comprise entities comprising electrophoretic tags that are small molecules (molecular weight of 150 to 5,000), usually other than oligomers, which can be used in any measurement technique that permits identification by mass, e.g. mass spectrometry, and or mass/charge ratio, as in mobility in electrophoresis. Simple variations in mass and/or mobility of the c-tag leads to generation of a library of e-tags, that can then be used to detect a plurality of individual events associated with different molecular species, generally related species. The e-tags are designed to be easily and rapidly separated, particularly in free solution without the need for a polymeric separation media. Quantitation is achieved using internal controls. Enhanced separation of the e-tags comprising a nucleotide in electrophoresis is achieved by modifying the tags with positively charged moieties.[0036]
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIGS. 1A, B and C depict the specific sequences of the snp detection sequences for the two alleles, the optical characteristics of the fluorescent dyes, and the cleaved fragments from the snp detection sequences, respectively; [0037]
  • FIGS. 2A and B depict the CE separation of the reaction products of [0038] Allele 1 after 0 and 40 cycles. CE instrument: Beckman P/ACE/ 5000 with LIF detection. BGE: 2.5% LLD 30, 7M urea, 1×TBE. Capillary: 100 μm i.d., 375 μm o.d., Lc=27 cm, Ld=6.9 cm. Detection; λex=488nm, λem=520nm. Injection: 5 s at 2.0 kV. Field strength: 100V/cm at rt. Peaks: P= unreacted snp detection sequence, P′= snp detection sequence product;
  • FIGS. 3A and B depict the CE separation of the reaction products of [0039] Allele 1 after 0 and 40 cycles. Experimental conditions are the same as FIG. 2, except for BGE composition; 2% LDD30, 1×TBE;
  • FIG. 4 is a graph of the CE separation of a 1:1 mixture of the 40 cycles products of [0040] Alleles 1 and 2, with experimental conditions as described for FIG. 2;
  • FIG. 5 is a graph of the CE separation of a 1:10 mixture of the 40 cycles products of [0041] Alleles 1 and 2, with experimental conditions as described for FIG. 2;
  • FIG. 6 is an electopherogram of e-tags, which involved a separation involving a 1000-fold difference in concentration; [0042]
  • FIGS. 7[0043] a, 7 b are the electropherograms of the analysis of 5 snps of the cystic fibrosis genes using multiplexed PCR and the subject e-tag probes. FIG. 7c is the electropherogram of the analysis of single snps and triple x snps for the cystic fibrosis genes using multiplexed PCR and the subject e-tag probes along with an agarose gel separation of the triple x PCR;
  • FIG. 8 is an electropherogram of a separation of 9 negatively charged e-tag probes. [0044]
  • FIGS. 9A and 9B are electropherograms of probes employing a penultimate thiophosphate linkage in the e-tag probes to discourage cleavage after the first phosphate linkage; [0045]
  • FIG. 10 is a cartoon of a system for performing multiplexed determinations using e-tags.[0046]
    • DESCRIPTION OF THE SPECIFIC EMBODIMENTS
  • A system is provided for the simultaneous multiplexed determination of a plurality of events employing electrophoresis to distinguish the events, comprising an electrophoretic device for electrophoretic separation and detection, a container containing a first set of first agents, referred to as “e-tags,” comprising differing mobility regions and a second reagent composition comprising at least one active second agent, under conditions where said second agent modifies at least one member of said first agent set resulting in a change of electrophoretic mobility of said at least one member to provide a modified member retaining said mobility region, and transfer of said at least one modified member to said electrophoretic device for separation and detection of said at least one modified member. The electrophoretic device may be connected to a data processor for receiving and processing data from the device, as well as operating the electrophoretic device [0047]
  • The systems are based on having libraries available comprising a plurality of e-tags that comprise at least a plurality of different mobility-identifying regions, so as to be separable in an electrophoresis with the entities to which the mobility-identifying regions are attached. The mobility-identifying regions are retained in the product of the reaction, where the product is modified by the gain and/or loss of a group that changes the mass and may also change the charge of the product, as compared to the starting material. In some instances, the mobility-identifying region may be joined to a target-binding region by a cleavable bond, so that the mobility-identifying region is released for analysis subsequent to the modification of the target-binding region, e.g. complex formation. [0048]
  • The subject invention provides compositions and methods for improved analysis of complex mixtures, where one is interested in the simultaneous identification of a plurality of entities, such as nucleic acid or amino acid sequences, snps, alleles, mutations, proteins, haptens, protein family members, expression products, etc., analysis of the response of a plurality of entities to an agent that can affect the mobility of the entities, and the like. Libraries of differentiable compounds are provided, where the compounds comprise a mobility-identifying region (including mass-identifying region) (“mir”), that provides for ready identification by electrophoresis or mass spectrometry (differentiation by mobility in an electrical field or magnetic field), by itself or in conjunction with a detectable label. Depending on the determination the product may also include one or more nucleotides or their equivalent, one or more amino acids or their equivalent, a functionality resulting from the release of the target-binding region or a modified functionality as a result of the action of an agent on the target-binding region. [0049]
  • The methodology involves employing detectable tags that can be differentiated by electrophoretic mobility or mass. The tags comprise mobility-identifying regions joined to a moiety that will undergo a change to produce a product. Depending on the nature of the change, the change may involve a change in mass and/or charge of the mir, the release of the mir from all or a portion of the target-binding region or may provide for the ability to sequester the mir from the starting material for preferential release of the mir. The differentiable tags, whether identified by electrophoresis or mass spectrometry, comprising the mir, with or without the detectable label and a portion of the target-binding region will be referred to as “e-tags.”[0050]
  • In addition, the subject invention employs a variety of reagent systems, where a binding event results in a change in mobility of the e-tag. The binding event is between a target-binding region and a target, and the reagent system recognizes this event and changes the nature of the e-tag containing target-binding region, so that the mobility and/or mass of the product is different from the starting material. The reagent system will frequently involve an enzyme and the reagent system may comprise the target. The effect of the reagent system is to make or break a bond by physical, chemical or enzymatic means. Each of the products of the different e-tag containing target-binding regions can be accurately detected, so as to determine the occurrence of the binding event. [0051]
  • The subject invention may be used for a variety of multiplexed analyses involving the action of one or more agents on a plurality of reagents comprising the mir and a target-binding region that undergoes a change as a result of a chemical reaction, resulting in a change in mobility of the product as compared to the starting material. The reaction may be the result of addition or deletion in relation to the target-binding region, so that the resulting product may be sequestered from the starting material. The subject systems find use in nucleic acid and protein analyses, reactions, particularly enzyme reactions, where one or more enzymes are acting on a group of different potential or actual substrates, and the like. [0052]
  • The e-tags are a group of reagents having a mir that with the other regions to which the mir is attached during separation provide for unique identification of an entity of interest. The mir of the e-tags can vary from a bond to about 100 atoms in a chain, usually not more than about 60 atoms, more usually not more than about 30 atoms, where the atoms are carbon, oxygen, nitrogen, phosphorous, boron and sulfur. Generally, when other than a bond, the mir will have from 0 to 40, more usually from 0 to 30 heteroatoms, which in addition to the heteroatoms indicated above will include halogen or other heteroatom. The total number of atoms other than hydrogen will generally be fewer than 200 atoms, usually fewer than 100 atoms. Where acid groups are present, depending upon the pH of the medium in which the mir is present, various cations may be associated with the acid group. The acids may be organic or inorganic, including carboxyl, thionocarboxyl, thiocarboxyl, hydroxamic, phosphate, phosphite, phosphonate, sulfonate, sulfinate, boronic, nitric, nitrous, etc. For positive charges, substituents will include amino (includes ammonium), phosphonium, sulfonium, oxonium, etc., where substituents will generally be aliphatic of from about 1-6 carbon atoms, the total number of carbon atoms per heteroatom, usually be less than about 12, usually less than about 9. The mir may be neutral or charged depending on the other regions to which the mir is attached, at least one of the regions having at least one charge. Neutral mirs will generally be polymethylene, halo- or polyhaloalkylene or aralkylene (a combination of aromatic—includes heterocycleic—and aliphatic groups), where halogen will generally be fluorine, chlorine, bromine or iodine, polyethers, particularly, polyoxyalkylene, wherein alkyl is of from 2-3 carbon atoms, polyesters, e.g. polyglycolide and polylactide, dendrimers, comprising ethers or thioethers, oligomers of addition and condensation monomers, e.g. acrylates, diacids and diols, etc. The side chains include amines, ammonium salts, hydroxyl groups, including phenolic groups, carboxyl groups, esters, amides, phosphates, heterocycles, particularly nitrogen heterocycles, such as the nucleoside bases and the amino acid side chains, such as imidazole and quinoline, thioethers, thiols, or other groups of interest to change the mobility of the e-tag. The mir may be a homooligomer or a heterooligomer, having different monomers of the same or different chemical characteristics, e.g., nucleotides and amino acids. Desirably neutral mass differentiating groups will be combined with short charged sequences to provide the mir. [0053]
  • The charged mirs will generally have only negative or positive charges, although, one may have a combination of charges, particularly where a region to which the mir is attached is charged and the mir has the opposite charge. The mirs may have a single monomer that provides the different functionalities for oligomerization and carry a charge or two monomers may be employed, generally two monomers. One may use substituted diols, where the substituents are charged and dibasic acids. Illustrative of such oligomers are the combination of diols or diamino, such as 2,3-dihydroxypropionic acid, 2,3-dihydroxysuccinic acid, 2,3-diaminosuccinic acid, 2,4-dihydroxyglutaric acid, etc. The diols or diamino compounds can be linked by dibasic acids, which dibasic acids include the inorganic dibasic acids indicated above, as well as dibasic acids, such as oxalic acid, malonic acid, succinic acid, maleic acid, furmaric acid, carbonic acid, etc. Instead of using esters, one may use amides, where amino acids or diamines and diacids may be employed. Alternatively, one may link the hydroxyls or amines with alkylene or arylene groups. [0054]
  • By employing monomers that have substituents that provide for charges or which may be modified to provide charges, one can provide for mirs having the desired mass/charge ratio. For example, by using serine or threonine, one may modify the hydroxyl groups with phosphate to provide negatively charged mirs. With arginine, lysine and histidine, one provides for positively charged mirs. Oligomerization may be performed in conventional ways to provide the appropriately sized mir. The different mirs having different orders of oligomers, generally having from 1 to 20 monomeric units, more usually about 1 to 12, where a unit intends a repetitive unit that may have from 1 to 2 different monomers. For the most part, oligomers will be used with other than nucleic acid target-binding regions. The polyfunctionality of the monomeric units provides for functionalities at the termini that may be used for conjugation to other moieties, so that one may use the available functionality for reaction to provide a different functionality. For example, one may react a carboxyl group with an aminoethylthiol, to replace the carboxyl group with a thiol functionality for reaction with an activated olefin. [0055]
  • By using monomers that have 1-3 charges, one may employ a low number of monomers and provide for mobility variation with changes in molecular weight. Of particular interest are polyolpolycarboxylic acids having from about two to four of each functionality, such as tartaric acid, 2,3-dihydroxyterephthalic acid, 3,4-dihydroxyphthalic acid, Δ[0056] 5-tetrahydro-3,4-dihydroxyphthalic acid, etc. To provide for an additional negative charge, these monomers may be oligomerized with a dibasic acid, such as a phosphoric acid derivative to form the phosphate diester. Alternatively, the carboxylic acids could be used with a diamine to form a polyamide, while the hydroxyl groups could be used to form esters, such as phosphate esters, or ethers such as the ether of glycolic acid, etc. To vary the mobility, various aliphatic groups of differing molecular weight may be employed, such as polymethylenes, polyoxyalkylenes, polyhaloaliphatic or—aromatic groups, polyols, e.g. sugars, where the mobility will differ by at least about 0.01, more usually at least about 0.02 and more usually at least about 0.5. Alternatively, the libraries may include oligopeptides for providing the charge, particularly oligopeptides of from 2-6, usually 2-4 monomers, either positive charges resulting from lysine, arginine and histidine or negative charges, resulting from aspartic and glutamic acid. Of course, one need not use naturally occurring amino acids, but unnatural or-synthetic amino acids, such as taurine, phosphate substituted serine or threonine, S-α-succinylcysteine, co-oligomers of diamines and amino acids, etc.
  • Where the e-tags are used for mass detection, as with mass spectrometry, the e-tags need not be charged but merely differ in mass, since a charge will be imparted to the e-tags by the mass spectrometer. Thus, one could use the same or similar monomers, where the functionalities would be neutral or made neutral, such as esters and amides of carboxylic acids. Also, one may vary the e-tags by isotopic substitution, such as [0057] 2H, 18O, 14C, etc.
  • The libraries will ordinarily have at least about 5 members, usually at least about 10 members, and may have 100 members or more, for convenience generally having about 50-75 members. Some members may be combined in a single container or be provided in individual containers, depending upon the region to which the mir is attached. The members of the library will be selected to provide clean separations in electrophoresis, when capillary clectrophoresis is the analytical method. To that extent, mobilities will differ as described above, where the separations may be greater, the larger the larger the number of molecules in the band to be analyzed. Particularly, non-sieving media may be employed in the separation. [0058]
  • An e-tag will be a molecule, which is labeled with a directly detectable label or can be made so by having a functionality that can be used for bonding to a detectable label, if such label is required for detection. The e-tags will be differentiated by their electrophoretic mobility, usually their mass/charge ratio, to provide different mobilities for each e-tag. Although in some instances the e-tags may have identical mass/charge ratios, such as oligonucleotides, but differ in size or shape and therefore exhibit different electrophoretic mobilities under appropriate conditions. Therefore, the tags will be amenable to electrophoretic separation and detection, although other methods of differentiating the tags may also find use. The e-tag may be joined to any convenient site on the target binding reagent, without interfering with the synthesis, release and binding of the e-tag labeled reagent. For nucleotides, the e-tag may be bound to a site on the base, either an annular carbon atom or a hydroxyl or amino substituent. [0059]
  • The e-tag may be linked by a stable bond or one, which may be cleavable, thermally, photolytically or chemically. There is an interest in cleaving the e-tag from the target-binding region in situations where cleavage of the target-binding region results in significant cleavage at other than the desired site of cleavage, resulting in satellite cleavage products, such as di- and higher oligonucleotides and this family of products interferes with the separation and detection of the e-tags. However, rather than requiring an additional step in the identification of the tags by releasing them from the base to which they are attached, one can modify the target binding sequence to minimize obtaining cleavage at other than the desired bond, for example, the ultimate or penultimate phosphate link in a nucleic acid sequence. For immunoassays involving specific binding members, bonding of the e-tag will usually be through a cleavable bond to a convenient functionality, such as carboxy, hydroxy, amino or thiol, particularly as associated with proteins, lipids and saccharides. [0060]
  • If present, the nature of the cleavable link resulting in release of the e-tag may be varied widely. Numerous linkages are available, which are thermally, photolytically or chemically labile. See, for example, U.S. Pat. No. 5,721,099. Where detachment of the product from all or a portion of the target-binding region is desired, there are numerous functionalities and reactants, which may be used. Conveniently, ethers may be used, where substituted benzyl ether or derivatives thereof, e.g. benzhydryl ether, indanyl ether, etc. may be cleaved by acidic or mild reductive conditions. Alternatively, one may employ beta-elimination, where a mild base may serve to release the product. Acetals, including the thio analogs thereof, may be employed, where mild acid, particularly in the presence of a capturing carbonyl compound, may serve. By combining formaldehyde, HCl and an alcohol moiety, an α-chloroether is formed. This may then be coupled with an hydroxy functionality to form the acetal. Various photolabile linkages may be employed, such as o-nitrobenzyl, 7-nitroindanyl, 2-nitrobenzhydryl ethers or esters, etc. [0061]
  • For a list of cleavable linkages, see, for example, Greene and Wuts, Protective Groups in Organic Synthesis, 2[0062] nd ed. Wiley, 1991. The versatility of the various systems that have been developed allows for broad variation in the conditions for attachment of the e-tag entities.
  • Various functionalities for cleavage are illustrated by: silyl groups being cleaved with fluoride, oxidation, acid, bromine or chlorine; o-nitrobenzyl with light; catechols with cerium salts; olefins with ozone, permanganate or osmium tetroxide; sulfides with singlet oxygen or enzyme catalyzed oxidative cleavage with hydrogen peroxide, where the resulting sulfone can undergo elimination; furans with oxygen or bromine in methanol; tertiary alcohols with acid; ketals and acetals with acid; α- and β-substituted ethers and esters with base, where the substituent is an electron withdrawing group, e.g., sulfone, sulfoxide, ketone, etc., and the like [0063]
  • The mir will link the target-binding region and the detectable label molecule, usually a fluorescer, or a functionality, which may be used for linking to a detectable label molecule. By having different functionalities, which may be individually bonded to a detectable label molecule, one enhances the opportunity for diversity of the e-tags. Using different fluorescers for joining to the different functionalities, the different fluorescers can provide differences in light emission and mass/charge ratios for the e-tags. [0064]
  • As discussed previously, the mir may be an oligomer, where the monomers may differ as to mass and charge. For convenience and economy, monomers will generally be commercially available, but if desired, they may be originally synthesized. Monomers which are commercially available and readily lend themselves to oligomerization include amino acids, both natural and synthetic, monosaccharides, both natural and synthetic, while other monomers include hydroxyacids, where the acids may be organic or inorganic, e.g. carboxylic, phosphoric, boric, sulfonic, etc., and amino acids, where the acid is inorganic, and the like. In some instances, nucleotides, natural or synthetic, may find use. The monomers may be neutral, negatively charged or positively charged or modified to be charged or neutral, e.g. sugars that are phosphorylated, amino acids that are acylated. Normally, the charges of the monomers in the mir will be the same, so that in referring to the mass/charge ratio, it will be related to the same charge. Where the label has a different charge from the mir, this will be treated as if the number of charges is reduced by the number of charges on the mir. For natural amino acids, the positive charges may be obtained from lysine, arginine and histidine, while the negative charges may be obtained from aspartic and glutamic acid. For nucleotides, the charges will be obtained from the phosphate and any substituents that may be present or introduced onto the base. For sugars, sialic acid and uronic acids of the various sugars, or substituted sugars may be employed. [0065]
  • The mir may be joined in any convenient manner to the unit of the target-binding region, such as the base of the nucleoside or the amino acid of a protein. Various functionalities which may be used include alkylamine, amidine, thioamide, ether, urea, thiourea, guanidine, azo, thioether and carboxylate, sulfonate, and phosphate esters, amides and thioesters. [0066]
  • Besides the nature of the mir, as already indicated, diversity can be achieved by the chemical and optical characteristics of the label, the use of energy transfer complexes, variation in the chemical nature of the mir, which affects mobility, such as folding, interaction with the solvent and ions in the solvent, and the like. As already suggested, the mir will usually be an oligomer, where the mir may be synthesized on a support or produced by cloning or expression in an appropriate host. Conveniently, polypeptides can be produced where there is only one cysteine or serine/threonine/tyrosine, aspartic/glutamic acid, or lysine/arginine/histidine, other than an end group, so that there is a unique functionality, which may be differentially functionalized. By using protective groups, one can distinguish a side chain functionality from a terminal amino acid functionality. Also, by appropriate design, one may provide for preferential reaction between the same functionalities present at different sites on-the mir. Whether one uses synthesis or cloning for preparation of oligopeptides, will to a substantial degree depend on the length of the mir. [0067]
  • The e-tag, which is detected, will comprise the mir, generally a label, and optionally a portion of the target-binding region, all of the target-binding region when the target is an enzyme and the target-binding region is the substrate. Generally, the e-tag will have a charge/mass ratio in the range of about −0.0001 to 1, usually in the range of about −0.001 to about 0.5. Mobility is proportional to q/M[0068] ⅔, where q is the charge on the molecule and M is the mass of the molecule. Desirably, the difference in mobility under the conditions of the determination between the closest electrophoretic labels will be at least about 0.001, usually 0.002, more usually at least about 0.01, and may be 0.02 or more.
  • Depending upon the reagent to which the e-tag is attached, there may be a single e-tag or a plurality of e-tags, generally ranging from about 1-100, more usually ranging from about 1-40, more particularly ranging from about 1-20. The number of e-tags bonded to a single target-binding region will depend upon the sensitivity required, the solubility of the e-tag conjugate, the effect on the assay of a plurality of e-tags, and the like. For oligomers or polymers, such as nucleic acids and poly(amino acids), e.g. peptides and proteins, one may have one or a plurality of e-tags, while for synthetic or naturally occurring non-oligomeric compounds, usually there will be only 1-3, more usually 1-2 e-tags. [0069]
  • The e-tag for use in electrophoresis may be represented by the formula: [0070]
  • R-L-T
  • wherein R is a label, particularly a fluorescer, L is a mir, a bond or a linking group as described previously, where L and the regions to which L is attached provide for the variation in mobility of the e-tags. T comprises a portion of the target-binding region, particularly a nucleoside base, purine or pyrimidine, and is the base, a nucleoside, nucleotide or nucleotide triphosphate, an amino acid, either naturally occurring or synthetic, or other functionality that may serve to participate in the synthesis of an oligomer, when T is retained, and is otherwise a functionality resulting from the cleavage between L, the mir, and the target-binding region. L provides a major factor in the differences in mobility between the different e-tags, in combination with the label and any residual entity, which remain with the mir. L may or may not include a cleavable bond, depending upon whether the terminal entity to which L is attached is to be retained or completely removed. [0071]
  • L has been substantially described as the mir and as indicated previously may include charged groups, uncharged polar groups or be non-polar. The groups may be alkylene and substituted alkylenes, oxyalkylene and polyoxyalkylene, particularly alkylene of from 2 to 3 carbon atoms, arylenes and substituted arylenes, polyamides, polyethers, polyalkylene amines, etc. Substituents may include heteroatoms, such as halo, phosphorous, nitrogen, oxygen, sulfur, etc., where the substituent may be halo, nitro, cyano, non-oxo-carbonyl, e.g. ester, acid and amide, oxo-carbonyl, e.g. aldehyde and keto, amidine, urea, urethane, guanidine, carbamyl, amino and substituted amino, particularly alkyl substituted amino, azo, oxy, e.g. hydroxyl and ether, etc., where the substituents will generally be of from about 0 to 10 carbon atoms, while L will generally be of from about 1 to 100 carbon atoms, more usually of from about 1 to 60 carbon atoms and preferably about 1 to 36 carbon atoms. L will be joined to the label and the target-binding region by any convenient functionality, such as carboxy, amino, oxy, phospo, thio, iminoether, etc., where in many cases the label and the target-binding region will have a convenient functionality for linkage. [0072]
  • The number of heteroatoms in L is sufficient to impart the desired charge to the label conjugate, usually from about 1 to about 200, more usually from about 2 to 100, heteroatoms. The heteroatoms in L may be substituted with atoms other than hydrogen. [0073]
  • The charge-imparting moieties of L may be, for example, amino acids, tetraalkylammonium, phosphonium, phosphate diesters, carboxylic acids, thioacids, sulfonic acids, sulfate groups, phosphate monoesters, and the like and combinations of one or more of the above. The number of the above components of L is such as to achieve the desired number of different charge-imparting moieties. The amino acids may be, for example, lysine, aspartic acid, alanine, gamma-aminobutyric acid, glycine, β-alanine, cysteine, glutamic acid, homocysteine, β-alanine and the like. The phosphate diesters include, for example, dimethyl phosphate diester, ethylene glycol linked phosphate diester, and so forth. The thioacids include, by way of example, thioacetic acid, thiopropionic acid, thiobutyric acid and so forth. The carboxylic acids preferably have from 1 to 30 carbon atoms, more preferably, from 2 to 15 carbon atoms and preferably comprise one or more heteroatoms and may be, for example, acetic acid derivatives, formic acid derivatives, succinic acid derivatives, citric acid derivatives, phytic acid derivatives and the like. In one embodiment of the present invention the label conjugates having different charge to mass ratios may comprise fluorescent compounds, each of which are linked to molecules that impart a charge to the fluorescent compound conjugate. As indicated previously, desirably the linking group has an overall negative charge, preferably having in the case of a plurality of groups, groups of the same charge, where the total charge may be reduced by having one or more oppositely charged moiety. [0074]
  • Of particular interest for L is to have two sub-regions, a common charged sub-region, which will be common to a group of e-tags, and a varying uncharged, a non-polar or polar sub-region, that will vary the mass/charge ratio. This permits ease of synthesis, provides for relatively common chemical and physical properties and permits ease of handling. For negative charges, one may use dibasic acids that are substituted with functionalities that permit low orders of oligomerization, such as hydroxy and amino, where amino will usually be present as neutral amide. These charge imparting groups provide aqueous solubility and allow for various levels of hydrophobicity in the other sub-region.. Thus the uncharged sub-region could employ substituted dihydroxybenzenes, diaminobenzenes, or aminophenols, with one or greater number of aromatic rings, fused or non-fused, where substituents may be halo, nitro, cyano, alkyl, etc., allowing for great variation in molecular weight by using a common building block. Where the other regions of the e-tag impart charge to the e-tag, L may be neutral. [0075]
  • In some instances, where release of the e-tag results in an available functionality that can be used to react with a detectable label, there will be no need for R to be a functionality. The release of the e-tag can provide an hydroxyl, amino, carboxy or thiol group, where each may serve as the site for conjugation to the detectable label. To the extent that the e-tag is released free of a component of the target-binding region, this opportunity will be present. In that case, R is the unreactive (under the conditions of the conjugation) terminus of L and T is a functionality for release of the e-tag that may be joined to all or a portion of the target-binding region or may be available for binding to all or a portion of the target-binding region. [0076]
  • Combinations of particular interest comprise a fluorescent compound and a different amino acid or combinations thereof in the form of a peptide or combinations of amino acids and thioacids or other carboxylic acids. Such compounds are represented by the formula: [0077]
  • R′-L′-T′
  • wherein R′ is a fluorescer, L′ is is an amino acid or a peptide or combinations of amino acids and thioacids or other carboxylic acids and T′ is a functionality for linking to a nucleoside base or is a nucleoside, nucleotide or nucleotide triphosphate or other moiety as described above for T. [0078]
  • In one embodiment of the present invention, the charge-imparting moiety is conveniently composed primarily of amino acids but also may include thioacids and other carboxylic acids having from one to five carbon atoms. The charge-imparting moiety may have from 1 to 30, preferably 1 to 20, more preferably, 1 to 10 amino acids per moiety and may also comprise 1 to 3 thioacids or other carboxylic acids. Howeever, when used with an uncharged sub-region, the charged sub-region will generally have from 1-4, frequently 1-3 amino acids. As mentioned above, any amino acid, both naturally occurring and synthetic may be employed. [0079]
  • In a particular embodiment the label conjugates may be represented by the formula: [0080]
  • Fluorescer-L″-(amino acid)n-T″
  • wherein L″ is a bond or a linking group of from 1 to 20 atoms other than hydrogen, n is 1 to 20, and T″ comprises a nucleoside base, purine or pyrimidine, including a base, a nucleoside, a nucleotide or nucleotide triphosphates, an amino acid, or functionality for linking to the target-binding region. An example of label conjugates in this embodiment, by way of illustration and not limitation, is one in which the fluorescer is fluorescein, L″ is a bond in the form of an amide linkage involving the meta-carboxyl of the fluorescein and the terminal amine group of lysine, and T″ is a nucleotide triphosphate. These label conjugates may be represented as follows: [0081]
  • Fluorescein-(CO)NH—CH(CH2)3CH(NH2)(amino acid)nCOX″
  • wherein X is as set forth in Table 1. [0082]
    TABLE 1
    No. X Charge
    1 OH −2
    2 NH-lysine −1
    3 NH-(lysine)2 neutral
    4 NH-alanine −3
    5 NH-aspartic acid −4
    6 NH-(aspartic acid)2 −5
    7 NH-(aspartic acid)3 −6
    8 NH-(aspartic acid)4 −7
    9 NH-(aspartic acid)5 −8
    10 NH-(aspartic acid)6 −9
    11 NH-(aspartic acid)7 −10
    12 NH-alanine-lysine −2 (unique q/M)
    13 NH-aspartic acid-lysine −3 (unique q/M)
    14 NH-(aspartic acid)2 -lysine −4 (unique q/M)
    15 NH-(aspartic acid)3 -lysine −5 (unique q/M)
    16 NH-(aspartic acid)4 -lysine −6 (unique q/M)
    17 NH-(aspartic acid)5 -lysine −7 (unique q/M)
    18 NH-(aspartic acid)6 -lysine −8 (unique q/M)
    19 NH-(aspartic acid)7 -lysine −9 (unique q/M)
    20 NH-(aspartic acid)8 -lysine −10 (unique q/M)
    21 NH-(lysine)4 +1
    22 NH-(lysine)5 +2
  • wherein q is charge, M is mass and mobility is q/M[0083] ⅔. Examples of such label conjugates are shown in FIG. 1C.
  • Table 2 shows various characteristics for the label conjugates. [0084]
    TABLE 2
    No. Mass (M) Charge (q) M2/3 q/M2/3 Mobility
    1 744.82 0 82.16765 0 0
    2 877.02 0 91.62336 0 0
    3 828.71 −1 88.22704 −0.01133 −0.16546
    4 970.71 −1 98.03767 −0.0102 −0.1489
    5 700.82 −2 78.89891 −0.02535 −0.37004
    6 842.83 −2 89.22639 −0.2241 −0.32721
    7 815.92 −3 87.31692 −0.03436 −0.50155
    8 957.92 −3 97.17461 −0.03087 −0.45067
    9 931.02 −4 95.34677 −0.04195 −0.61242
    10 1073.02 −4 104.8106 −0.03816 −0.55712
    11 1046 −5 103.0436 −0.04852 −0.70834
    12 1188 −5 112.1702 −0.04458 −0.65071
    13 1161 −6 110.4642 −0.05432 −0.79291
    14 1303 −6 119.297 −0.05029 −0.7342
    15 1276 −7 117.6433 −0.0595 −0.86861
    16 1418 −7 126.2169 −0.05546 −0.80961
    17 1391 −8 124.6096 −0.0642 −0.9372
    18 1533 −8 132.952 −0.06017 −0.87839
    19 1506 −9 131.3863 −0.0685 −0.99997
    20 1648 −9 139.6205 −0.06451 −0.94167
    21 793.52 1 85.7114 0.011667 0.170316
    22 935.52 1 95.65376 0.010454 0.152613
  • Another group of e-tags has a mir which is dependent on using an alkylene or aralkylene (comprising a divalent aliphatic group having 1-2 aliphatic regions and 1-2 aromatic regions, generally benzene), where the groups may be substituted or unsubstituted, usually unsubstituted, of from 2-16, more usually 2-12, carbon atoms, where the mir may link the same or different fluorescers to a monomeric unit, e.g. a nucleotide. The mir may terminate in a carboxy, hydroxy or amino group, being present as an ester or amide. By varying the substituents on the fluorophor, one can vary the mass in units of at least 5 or more, usually at least about 9, so as to be able to obtain satisfactory separation in capillary electrophoresis. To provide further variation, a thiosuccinimide group may be employed to join alkylene or aralkylene groups at the nitrogen and sulfur, so that the total number of carbon atoms may be in the range of about 2-30, more usually 2-20. Instead of or in combination with the above groups and to add hydrophilicity, one may use alkyleneoxy groups. [0085]
  • The label conjugates may be prepared utilizing conjugating techniques that are well known in the art. The charge-imparting moiety L may be synthesized from smaller molecules that have functional groups that provide for linking of the molecules to one another, usually in a linear chain. Such functional groups include carboxylic acids, amines, and hydroxy- or thiol-groups. In accordance with the present invention the charge-imparting moiety may have one or more side groups pending from the core chain. The side groups have a functionality to provide for linking to a label or to another molecule of the charge-imparting moiety. [0086]
  • Common functionalities of L resulting from the reaction of the functional groups employed are exemplified by forming a covalent bond between the molecules to be conjugated. Such functionalities are disulfide, amide, thioamide, dithiol, ether, urea, thiourea, guanidine, azo, thioether, carboxylate and esters and amides containing sulfur and phosphorus such as, e.g. sulfonate, phosphate esters, sulfonamides, thioesters, etc., and the like. [0087]
  • The chemistry for performing the types of syntheses to form the charge-imparting moiety as a peptide chain is well known in the art. See, for example, Marglin, et al., [0088] Ann. Rev. Biochem. (1970) 39:841-866. In general, such syntheses involve blocking, with an appropriate protecting group, those functional groups that are not to be involved in the reaction. The free functional groups are then reacted to form the desired linkages. The peptide can be produced on a resin as in the Merrifield synthesis (Merrifield, J. Am. Chem. Soc. (1980) 85:2149-2154 and Houghten et al., Int. J. Pep. Prot. Res. (1980) 16:311-320. The peptide is then removed from the resin according to known techniques.
  • A summary of the many techniques available for the synthesis of peptides may be found in J. M. Stewart, et al., “Solid Phase Peptide Synthesis, W. H. Freeman Co, San Francisco (1969); and J. Meienhofer, “Hormonal Proteins and Peptides”, (1973), vol. 2, p 46., Academic Press (New York), for solid phase peptide synthesis and E. Schroder, et al., “The Peptides, vol. 1, Academic Press (New York), 1965 for solution synthesis. [0089]
  • In general, these methods comprise the sequential addition of one or more amino acids, or suitably protected amino acids, to a growing peptide chain. Normally, a suitable protecting group protects either the amino or carboxyl group of the first amino acid. The protected or derivatized amino acid can then be either attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complementary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage. The protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide. The protecting groups are removed, as desired, according to known methods depending on the particular protecting group utilized. For example, the protecting group may be removed by reduction with hydrogen and palladium on charcoal, sodium in liquid ammonia, etc.; hydrolysis with trifluoroacetic acid, hydrofluoric acid, and the like. [0090]
  • After the synthesis of the peptide is complete, the peptide is removed from the resin by conventional means such as ammonolysis, acidolysis and the like. The fully deprotected peptide may then be purified by techniques known in the art such as chromatography, for example, adsorption chromatography; ion exchange chromatography, partition chromatography, high performance liquid chromatography, thin layer chromatography, and so forth. [0091]
  • As can be seen, the selected peptide representing a charge-imparting moiety may be synthesized separately and then attached to the label either directly or by means of a linking group. On the other hand, the peptide may be synthesized as a growing chain on the label. In any of the above approaches, the linking of the peptide or amino acid to the label may be carried out using one or more of the techniques described above for the synthesis of peptides or for linking moieties to labels. [0092]
  • Synthesis of e-tags comprising nucleotides can be easily and effectively achieved via assembly on solid phase support during probe synthesis using standard phosphoramidite chemistries. The e-tags are assembled at the 5 end of probes after coupling of a final nucleosidic residue, which becomes part of the e-tag during the assay. In one approach, the e-tag is constructed sequentially from a single or several monomeric phosphoramidite building blocks (one containing a dye residue), which are chosen to generate tags with unique electrophoretic mobilities based on their mass to charge ratio. The e-tag is thus composed of monomeric units of variable charge to mass ratios bridged by phosphate linkers (Figure A). The separation of e-tags, which differ by 9 mass units (Table 3) has been demonstrated. The nucleosidic phosphoramidites employed for tag [0093]
    Figure US20030175747A1-20030918-P00001
  • synthesis are initially either modified or natural residues. Fluorescein has been the initial dye employed but other dyes can be used as well. Some of the combinations of phosphoramidite building blocks with their predicted elution times are presented in Table 4. e-tags are synthesized to generate a contiguous spectrum of signals, one eluting after another with none of them coeluting (Figure B). [0094]
    Figure US20030175747A1-20030918-P00002
    TABLE 3
    e-tags that have been separated on a LabCard (detection: 4.7 cm; 200 V/cm).
    E-Tag Elution Time on CE (sec) Mass
    Figure US20030175747A1-20030918-C00001
         		385 778
    Figure US20030175747A1-20030918-C00002
         		428 925
    Figure US20030175747A1-20030918-C00003
         		438 901
    Figure US20030175747A1-20030918-C00004
         		462 994
    Figure US20030175747A1-20030918-C00005
         		480 985
    Figure US20030175747A1-20030918-C00006
         		555 961
  • [0095]
    TABLE 4
    Predicted and experimental (*) elution times of e-tags. C3, C6, C9, C18,
    are commercially available phosphoramidite spacers from Glen Research, Sterling VA.
    The units are derivatives of N,N-diisopropyl, O-cyanoethyl phosphoramidite,
    which in the following formulas will be indicated by “Q”.
    C3 is DMT (dimethoxytrityl)oxypropyl Q; C6 is DMToxyhexyl Q;
    C9 is DMToxy(triethyleneoxy) Q; C12 is DMToxydodecyl Q;
    C18 is DMToxy(hexaethyleneoxy) Q.
    Etag Charge Elution Time
    Figure US20030175747A1-20030918-C00007
         		−
    9 41.12
    Figure US20030175747A1-20030918-C00008
         		−8 43.72
    Figure US20030175747A1-20030918-C00009
         		−9 45.66
    Figure US20030175747A1-20030918-C00010
         		−8 48.14
    Figure US20030175747A1-20030918-C00011
         		−7 51.21
    Figure US20030175747A1-20030918-C00012
         		−6 53.53
    Figure US20030175747A1-20030918-C00013
         		−6 55.13
    Figure US20030175747A1-20030918-C00014
         		−5 57.66
    Figure US20030175747A1-20030918-C00015
         		−5 60.00
    Figure US20030175747A1-20030918-C00016
         		−5 62.86
    Figure US20030175747A1-20030918-C00017
         		−6 65.00*
    Figure US20030175747A1-20030918-C00018
         		−5 67.50*
    Figure US20030175747A1-20030918-C00019
         		−4 69.61
    Figure US20030175747A1-20030918-C00020
         		−4 72.00*
  • All of the above e-tags work well and are easily separable and elute after 40 minutes. To generate tags that elute faster, highly charged low molecular weight tags are required. Several types of phosphoramidite monomers allow for the synthesis of highly charged tags with early elution times. Use of dicarboxylate phosphoramidites (FIG. 5A) allows for the addition of 3 negative charges per coupling of monomer. A variety of fluorescein derivatives (FIG. 5B) allow the dye component of the tag to carry a higher mass than standard fluorescein. Polyhydroxylated phosphoramidites (FIG. 6) in combination with a common phosphorylation reagent enable the synthesis of highly phosphorylated tags. Combinations of these reagents with other mass modifier linker phosphoramidites allow for the synthesis of tags with early elution times. [0096]
    Figure US20030175747A1-20030918-P00003
  • The aforementioned label conjugates with different electrophoretic mobility permit a multiplexed amplification and detection of multiple targets, e.g. nucleic acid targets. The label conjugates are linked to oligonucleotides in a manner similar to that for labels in general, by means of linkages that are enzymatically cleavable. It is, of course, within the purview of the present invention to prepare any number of label conjugates for performing multiplexed determinations. Accordingly, for example, with 40 to 50 different label conjugates separated in a single separation channel and 96 different amplification reactions with 96 separation channels on a single plastic chip, one can detect 4000 to 5000 single nucleotide polymorphisms. [0097]
  • The separation of e-tags, which differ by 9 mass units (Table 3) has been demonstrated as shown in FIG. 7. The penultimate coupling during probe synthesis is initially carried out using commercially available modified (and unmodified) phosphoramidites (Table 4). This residue is able to form hydrogen bonds to its partner in the target strand and is considered a mass modifier but could potentially be a charge modifier as well. The phosphate bridge formed during this coupling is the linkage severed during a 5′-nuclease assay. The final coupling is done using a phosphoramidite analogue of a dye. Fluorescein is conveniently employed, but other dyes can be used as well. [0098]
  • One synthetic approach is outlined in [0099] Scheme 1. Starting with commercially available 6-carboxy fluorescein, the phenolic hydroxyl groups are protected using an anhydride. Isobutyric anhydride in pyridine was employed but other variants are equally suitable. It is important to note the significance of choosing an ester functionality as the protecting group. This species remains intact though the phosphoramidite monomer synthesis as well as during oligonucleotide construction. These groups are not removed until the synthesized oligo is deprotected using ammonia. After protection the crude material is then activated in situ via formation of an N-hydroxy succinimide ester (NHS-ester) using DCC as a coupling agent. The DCU byproduct is filtered away and an amino alcohol is added. Many amino alcohols are commercially available some of which are derived from reduction of amino acids. Only the amine is reactive enough to displace N-hydroxy succinimide.
    Figure US20030175747A1-20030918-C00021
  • Upon standard extractive workup, a 95% yield of product is obtained. This material is phosphitylated to generate the phosphoramidite monomer (Scheme 1). For the synthesis of additional e-tags, a symmetrical bisamino alcohol linker is used as the amino alcohol (Scheme 2). As such the second amine is then coupled with a multitude of carboxylic acid derivatives (Table 3) prior to the phosphitylation reaction. Using this methodology hundreds if not thousands of e-tags with varying charge to mass ratios can easily be assembled during probe synthesis on a DNA synthesizer using standard chemistries. [0100]
    Figure US20030175747A1-20030918-C00022
  • Additional e-tags are accessed via an alternative strategy which uses 5-aminofluorescein as starting material (Scheme 3). Addition of 5-aminofluorescein to a great excess of a diacid chloride in a large volume of solvent allows for the predominant formation of the monoacylated product over dimer formation. The phenolic groups are not reactive under these conditions. Aqueous workup converts the terminal acid chloride to a carboxylic acid. This product is analogous to 6-carboxy fluorescein and using the same series of steps is converted to its protected phosphoramidite monomer (Scheme 3). There are many commercially available di(acid chorides) and diacids, which can be converted to diacid chlorides using SOCl[0101] 2 or acetyl chloride. This methodology is highly attractive in that a second mass modifier is used. As such, if one has access to 10 commercial modified phosphoramidites and 10 diacid chlorides and 10 amino alcohols there is a potential for 1000 different e-tags. There are many commercial diacid chlorides and amino alcohols (Table 6). These synthetic approaches are ideally suited for combinatorial chemistry.
    Figure US20030175747A1-20030918-C00023
    TABLE 5
    Benzoic acid derivatives as mass and charge modifiers.
    (Mass is written below each modifier)
    Figure US20030175747A1-20030918-C00024
    122
    Figure US20030175747A1-20030918-C00025
    138
    Figure US20030175747A1-20030918-C00026
    151
    Figure US20030175747A1-20030918-C00027
    176
    Figure US20030175747A1-20030918-C00028
    181
    Figure US20030175747A1-20030918-C00029
    191
    Figure US20030175747A1-20030918-C00030
    198
    Figure US20030175747A1-20030918-C00031
    214
    Figure US20030175747A1-20030918-C00032
    226
    Figure US20030175747A1-20030918-C00033
    249
    Figure US20030175747A1-20030918-C00034
    258
    Figure US20030175747A1-20030918-C00035
    309
  • [0102]
    TABLE 6
    Mass and charge modifiers that can be used for conversion of
    amino dyes into e-tag phosphoramidite monomers.
    Figure US20030175747A1-20030918-C00036
    Figure US20030175747A1-20030918-C00037
    Figure US20030175747A1-20030918-C00038
    Figure US20030175747A1-20030918-C00039
    Figure US20030175747A1-20030918-C00040
    Figure US20030175747A1-20030918-C00041
    Figure US20030175747A1-20030918-C00042
    Figure US20030175747A1-20030918-C00043
    Figure US20030175747A1-20030918-C00044
    Figure US20030175747A1-20030918-C00045
    Figure US20030175747A1-20030918-C00046
    Figure US20030175747A1-20030918-C00047
    Figure US20030175747A1-20030918-C00048
    Figure US20030175747A1-20030918-C00049
    Figure US20030175747A1-20030918-C00050
    Figure US20030175747A1-20030918-C00051
    Figure US20030175747A1-20030918-C00052
    Figure US20030175747A1-20030918-C00053
    Figure US20030175747A1-20030918-C00054
    Figure US20030175747A1-20030918-C00055
    Figure US20030175747A1-20030918-C00056
    Figure US20030175747A1-20030918-C00057
  • A variety of maleimide derivatized e-tags have also been synthesized. These compounds were subsequently bioconjugated to 5′-thiol adorned DNA sequences and subjected to the 5′-nuclease assay. The species formed upon cleavage are depicted in Table 7. [0103]
    TABLE 7
    E-tags derived from maleimide linked precursors.
    1
    Figure US20030175747A1-20030918-C00058
    2
    Figure US20030175747A1-20030918-C00059
    3
    Figure US20030175747A1-20030918-C00060
    4
    Figure US20030175747A1-20030918-C00061
    5
    Figure US20030175747A1-20030918-C00062
    6
    Figure US20030175747A1-20030918-C00063
    7
    Figure US20030175747A1-20030918-C00064
    8
    Figure US20030175747A1-20030918-C00065
    9
    Figure US20030175747A1-20030918-C00066
    10
    Figure US20030175747A1-20030918-C00067
  • As a matter of convenience, predetermined amounts of reagents employed in the present invention can be provided in a kit in packaged combination. A kit can comprise in packaged combination a target-binding region, e.g. oligonucleotide primer for each polynucleotide suspected of being in said set wherein each of said primers is hybridizable to a first sequence of a respective polynucleotide if present, a template dependent polynucleotide polymerase, nucleoside triphosphates, and a set of oligonucleotide snp detection sequences, each of said oligonucleotide probes having a fluorescent label at its 5′-end and having a sequence at its 5′-end that is hybridizable to a respective polynucleotide wherein each of said labels is cleavable from said oligonucleotide probe. Alternatively, the target-binding region may be an antibody for detecting ligands or enzyme substrate for detecting enzymes. [0104]
  • The kit may further comprise a device for conducting capillary electrophoresis. For nucleic acid determinations, the e-tag is releasable by a template dependent polynucleotide polymerase having 5′ to 3′ exonuclease activity. The kit can further include various buffered media, some of which may contain one or more of the above reagents. [0105]
  • The relative amounts of the various reagents in the kits can be varied widely to provide for concentrations of the reagents necessary to achieve the objects of the present invention. Under appropriate circumstances one or more of the reagents in the kit can be provided as a dry powder, usually lyophilized, including excipients, which on dissolution will provide for a reagent solution having the appropriate concentrations for performing a method or assay in accordance with the present invention. Each reagent can be packaged in separate containers or some reagents can be combined in one container where cross-reactivity and shelf life permit. The kits may also include a written description of a method in accordance with the present invention as described above. [0106]
  • In one embodiment of the kit, the e-tags are fluorescent conjugates represented by the formula: [0107]
  • R-L-T
  • wherein R is a fluorescer, L is a mir, as described previously, and T is a functionality for binding to a nucleoside base, purine or pyrimidine, or a nucleoside base, a nucleoside, nucleotide or nucleotide triphosphates, or other member of the target-binding region. [0108]
  • In another embodiment of a kit, the e-tags are fluorescent conjugates represented by the formula: [0109]
  • R′-L′-T′
  • wherein R′ is a fluorescer, L′ is a bond, , a combination of a neutral sub-region and a charged sub-region, an amino acid or a peptide or combinations of amino acids and thioacids or other carboxylic acids and T′ is a nucleotide, nucleotide triphosphates or functionality for binding to a member of the target-binding region. [0110]
  • In another embodiment of a kit, the e-tag is a fluorescent conjugate represented by the formula: [0111]
  • Fluorescer-L″-(amino acid)n
  • wherein L″ with (amino acid)[0112] n is a mir, where L″ isa bond or a linking group of from 1 to 20 atoms in the chain and n is 1 to 100, usually 1 to 20, more usually 1 to 10. The fluorescer may be fluorescein, the amino acid may be lysine and L″ may be a bond in the form of an amide linkage involving the meta-carboxyl of the fluorescein and the terminal amine group of lysine.
  • In another embodiment of a kit in accordance with the invention, the e-tag is a label conjugate represented by the formula: [0113]
  • Fluorescein-(CO)NH—CH(CH2)3CH(NH2)COX
  • wherein X is selected from the group consisting of: OH, NH-lysine, NH-(lysine)[0114] 2, NH-alanine, NH-aspartic acid, NH-(aspartic acid)2, NH-(aspartic acid)3, NH-(aspartic acid)4, NH-(aspartic acid)5, NH-(aspartic acid)6, NH-(aspartic acid)7, NH-alanine-lysine, NH-aspartic acid-lysine, NH-(aspartic acid)2-lysine, NH-(aspartic acid)3-lysine, NH-(aspartic acid)4-lysine, NH-(aspartic acid)5-lysine, NH-(aspartic acid)6-lysine, NH-(aspartic acid)7-lysine, NH-(aspartic acid)8-lysine, NH-(lysine)4, and NH-(lysine)5
  • The kits will usually have at least about 5 different e-tags for conjugation, more usually at least about 10, frequently at least about 25 and may have 50 or more, usually not more than about 1,000. The e-tags will differ as to mobility, including mass/charge ratio and nature of charge, e.g. overall positive or negative, detectable moiety, e.g. fluorophore, electrochemical, etc, or functionality for linking a detectable moiety, e.g. maleimide, mercaptan, aldehyde, ketone, etc. [0115]
  • The e-tags described above may terminate in an appropriate functionality for linking to a nucleotide, nucleotide triphosphate or other molecule of interest or may terminate in such moieties. [0116]
  • The methodologies that may be employed involve heterogeneous and homogeneous techniques, where heterogeneous normally involves a separation step, where unbound label is separated from bound label, where homogeneous assays do not require, but may employ a separation step. One group of assays will involve nucleic acid detection, which includes sequence recognition, snp detection and scoring, transcription analysis, allele determinations, HLA determinations, or other determination associated with variations in sequence. The use of the determination may be forensic, mRNA determinations, mutation determinations, allele determinations, MHC determinations, haplotype determinations, single nucleotide polymorphism determinations, etc. The methodology may include assays dependent on 5′-nuclease activity, as in the use of the polymerase chain reaction or in Invader technology, 3′-nuclease activity, restriction enzymes and ribonuclease H, all of these methods involving catalytic cleavage of a phosphate linkage, where one to two oligonucleotides are bound to the target template. Alternatively, one may use channeling, where first and second agents are bound to first and second oligonucleotides, which bind proximally to the same target nucleic acid template. By having a label generating a mediator active in the cleavage of a bond present in the second agent to which an e-tag is linked, the e-tag will be released only when the two agents are proximally bound to the target template. The mediator may be physical, e.g. electromagnetic radiation or chemical, e.g. singlet oxygen or hydrogen peroxide. By providing for release of the agent to which the e-tag is bonded from the template, one can amplify the number of e-tags for a single target. Alternatively, one may have a plurality of e-tags that are bonded to the agent bound to the target, where binding to the target permits separation from e-tag labeled agent that is unbound. The e-tags bound to the target may then be released providing for a plurality of e-tags for a single target. [0117]
  • Instead of nucleic acid pairing, one may employ specific binding member pairing. There are a large number of specific binding pairs associated with receptors, such as antibodies, poly- and monoclonal, enzymes, surface membrane receptors, lectins, etc., and ligands for the receptors, which may be naturally occurring or synthetic molecules, protein or non-protein, such as drugs, hormones, enzymes, ligands, etc. The specific binding pair has many similarities to the binding of homologous nucleic acids, significant differences being that one normally cannot cycle between the target and the agent and one does not have convenient phosphate bonds to cleave. For heterogeneous assays, the binding of the specific binding pair is employed to separate the bound from the unbound e-tag bonded agents, while with homogeneous assays, the proximity of the specific binding pairs allow for release of the e-tags from the complex. [0118]
  • For an inclusive but not exclusive listing of the various manners in which the subject invention may be used, the following table is provided. [0119]
  • Recognition event leads to generation or modification of e-tags. [0120]
    Recognition Event e-tag Activation Amplification Mode Format
    Binding Assays (solution Phase Multiplexed assays (2-1000)
    e-tag generation followed by leading to release of library of e-
    separation by CE, HPLC or Mass tags. Every e-tag codes for a
    Spectra) unique binding event or assay.
    Hybridization followed by 5′ Nuclease assay PCR, Invader Sequence recognition for example
    enzyme recognition or multiplexed gene expression,
    SNP's scoring etc . . .
    3′ Nuclease assay Multiplexed assays Sequence
    recognition
    Restriction enzymes Multiplexed assays Sequence
    recognition
    Ribonuclease H Multiplexed assays Sequence
    recognition
    Hybridization followed by Singlet Oxygen Single e-tag release per binding event Multiplexed assays Sequence
    channeling recognition
    Hybridization followed by Singlet Oxygen Amplification due to turnover of e- Multiplexed assays Sequence
    channeling tag binding moiety recognition
    Amplification due to release of Multiplexed assays Sequence
    multiple e-tags (10 to 100,000) per recognition
    binding event
    Hydrogen peroxide Amplification due to turnover of e- Multiplexed assays Sequence
    tag binding moiety recognition
    Amplification due to release of Multiplexed assays Sequence
    multiple e-tags (10 to 100,000) per recognition
    binding event
    Light; Energy Transfer Amplification due to turnover Multiplexed assays Sequence
    (Photocleavage) of e-tag binding recognition
    moiety
    Amplification due to release of Multiplexed assays Sequence
    multiple e-tags (10 to 100,000) per recognition
    binding event
    IMMUNO-ASSYS
    Sandwich assays Singlet Oxygen A few (2-10) e-tags release per Proteomics
    Antibody-1 decorated with binding event Multiplexed Immunoassays
    Sensitizer while antibody-2
    Is decorated with singlet oxygen
    cleavable e-tags
    Singlet Oxygen Amplification due to release of Proteomics
    multiple e-tags (10 to 100,000) per Multiplexed Immunoassays
    binding event
    Sandwich assays Hydrogen Peroxide A few (2-10) e-tags release per Proteomics
    Antibody-1 decorated with binding event Multiplexed Immunoassays
    Glucose oxidase while antibody-2
    is decorated with hydrogen
    peroxide cleavable e-tags
    Hydrogen Peroxide Amplification due to release of Proteomics
    multiple e-tags (10 to 100,000) per Multiplexed Immunoassays
    binding event
    Competition assays Singlet Oxygen A few (2-10) e-tags release per
    Antibody-1 decorated with binding event
    Sensitizer while Antigen
    Is decorated with singlet oxygen
    cleavable e-tags
    Singlet Oxygen Amplification due to release of
    multiple e-tags (10 to 100,000) per
    binding event
    Competition assays
    Antibody-1 decorated with
    Glucose oxidase while antigen
    Is decorated with hydrogen
    peroxide cleavable e-tags
    Hydrogen Peroxide A few (2-10) e-tags release per
    binding event
    Hydrogen Peroxide Amplification due to release of
    multiple e-tags (10 to 100,000) per
    binding event
    Binding Assays (Solid Phase e- Multiplexed assays (2-1000)
    tag generation followed by leading to release of library of e-
    separation by CE, HPLC or Mass tags. Every e-tag codes for a
    Spectra) unique binding event or assay.
    Hybridization Light; Enzymes, As an alternative to Branched chain Sequence recognition for example
    Capture of Target on solid Singlet oxygen, Hydrogen assay; Digene's RNA:DNA duplex; for gene expression, SNP's
    Surface. A number of e-tag Peroxide Fluoride, High Sensitivity sequence scoring; Pathogen detection; etc . . .
    labeled probes are hybridized to Reducing agents, Mass identification assay. Can be carried out on Patches in
    the target. Unhybridized e-tag Spectra Others Amplification due to release of Microfluidic channels - - -
    labeled probes are removed. E-tag multiple e-tags (10 to 100,000) per Integrated assay and separation
    is released and separated and binding event3 device
    identified.
    Immunoassays
    Sandwich assays Light; Enzymes, A few (2-10) e-tags release per Proteomics
    Antibody-1 is attached to a solid Singlet oxygen, Hydrogen binding event Multiplexed Immunoassays
    surface while antibody-2 Peroxide Fluoride, Amplification due to release of Can be carried out on Patches in
    is decorated with cleavable e-tags Reducing agents, Mass multiple e-tags (10 to 100,000) per Microfluidic channels - - -
    Spectra Others binding event Integrated assay and separation
    device
    Competition assays Light; Enzymes, A few (2-10) e-tags release per Proteomics
    Antibody-1 is attached to solid Singlet oxygen, Hydrogen binding event Multiplexed Immunoassays
    surface while Antigen Peroxide Fluoride, Amplification due to release of Can be carried out on Patches in
    Is decorated with cleavable e-tags Reducing agents, Mass multiple e-tags (10 to 100,000) per Microfluidic channels - - -
    Spectra Others binding event Integrated assay and separation
    device
  • As indicated in the table, for amplification one may use thermal cycling. The cleavage of the nucleic acid bound to the template results in a change in the melting temperature of the e-tag residue with release of the e-tag. By appropriate choice of the primer and/or protocol, one can retain the primer bound to the template and the e-tag containing sequence can be cleaved and released from the template to be replaced by an c-tag containing probe. [0121]
  • In determinations involving nucleic acids, since snp detection is, for the most part, the most stringent in its requirements, most of the description will be directed toward the multiplexed detection of snps. For other nucleic acid analyses, frequently the protocols will be substantially the same, although in some instances somewhat different protocols will be employed for snps, because of the greater demands snps make on fidelity. For proteins, the protocols will be substantially different and will be described independently of the snp protocols. [0122]
  • As exemplary of the subject invention, four target polynucleotides T1, T2, T3 and T4 are employed. Oligonucleotide primers PR1, PR2, PR3 and PR4 are employed, each respectively capable of hybridizing to a sequence in the respective target polynucleotides. Also employed are four oligonucleotide snp detection sequences, PB1, PB2, PB3 and PB4. Each of the snp detection sequences comprises a fluorescent label F1, F2, F3 and F4, respectively. In this example, there is a mismatch between PB2 and T2, which comprises a single nucleotide polymorphism. The reaction medium comprising the above reagents and nucleoside triphosphates and a template dependent polynucleotide polymerase having 5′ to 3[0123] 40 exonuclease activity is treated under amplification conditions. Primers PR1, PR2, PR3 and PR4 hybridize to their respective target polynucleotides and are extended to yield extended primers EPR1, EPR2, EPR3 and EPR4. snp detection sequences PB1, PB3 and PB4, which hybridize with their respective target polynucleotides, are acted upon by the exonuclease to cleave a single nucleotide bearing the respective fluorescent label. PB2, which does not bind to the target polynucleotide, is not cleaved. Cleaved fragments F1, F3 and F4 are injected into a separation channel in a chip for conducting electroseparation. The labels are identified by their specific mobility and fluorescence upon irradiation. The separated labels are related to the presence and amount of the respective target polynucleotide.
  • One, usually a plurality, of snp's, is simultaneously determined by combining target DNA with one or a plurality, respectively, of reagent pairs under conditions of primer extension. Each pair of reagents includes a primer which binds to target DNA and a snp detection sequence, normally labeled, which binds to the site of the snp and has an e-tag, usually at its 5′-end and the base complementary to the snp, usually at other than a terminus of the snp detection sequence. The conditions of primer extension employ a polymerase having 5′-3′ exonuclease activity, dNTP's and auxiliary reagents to permit efficient primer extension. The primer extension is performed, whereby detector sequences bound to the target DNA are degraded with release of the e-tag. By having each snp associated with its own e-tag, one can determine the snp's, which are present in the target DNA for which pairs of reagents have been provided. [0124]
  • The pairs of reagents are DNA sequences, which are related to a snp site. The primer binds to the target DNA upstream from the snp site in the direction of extension. The labeled detector sequence binds downstream from the primer in the direction of extension and binds to a sequence, which includes the snp. The primer sequence will usually be at least about 12 bases long, more usually at least 18 bases long and usually fewer than 100 bases, and more usually fewer than 60 bases. The primer will be chosen to bind substantially uniquely to a target sequence under the conditions of primer extension, so that the sequence will normally be one that is conserved or the primer is long enough to bind in the presence of a few mismatches, usually fewer than about 10 number % mismatches. By knowing the sequence, which is upstream from the snp of interest, one may select a sequence, which has a high G-C ratio, so as to have a high binding affinity for the target sequence. In addition, the primer should bind reasonably close to the snp, usually not more than about 200 bases away, more usually not more than about 100 bases away, and preferably within about 50 bases. Since the farther away the primer is from the snp, the greater amount of dNTP's, which will be expended, there will usually be no advantage in having a significant distance between the primer and the snp detection sequence. Generally, the primer will be at least about 5 bases away from the snp. [0125]
  • The number of reagent pairs may be varied widely, from a single pair to two or more pairs, usually at least about 5 pairs, more usually at least about 9 pairs and may be 20 pairs or more. By virtue of the use of different e-tags, which have different mobilities and are readily resolvable under conventional capillary electrophoretic conditions, the subject pairs may be used to perform multiplexed operations in a single vessel, where a family of snps may be identified. Usually, the total number of different reagent pairs or different target sequences in a single determination will be under 200, more usually under 100 and in many cases will not exceed 50 [0126]
  • In one snp determination protocol, the primer includes the complementary base of the snp. This protocol is referred to as “Invader” technology and is described in U.S. Pat. No. 6,001,567. The protocol involves providing: (a) (i) a cleavage means, which is normally an enzyme, referred to as a cleavase, that recognizes a triplex consisting of the target sequence, a primer which binds to the target sequence and terminates at the snp position and a labeled probe that binds immediately adjacent to the primer and is displaced from the target at the snp position, when a snp is present; the cleavase clips the labeled probe at the site of displacement, releasing the label; ii) a source of target nucleic acid, the target nucleic acid having a first region, a second region and a third region, wherein the first region is downstream from the second region and the second region is contiguous to and downstream from the third region; and (iii) first and second oligonucleotides having 3′ and 5′ portions, wherein the 3′ portion of the first oligonucleotide contains a sequence complementary to the third region of the target nucleic acid and the 5′ portion of the first oligonucleotide and the 3′ portion of the second oligonucleotide each contain sequences usually fully complementary to the second region of the target nucleic acid, and the 5′ portion of the second oligonucleotide contains sequence complementary to the first region of said target nucleic acid; (b) mixing, in any order, the cleavage means, the target nucleic acid, and the first and second oligonucleotides under hybridization conditions that at least the 3′ portion of the first oligonucleotide is annealed to the target nucleic acid and at least the 5′ portion of the second oligonucleotide is annealed to any target nucleic acid to from a cleavage structure, where the combined melting temperature of the complementary regions within the 5′ and 3′ portions of the first oligonucleotide when annealed to the target nucleic acid is greater than the melting temperature of the 3′ portion of the first oligonucleotide and cleavage of the cleavage structure occurs to generate labeled products; and (c) detecting the labeled cleavage products. [0127]
  • Thus, in an Invader assay attachment of an e-tag to the 5′ end of the detector sequence results in the formation of e-tag labeled nucleotide when target sequence is present. The e-tag labeled nucleotide is separated and detected. By having a different e-tag for each nucleic acid sequence of interest, having a different electrophoretic mobility, which may require further treatment depending on the total number of snp's or target sequences to be detected, one can readily determine the snp's or measure multiple sequences, which are present in a sample. [0128]
  • In another snp detection protocol, an alternative method of cleavage is used and various detectable tags may be employed, the most common using a fluorescent label. The difference in protocol between a fluorescent label and another type of label, such as an electrochemical label, is the method of detection. Otherwise, the protocols will be substantially the same. The tagged snp detection sequence will be chosen to bind to the target sequence comprising the snp. The length of the snp detector sequence is in part related to the length and binding affinity of the primer. The two sequences act together to ensure that the pair of reagents bind to the proper target sequence. The greater the fidelity of binding of one member of the pair, the less fidelity that is required for the other member of the pair. Since the observed signal will be dependent upon both members of the pair being present, each member serves as a check on the other member for production of the signal. However, since except for the cost, it is relatively easy to make reasonably long oligonucleotides, usually both members of the pair will provide for unique binding to their respective target sequences. Therefore, the length of the snp detector sequence will come within the parameters indicated for the primer, but the total number of bases for the two pair members will usually be at least 36, more usually at least about 40. [0129]
  • Each snp detection sequence will have at least one nucleotide modified with an e-tag, which is labeled, which is fluorescent or can be subsequently made fluorescent, or can be detected electrochemically or by other convenient detection methodologies. Usually, the modified nucleotide will be at the 5′-end of the sequence, but the modified nucleotide may be anywhere in the sequence, particularly where there is a single nuclease susceptible linkage in the detection sequence. Since the determination is based on the at least partial degradation of the snp detector sequence, having the modified nucleotide at the end ensures that if degradation occurs, the e-tag will be released. Since nucleases may clip at other than the terminal phosphate link, it is desirable to prevent cleavage at other than the terminal phosphate link. In this way one avoids the confusion of having the same e-tag joined to different numbers of nucleotides after cleavage. Cleavage at the terminal phosphate can be relatively assured by using a linker at the penultimate nucleoside, which is not cleaved by the nuclease, more particularly having only the ultimate linkage susceptible to hydrolysis by a nuclease. For example, one may use a thiophosphate, phosphinate, phosphoramidate, or a linker other than a phosphorous acid derivative, such as an amide, boronate, or the like. The particular hydrolase resistive linker will be primarily one of synthetic convenience, so long as degradation of the binding affinity is not sacrificed. If desired all of the linkers other than the ultimate linker may be resistant to nuclease hydrolysis. [0130]
  • If desired, the snp detection sequence may have a combination of a quencher and a fluorescer. In this instance the fluorescer would be in proximity to the nucleoside to which the linker is bonded, as well as the quencher, so that in the primer extension mixture, fluorescence from fluorescer bound to the snp detection sequence would be quenched. As the reaction proceeds and fluorescer is released from the snp detection sequence and, therefore, removed from the quencher, it would then be capable of fluorescence. By monitoring the primer extension mixture for fluorescence, one would be able to determine when there would probably be a sufficient amount of individual e-tags to provide a detectable signal for analysis. In this way, one could save time and reagent by terminating the primer extension reaction at the appropriate time. There are many quenchers that are not fluorescers, so as to minimize fluorescent background from the snp detection sequence. Alternatively, one could take small aliquots and monitor the reaction for observable e-tags. [0131]
  • The snp detection sequence may be further modified to improve separation and detection of the e-tags. By virtue of the difference in mobility of the e-tags, the snp detection sequences will also have different mobilities. Furthermore, these molecules will be present in much larger amounts than the released e-tags, so that they may obscure detection of the released e-tags. Also, it is desirable to have negatively charged snp detection sequence molecules, since they provide for higher enzymatic activity and decrease capillary wall interaction. Therefore, by providing that the intact snp detection sequence molecule can be modified with a positively charged moiety, but not the released e-tag, one can change the electrostatic nature of the snp detection sequence molecules during the separation. By providing for a ligand on the snp detection sequence molecule to which a positively charged molecule can bind, one need only add the positively charged molecule to change the electrostatic nature of the snp detection sequence molecule. Conveniently, one will usually have a ligand of under about 1 kDal. This may be exemplified by the use of biotin as the ligand and avidin, which is highly positively charged, as the receptor/positively charged molecule. Instead of biotin/avidin, one may have other pairs, where the receptor, e.g. antibody, is naturally positively charged or is made so by conjugation with one or more positively charged entities, such as arginine, lysine or histidine, ammonium, etc. The presence of the positively charged moiety has many advantages in substantially removing the snp detection sequence molecules from the electropherogram. In carrying out the process, the positively charged moiety is added at or after the completion of the digestion. [0132]
  • If desired, the receptor may be used to physically sequester the molecules to which it binds, removing entirely intact e-tags containing the target-binding region or modified target-binding regions retaining the ligand. These modified target-binding regions may be as a result of degradation of the starting material, contaminants during the preparation, aberrant cleavage, etc. or other nonspecific degradation products of the target binding sequence. As above, a ligand, exemplified by biotin, is attached to the target-binding region, e.g. the penultimate nucleoside, so as to be separated from the e-tag upon cleavage. After the 5′ nuclease assay, a receptor for the ligand, for biotin exemplified by strept/avidin (hereafter “avidin”) is added to the assay mixture. Other receptors include natural or synthetic receptors, such as immunoglobulins, lectins, enzymes, etc. Desirably, the receptor is positively charged, naturally as in the case of avidin, or is made so, by the addition of a positively charged moiety or moieties, such as ammonium groups, basic amino acids, etc. Avidin binds to the biotin attached to the detection probe and its degradation products. Avidin is positively charged, while the cleaved e-tag is negatively charged. Thus the separation of the cleaved e-tag from, not only uncleaved probe, but also its degradation products, is easily achieved by using conventional separation methods. Alternatively, the receptor may be bound to a solid support or high molecular weight macromolecule, such as a vessel wall, particles, e.g. magnetic particles, cellulose, agarose, etc., and separated by physical separation or centrifugation, dialysis, etc. This method further enhances the specificity of the assay and allows for a higher degree of multiplexing. [0133]
  • While the ligand may be present at a position other than the penultimate position and one may make the ultimate linkage nuclease resistant, so that cleavage is directed to the penultimate linkage, this will not be as efficient as having cleavage at the ultimate linkage. The efficiency would be even worse where the ligand is at a more distant nucleotide from the e-tag. Therefore, while such protocols are feasible, and may be used, they will not be preferred. [0134]
  • As a general matter, one may have two ligands, if the nature of the target-binding region permits. As described above, one ligand can be used for sequestering e-tags bound to target-binding region retaining the first ligand from products lacking the first ligand. Isolation and concentration of the e-tags bound to a modified target-binding region lacking the first ligand would then be performed. In using the two ligands, one would first combine the reaction mixture with a first receptor for the first ligand for removing target-binding region retaining the first ligand. One could either separate the first receptor from the composition or the first receptor would be retained in the composition, as described. This would be followed by combining the resulting composition, where the target-binding region containing the first ligand is bound to the first receptor, with the second receptor, which would serve to isolate or enrich for modified target-binding region lacking the first ligand, but retaining the second ligand. The second ligand could be the detectable label; a small molecule for which a receptor is available, e.g. a hapten, or a portion of the e-tag could serve as the second ligand. After the product is isolated or enriched, the e-tag could be released by denaturation of the receptor, displacement of the product, high salt concentrations and/or organic solvents, etc. [0135]
  • For e-tags associated with nucleic acids sequences, improvements include employing a blocking linkage between nucleotides in the sequence, particularly at least one of the links between the second to fourth nucleotides to inhibit cleavage at this or subsequent sites, and using control sequences for quantitation. Further improvements in the e-tags provide for having a positively multicharged moiety joined to the e-tag probe during separation. [0136]
  • The above three methods are generally applicable not only to generating a single e-tag per sequence detected but also to generation of a single oligonucleotide fragment for fragment separation and identification by electrophoresis or by mass spectra as it is essential to get one fragment per sequence detected. For purpose of explanation, these methods are illustrated below. [0137]
    Figure US20030175747A1-20030918-C00068
    Figure US20030175747A1-20030918-C00069
    Figure US20030175747A1-20030918-C00070
    Figure US20030175747A1-20030918-C00071
  • The complementary base to the snp may be anywhere in the detector sequence, desirably at other than the terminal nucleoside to enhance the fidelity of binding. The snp detector sequence will be designed to include adjacent nucleotides, which provide the desired affinity for the hybridization conditions. The snp detection sequence may be synthesized by any convenient means, such as described in Matthews, et al., Anal Biochem. (1988) 169:1 - 25; Keller, et al., “DNA Probes,” 2[0138] nd edition (1993) Stockton Press, New York, N.Y.; and Wetmur, Critical Reviews in Biochemistry and Molecular Biology (1991) 26:227-259.
  • The extension reaction is performed by bringing together the necessary combination of reagents and subjecting the mixture to conditions for carrying out the desired primer extension. Such conditions depend on the nature of the extension, e.g., PCR, single primer amplification, LCR, NASBA, 3SR and so forth, where the enzyme which is used for the extension has 5′-3′ nuclease activity. The extension reaction may be carried out as to both strands or as to only a single strand. Where pairs of primer and snp detection sequence are used for both strands, conveniently, the e-tag will be the same, but the bases will be different. In this situation, one may wish to have a cleavable linkage to the base, so that for the same snp, one would obtain the same e-tag. Alternatively, if the number of snps to be determined is not too high, one could use different e-tags for each of the strands. Usually, the reaction will be carried out by using amplifying conditions, so as to provide an amplified signal for each snp. Amplification conditions normally employ thermial cycling, where after the primer extension and release of e-tags associated with snps which are present, the mixture is heated to denature the double-stranded DNA, cooled, where the primer and snp detection sequence can rehybridize and the extension repeated. [0139]
  • Depending on the protocol, the e-tags or e-tag, will be separated from a portion or substantially all of the detection sequence, usually retaining not more than about 3 nucleotides, more usually not more than about 2 nucleotides and preferably from 0 to 1 nucleotide. By having a cleavable linker between the e-tag and the detection sequence, the e-tag may be freed of all the nucleotides. By having a nuclease resistant penultimate link, a single nucleotide may be bonded to the e-tag. [0140]
  • Reagents for conducting the primer extension are substantially the same reaction materials for carrying out an amplification, such as an amplification indicated above. The nature and amounts of these reagents are dependent on the type of amplification conducted. In addition to oligonucleotide primers the reagents also comprise nucleoside triphosphates and a nucleotide polymerase having 5′-3′ nuclease activity. [0141]
  • The nucleoside triphosphates employed as reagents in an amplification reaction include deoxyribonucleoside triphosphates such as the four common deoxyribonucleoside triphosphates dATP, dCTP, dGTP and dTTP. The term “nucleoside triphosphates” also includes derivatives and analogs thereof, which are exemplified by those derivatives that are recognized and polymerized in a similar manner to the underivatized nucleoside triphosphates. [0142]
  • The nucleotide polymerase employed is a catalyst, usually an enzyme, for forming an extension of an oligonucleotide primer along a polynucleotide such as a DNA template, where the extension is complementary thereto. The nucleotide polymerase is a template dependent polynucleotide polymerase and utilizes nucleoside triphosphates as building blocks for extending the 3′-end of a polynucleotide to provide a sequence complementary with the polynucleotide template. Usually, the catalysts are enzymes, such as DNA polymerases, for example, prokaryotic DNA polymerase (I, II, or III), T4 DNA polymerase, T7 DNA polymerase, Vent DNA polymerase, Pfu DNA polymerase, Taq DNA polymerase, and the like. Polymerase enzymes may be derived from any source, such as eukaryotic or prokaryotic cells, bacteria such as [0143] E. coli, plants, animals, virus, thermophilic bacteria, genetically modified enzymes, and so forth.
  • The conditions for the various amplification procedures are well known to those skilled in the art. In a number of amplification procedures, thermal cycling conditions as discussed above are employed to amplify the polynucleotides. The combination of reagents is subjected to conditions under which the oligonucleotide primer hybridizes to the priming sequence of, and is extended along, the corresponding polynucleotide. The exact temperatures can be varied depending on the salt concentration, pH, solvents used, length of and composition of the target polynucleotide sequence and the oligonucleotide primers. [0144]
  • Thermal cycling conditions are employed for conducting an amplification involving temperature or thermal cycling and primer extension, such as in PCR or single primer amplification, and the like. The pH and the temperature are selected so as to cause, either simultaneously or sequentially, dissociation of any internally hybridized sequences, hybridization or annealing of the oligonucleotide primer and the snp detection sequence with the target polynucleotide sequence, extension of the primer, release of the e-tag from snp detection sequence bound to the target polynucleotide sequence and dissociation of the extended primer. This usually involves cycling the reaction medium between two or more temperatures. In conducting such a method, the medium is cycled between two to three temperatures. The temperatures for thermal cycling generally range from about 50° C. to 100° C., more usually, from about 60° C. to 95° C. Relatively low temperatures of from about 30° C. to about 65° C. can be employed for the extension steps, while denaturation and hybridization can be carried out at a temperature of from about 50° C. to about 105° C. The reaction medium is initially at about 20° C. to about 45° C., preferably, about 25° C. to about 35° C. Relatively low temperatures of from about 50° C. to about 80° C., preferably, 50° C. to about 60° C., are employed for the hybridization or annealing steps, while denaturation is carried out at a temperature of from about 80° C. to about 100° C., preferably, 90° C. to about 95° C., and extension is carried out at a temperature of from about 70° C. to about 80° C., usually about 72° C. to about 74° C. The duration of each cycle may vary and is usually about 1 to 120 seconds, preferably, about 5 to 60 seconds for the denaturation steps, and usually about 1 to 15 seconds, preferably, about 1 to 5 seconds, for the extension steps. It is to be understood that the actual temperature and duration of the cycles employed are dependent on the particular amplification conducted and are well within the knowledge of those skilled in the art. [0145]
  • Generally, an aqueous medium is employed. Other polar cosolvents may also be employed, usually oxygenated organic solvents of from 1-6, more usually from 1-4, carbon atoms, including alcohols, ethers, formamide and the like. Usually, these cosolvents, if used, are present in less than about 70 weight percent, more usually in less than about 30 weight percent. [0146]
  • The pH for the medium is usually in the range of about 4.5 to 9.5, more usually in the range of about 5.5 to 8.5, and preferably in the range of about 6 to 8. Various buffers may be used to achieve the desired pH and maintain the pH during the determination. Illustrative buffers include borate, phosphate, carbonate, Tris, barbital and the like. The particular buffer employed is not critical to this invention but in individual methods one buffer may be preferred over another. The medium may also contain materials required for enzyme activity such as a divalent metal ion (usually magnesium). [0147]
  • The selection of the snp detection sequence will affect the stringency employed during the primer extension, particularly at the stage of hybridization. Since in a substantial number of samples, the DNA will be heterozygous for snps, rather than homozygous, one does not wish to have false positives, where the snp detection sequence may bond to the sequence comprising the prevalent nucleotide, as well as the sequence comprising the snp. Where the DNA sample is homozygous for the prevalent sequence, it is also important that the snp detection sequence does not bind to give a false positive. Therefore, the difference in T[0148] m between the snp containing sequence and the wild-type sequence will usually be at least about 3° C., more usually at least about 5° C., under the conditions of the primer extension.
  • Various ancillary materials will frequently be employed in the methods in accordance with the present invention. For example, in addition to buffers and salts, the medium may also comprise stabilizers for the medium and the reaction components. Frequently, the medium may also include proteins such as albumins, quaternary ammonium salts, polycations such as spermine, surfactants, particularly non-ionic surfactants, binding enhancers, e.g., polyalkylene glycols, or the like. [0149]
  • The reaction is conducted for a time sufficient to produce the desired number of copies of each of the polynucleotides suspected of being present as discussed below. Generally, the time period for conducting the entire method will be from about 10 to 200 minutes. As mentioned above, it is usually desirable to minimize the time period. [0150]
  • The concentration of the nucleotide polymerase is usually determined empirically. Preferably, a concentration is used that is sufficient such that the amplification is robust. The primary limiting factor generally is the cost of the reagent. Such enzymes include Pfu DNA polymerase (native and recombinant) from Stratagene, La Jolla, Calif., Ultma DNA polymerase from Perkin Elmer, Foster City, Calif., rBst DNA polymerase from Epicentre Technologies, Madison, Wis., VENT DNA polymerase from New England Biolabs, Beverly, Mass., Tli DNA polymerase from Promega Corp., Madison, Wis., and Pwo DNA polymerase from Boehringer Mannheim, Indianapolis; Ind., and the like. [0151]
  • The initial concentration of each of the polynucleotides containing the respective target snps can be as low as about 50 pg/ml in a sample. After amplification the concentration of each polynucleotide should be at least about 10 picomolar, generally in the range of about 10 pM to about 10 nM, usually from about 10 to 10[0152] 10, more usually from about 103 to 108 molecules in a sample preferably at least 10−21M in the sample and may be 10−10 to 10−19M, more usually 10−14 to 10−19M. In general, the reagents for the reaction are provided in amounts to achieve extension of the oligonucleotide primers.
  • The concentration of the oligonucleotide primer(s) will be about 1 to about 20 μM and is usually about 1 to about 10 μM, preferably, about 1 to about 4 μM, for a sample size that is about 10 fM. Preferably, the concentration of the oligonucleotide primer(s) is substantially in excess over, preferably at least about 10[0153] 7 to about 1010 times greater than, more preferably, at least about 109 times greater than, the concentration of the corresponding target polynucleotides.
  • The amount of the oligonucleotide probes will be 10 to about 500 nM and is usually about 50 to about 200 nM for a sample size that is about 10 fM (10 fg/μl). Preferably, the concentration of the oligonucleotide probes is substantially in excess over, preferably at least about 10[0154] 7 times greater than, more preferably, at least about 108 times greater than, the concentration of each of the target polynucleotides.
  • The concentration of the nucleoside triphosphates in the medium can vary widely; preferably, these reagents are present in an excess amount. The nucleoside triphosphates are usually present in about 100 M to about 1 mM, preferably, about 20 to about 400 M [0155]
  • The order of combining of the various reagents to form the combination may vary. Usually, the sample containing the polynucleotides is combined with a pre-prepared combination of nucleoside triphosphates and nucleotide polymerase. The oligonucleotide primers and the snp detection sequences may be included in the prepared combination or may be added subsequently. However, simultaneous addition of all of the above, as well as other step-wise or sequential orders of addition, may be employed provided that all of the reagents described above are combined prior to the start of the reactions. The oligonucleotide pairs may be added to the combination of the reagents at or prior to the initiation of the primer extension reaction and may be replenished from tine-to-time during the primer extension reaction. [0156]
  • For quantitation, one may choose to use controls, which provide a signal in relation to the amount of the target that is present or is introduced. Where one is dealing with a mixture of nucleic acid molecules, as in the case of mRNA in a lysate, one may use the known amounts of one or more different mRNAs in the particular cell types as the standards. Desirably, one would have at least two controls, preferably at least 3 controls, where the variation in number between any two controls is at least about 10[0157] 2, and the total range is at least about 103, usually at least about 104. However, determining the consistent ratio of mRNAs occurring naturally will result in a large margin of error, so that one would usually rely on synthetic targets. Where a control system is added for quantitation, as compared to relying on the presence of a known amount of a plurality of endogenous nucleic acids, the control system will comprise at least two control sequences, usually at least 3 control sequences and generally not more than about 6 control sequences, where the upper limit is primarily one of convenience and economy, since additional control sequences will usually not add significant additional precision. which will usually be at least about 50 nucleotides, more usually at least about 10 nucleotides. The control sequences will have a common primer sequence and different control detection sequences, which are intended to parallel the primer sequence and snp detection sequence in size, spacing and response to the primer extension conditions. In carrying out the primer extension reaction with sample nucleic acid, one would then add different number of molecules of the different control sequences, so that one could graph the result to give a signal/number relationship. This graph could then be used to relate signals observed with target molecules to the number of molecules present.
  • After completion of the primer extension reaction, either by monitoring the change in fluorescence as described above or taking aliquots and assaying for total free e-tags, the mixture may now be analyzed. Depending on the instrument, today from one to four different fluorescers activated by the same light source and emitting at different detectable labels may be used. With improvements, five or more different fluorescers will be available, where an additional light source may be required. Electrochemical detection is described in U.S. Pat. No. 6,045,676. [0158]
  • The subject assays are predicated on having a reagent that has a high affinity for a reciprocal binding member, the analyte. Usually, the binding affinity will be at least about 10[0159] −7M−1, more usually, at least about 10−8M−1. For the most part, the reagents will be receptors, which includes antibodies, IgA, IgD, IgG, IgE and IgM and subtypes thereof, enzymes, lectins, nucleic acids, nucleic acid binding proteins, or any other molecule that provides the desired specificity for the analyte in the assay, one of the members normally being a protein. The antibodies may be polyclonal or monoclonal or mixtures of monoclonal antibodies depending on the nature of the target composition and the targets. The targets or analytes may be any molecule, such as small organic molecules of from about 100 to 2500 Dal, poly(amino acids) including peptides of from about 3 to 100 amino acids and proteins of from about 100 to 50,000 or more amino acids, saccharides, lipids, nucleic acids, etc., where the analytes may be part of a larger assemblage, such as a cell, microsome, organelle, virus, protein complex, chromosome or fragment thereof, nucleosome, etc.
  • In addition, the subject heterogeneous assays require that the unbound labeled reagent be separable from the bound labeled reagent. This can be achieved in a variety of ways. Each way requires that a reagent that distinguishes between the complex of labeled reagent and target be bound to a solid support. The solid support may be a vessel wall, e.g. microtiter well plate well, capillary, plate, slide, beads, including magnetic beads, liposomes, or the like. The primary characteristics of the solid support is that it permits segregation of the bound labeled specific binding member from unbound and does not interfere with the formation of the binding complex, nor the other operations of the determination. [0160]
  • The solid support may have the complex directly bound to the support or indirectly bound. For directly bound, one may have the binding member covalently or non-covalently bound to the support. For proteins, many surfaces provide non-diffusible binding of a protein to the support, so that one adds the protein to the support and allows the protein to bind, washes away weakly bound protein and then adds an innocuous protein to coat any actively binding areas that are still available. The surface may be activated with various functionalities that will form covalent bonds with a binding member. These groups may include imino halides, activated carboxyl groups, e.g. mixed anhydrides or acyl halides, amino groups, α-halo or pseudohaloketones, etc. The specific binding member bound to the surface of the support may be any molecule which permits the binding portion of the molecule, e.g. epitope, to be available for binding by the reciprocal member. Where the binding member is polyepitopic, e.g. proteins, this is usually less of a problem, since the protein will be polyepitopic and even with random binding of the protein to the surface, the desired epitope will be available for most of the bound molecules. For smaller molecules, particularly under 5 kDal, one will usually have an active functionality on the specific binding member that preserves the binding site, where the active functionality reacts with a functionality on the surface of the support. The same functionalities described above may find use. Conveniently, one may use the same site for preparing the conjugate immunogen to produce antibodies, as the site for the active functionality for linking to the surface. [0161]
  • The assays may be performed in a competitive mode or a sandwich mode. In the competitive mode, one has the target competing with a labeled binding member for the reciprocal member, which reciprocal member is bound to the support, either during the complex formation or after, e.g. where antibody is a specific binding member and anti(Ig[0162] H) is bound to the support. In this mode, the binding sites of the reciprocal binding member become at least partially filled by the target, reducing the number of available binding sites for the labeled reciprocal binding member. Thus, the number of labeled binding members that bind to the reciprocal binding member will be in direct proportion to the number of target molecules present. In the sandwich mode, the target is able to bind at the same time to different binding members; a first support bound member and a second member which binds at a site of the target molecule different from the site at which the support bound member binds. The resulting complex has three components, where the target serves to link the labeled binding member to the support.
  • In carrying out the assays, the components are combined, usually with the target composition added first and then the labeled members in the competitive mode and in any order in the sandwich mode. Usually, the labeled member in the competitive mode will be equal to at least 50% of the highest number of target molecules anticipated, preferably at least equal and may be in 2-10 fold excess or greater. The particular ratio of target molecules to labeled molecules will depend on the binding affinities, the length of time the mixture is incubated, the off rates for the target molecule with its reciprocal binding member, the size of the sample and the like. In the case of the sandwich assays, one will have at least an equal amount of the labeled binding member to the highest expected amount of the target molecules, usually at least 1.5 fold excess, more usually at least 2 fold excess and may have 10 fold excess or more. The components are combined under binding conditions, usually in an aqueous medium, generally at a pH in the range of 5-10, with buffer at a concentration in the range of about 10 to 200 mM. These conditions are conventional, where conventional buffers may be used, such as phosphate, carbonate, HEPES, MOPS, Tris, borate, etc., as well as other conventional additives, such as salts, stabilizers, organic solvents, etc. [0163]
  • Usually, the unbound labeled binding member will be removed by washing the bound labeled binding member. Where particles or beads are employed, these may be separated from the supernatant before washing, by filtration, centrifugation, magnetic separation, etc. After washing, the support may be combined with a liquid into which the e-tags are to be released and/or the functionality of the e-tags is reacted with the detectable label, followed by or preceded by release. Depending on the nature of the cleavable bond and the method of cleavage, the liquid may include reagents for the cleavage. Where reagents for cleavage are not required, the liquid is conveniently an electrophoretic buffer. For example, where the cleavable linkage is photo labile, the support may be irradiated with light of appropriate wavelength to release the e-tags. Where detectable labels are not present on the e-tags, the e-tags may be reacted with the detectable labels. In some instances the detectable label may be part of the reagent cleaving the cleavable bond, e.g. a disulfide with a thiol. Where there is a plurality of different functionalities on different binding members for reaction with the label, the different labels will have functionalities that react with one of the functionalities. The different labels may be added together or individually in a sequential manner. For example, where the functionalities involve thiols, carboxyl groups, aldehydes and olefins, the labels could have activated olefins, alcohols, amines and thiol groups, respectively. By having removable protective groups for one or more of the functionalities, the protective groups may be removed stepwise and the labels added stepwise. In this way cross-reactivity may be avoided. Whether one has the detectable label present initially or one adds the detectable label is not critical to this invention and will frequently be governed by the nature of the target composition, the nature of the labeled binding members, and the nature of the detectable labels. For the most part, it will be a matter of convenience as to the particular method one chooses for providing the detectable labeled e-tag. [0164]
  • Where a reagent is necessary for cleavage, the e-tags may be required to be separated from the reagent solution, where the reagent interferes with the electrophoretic analysis. Depending on the nature of the e-tags and the reagent, one may sequester the e-tags from the reagent by using ion exchange columns, liquid chromatography, an initial electrophoretic separation, and the like. Alternatively, as discussed previously, one may have a ligand bound to the e-tag or retained portion of the target-binding region for isolating the e-tag, so as to remove any interferents in the mixture. Once the solution of e-tags is prepared and free of any interfering components, the solution may be analyzed electrophoretically. The analysis may employ capillary electrophoresis devices, microfluidic devices or other devices that can separate a plurality of compounds electrophoretically, providing resolved bands of the individual e-tags. [0165]
  • The protocols for the subject homogeneous assays will follow the procedures for the analogous assays, which may or may not include a releasable tag. These protocols employ a signal producing system that includes the label on one of the binding members, the cleavable bond associated with the e-tag, electromagnetic radiation or other reagents involved in the reaction or for diminishing background signal. In assays involving the production of hydrogen peroxide, one may wish to have a molecule in solution that degrades hydrogen peroxide to prevent reaction between hydrogen peroxide produced by a label bound to an analyte molecule and an e-tag labeled binding member that is not bound to the same analyte molecule. [0166]
  • Generally, the concentrations of the various agents involved with the signal producing system will vary with the concentration range of the individual analytes in the samples to be analyzed, generally being in the range of about 10 nM to 10 mM. Buffers will ordinarily be employed at a concentration in the range of about 10 to 200 mM. The concentration of each analyte will generally be in the range of about 1 pM to about 100 μM, more usually in the range of about 100 pM to 10 μM. Although in specific situations the concentrations may be higher or lower, depending on the nature of the analyte, the affinity of the reciprocal binding members, the efficiency of release of the e-tags, the sensitivity with which the e-tags are detected, and the number of analytes, as well as other considerations. [0167]
  • The reactive species that is produced in the assay, analogous to the subject assay, is employed in a different way than was used in the analogous assay, but otherwise the conditions will be comparable. In many instances, the chemiluminescent compound when activated will result in cleavage of a bond, so that one may obtain release of the e-tag. Assays that find use are described in U.S. Pat. Nos. 4,233,402; 5,616,719; 5,807,675; and 6,002,000. One would combine the analyte with one or both reagents. The particular order of addition will vary with the nature of the reagents. Generally, one would prefer to combine the binding reagents and the sample and allow the mixture to incubate, generally at least about 5 min, more usually at least about 15 min, before irradiating the mixture or adding the remaining reagents. [0168]
  • One may also use the subject libraries to analyze the effect of an agent on a plurality of different compounds. For example, one may prepare a plurality of substrates labeled with an e-tag, where the enzyme catalyzes a reaction resulting in a change in mobility between the product and the starting material. These assays can find use in determining affinity groups or preferred substrates for hydrolases, oxidoreductases, lyases, etc. For example, with kinases and phosphatases, one adds or removes a charged group, so as to change the mobility of the product. By preparing a plurality of alcohols or phosphate esters, one can determine which of the compounds serves as a substrate. By labeling the substrates with e-tags, one can observe the shift from the substrate to the product as evidence of the activity of a candidate substrate with the enzyme. By preparing compounds as suicide inhibitors, the enzymes may be sequestered and the e-tags released to define those compounds that may serve as suicide inhibitors and, therefore, preferentially bind to the active site of the enzyme. [0169]
  • One may also use the subject methods for screening for the activity of one or more candidate compounds, particularly drugs, for their activity against a battery of enzymes. In this situation, one would use active substrates for each of the enzymes to be evaluated, where each of the substrates would have its own e-tag. For those enzymes for which the drug is an inhibitor, the amount of product would be diminished in relation to the amount of product in the absence of the candidate compound. In each case the product would have a different mobility from the substrate, so that the substrates and products could be readily distinguished by electrophoresis. By appropriate choice of substrates and detectable labels, one would obtain electropherograms showing the effect of the candidate compound on the activity of the different enzymes. [0170]
  • In those instances where a fluorescent label is not present on the e-tag bound to the product comprising the mir, the mixture may be added to functionalized fluorescent tags to label the e-tag with a fluorescer. For example, where a thiol group is present, the fluorescer could have an activated ethylene, such as maleic acid to form the thioether. For hydroxyl groups, one could use activated halogen or pseudohalogen for forming an ether, such as an α-haloketone. For carboxyl groups, carbodiimide and appropriate amines or alcohols would form amides and esters, respectively. For an amine, one could use activated carboxylic acids, aldehydes under reducing condtions, activated halogen or pseudohalogen, etc. When synthesizing oligopeptides, protective groups are used. These could be retained while the fluorescent moiety is attached to an available functionality on the oligopeptide. [0171]
  • The presence of each of the released or intact e-tags is determined by the label. The separation of the mixture of labeled e-tags is carried out by electroseparation, which involves the separation of components in a liquid by application of an electric field, preferably, by electrokinesis (electrokinetic flow), electrophoretic flow, electroosmotic flow or combination thereof, with the separation of the e-tag mixture into individual fractions or bands. Electroseparation involving the migration and separation of molecules in an electric field is based on differences in mobility. Various forms of electroseparation include, by way of example and not limitation, free zone electrophoresis, gel electrophoresis, isoelectric focusing and isotachophoresis. Capillary electroseparation involves electroseparation, preferably by electrokinetic flow, including electrophoretic, dielectrophoretic and/or electroosmotic flow, conducted in a tube or channel of about 1-200 μm, usually, about 10-100 μm cross-sectional dimensions. The capillary may be a long independent capillary tube or a channel in a wafer or film comprised of silicon, quartz, glass or plastic. [0172]
  • In capillary electroseparation, an aliquot of the reaction mixture containing the e-tag products is subjected to electroseparation by introducing the mixture or an aliquot into an electroseparation channel that may be part of, or linked to, a capillary device in which the amplification and other reactions are performed. An electric potential is then applied to the electrically conductive medium contained within the channel to effectuate migration of the components within the combination. Generally, the electric potential applied is sufficient to achieve electroseparation of the desired components according to practices well known in the art. One skilled in the art will be capable of determining the suitable electric potentials for a given set of reagents used in the present invention and/or the nature of the cleaved labels, the nature of the reaction medium and so forth. The parameters for the electroseparation including those for the medium and the electric potential are usually optimized to achieve maximum separation of the desired components. This may be achieved empirically and is well within the purview of the skilled artisan. [0173]
  • Capillary devices are known for carrying out amplification reactions such as PCR. See, for example, Analytical Chemistry (1996) 68:4081-4086. Devices are also known that provide functional integration of PCR amplification and capillary electrophoresis in a microfabricated DNA analysis device. One such device is described by Woolley, et al., in [0174] Anal. Chem. (1996) 68:4081-4086. The device provides a microfabricated silicon PCR reactor and glass capillary electrophoresis chips. In the device a PCR chamber and a capillary electrophoresis chip are directly linked through a photolithographically fabricated channel filled with a sieving matrix such as hydroxyethylcellulose. Electrophoretic injection directly from the PCR chamber through the cross injection channel is used as an “electrophoretic valve” to couple the PCR and capillary electrophoresis devices on a chip.
  • The capillary electrophoresis chip contains a sufficient number of main or secondary electrophoretic channels to receive the desired number of aliquots from the PCR reaction medium or the solutions containing the e-tags, etc., at the intervals chosen. [0175]
  • For capillary electrophoresis one may employ one or more detection zones to detect the separated e-tags. It is, of course, within the purview of the present invention to utilize several detection zones depending on the nature of the amplification process, the number of cycles for which a measurement is to be made and so forth. There may be any number of detection zones associated with a single channel or with multiple channels. Suitable detectors for use in the detection zones include, by way of example, photomultiplier tubes, photodiodes, photodiode arrays, avalanche photodiodes, linear and array charge coupled device (CCD) chips, CCD camera modules, spectrofluorometers, and the like. Excitation sources include, for example, filtered lamps, LED's, laser diodes, gas, liquid and solid state lasers, and so forth. The detection may be laser scanned excitation, CCD camera detection, coaxial fiber optics, confocal back or forward fluorescence detection in single or array configurations, and the like. [0176]
  • Detection may be by any of the known methods associated with the analysis of capillary electrophoresis columns including the methods shown in U.S. Pat. Nos. 5,560,811 (column 11, lines 19-30), 4,675,300, 4,274,240 and 5,324,401, the relevant disclosures of which are incorporated herein by reference. [0177]
  • Those skilled in the electrophoresis arts will recognize a wide range of electric potentials or field strengths may be used, for example, fields of 10 to 1000 V/cm are used with 200-600 V/cm being more typical. The upper voltage limit for commercial systems is 30 kV, with a capillary length of 40-60 cm, giving a maximum field of about 600 V/cm. For DNA, typically the capillary is coated to reduce electroosmotic flow, and the injection end of the capillary is maintained at a negative potential, which may be reversed, as appropriate. [0178]
  • For ease of detection, the entire apparatus may be fabricated from a plastic material that is optically transparent, which generally allows light of wavelengths ranging from 180 to 1500 nm, usually 220 to 800 nm, more usually 450 to 700 nm, to have low transmission losses. Suitable materials include fused silica, plastics, quartz, glass, and so forth. [0179]
  • In mass spectrometry, the e-tags may be different from the e-tags used in electrophoresis, since the c-tags do not require a label, nor a charge. Thus, these e-tags may be differentiated solely by mass, which can be a result of atoms of different elements, isotopes of such elements, and numbers of such atoms. In the subject invention, such use of e-tags will be coupled with a process for removing the iterative extensions of the nucleic acid sequence, where degradation or cleavage has occurred at a site other than the ultimate linkage. [0180]
  • One embodiment of a system according to the present invention is presented in FIG. 10. This figure illustrates a system ([0181] 100) for the simultaneous, multiplexed determination of a plurality of events. Each event is distinguished from the others by electrophoresis. For example, a snp locus may be characterized using a pair of reagents, each specific for one allele of the locus. Each reagent is bonded to an e-tag with a unique electrophoretic mobility and an associated label. When the reagent is combined with a sample of interest in a reaction vessel (101), the associated e-tag is modified in a manner that changes its electrophoretic mobility if its specific target is present. After the reaction, the mixture is moved (102) onto an electrophoretic device (103) for separation of the e-tags contained in the mixture. A power control box (104) is used in conjunction with the device to control injection of the sample into the separation channel (105). Each e-tag species migrates down the separation channel of the device with a mobility unique to that tag, moving past a detector (106) that monitors its presence by its associated label. The data collected by the detector is sent to a data processor (107), which determines the presence of each snp allele in the sample based on the mobility of its corresponding e-tag.
  • In another example, a group of snp loci may be monitored in a multiplexed reaction. In this case, a plurality of pairs of e-tag reagents corresponding to the snp loci are combined with the sample in a single reaction vessel under conditions where the e-tag is released from at least a portion of the oligonucleotides sequence to which it is bonded when a pair is bonded to its target. The e-tags are either labeled for detection or the label is added by means of a reactive functionality present on the e-tag. The labeled c-tag products of the reaction are resolved from one another on the electrophoretic device, and again are monitored as they move past the detector. The level of multiplexing possible in this system is limited only by the degree of resolution that can be obtained between a designated set of e-tags on the electrophoretic device. [0182]
  • An additional degree of flexibility can be conferred on the assay by the stage at which the e-tags are labeled. As described above, each e-tag may already contain a detectable label when introduced to the reaction. Alternatively, an e-tag may contain a functionality allowing it to bind to a label after reaction with the sample is complete ([0183] 108). In this embodiment, an e-tag comprising a functionality for binding to a detectable label is combined with a sample (101). After a reaction to modify the mobility of the e-tag if its target is present in the sample, additional reagents are combined in a sample vessel (109) with the products of the first reaction, which will react with the modified e-tag(s) to add a detectable label.
    • EXAMPLES
  • The invention is demonstrated further by the following illustrative examples. Parts and percentages are by weight unless otherwise indicated. Temperatures are in degrees Centigrade (° C.) unless otherwise specified. The following preparations and examples illustrate the invention but are not intended to limit its scope. Unless otherwise indicated, oligonucleotides and peptides used in the following examples were prepared by synthesis using an automated synthesizer and were purified by gel electrophoresis or HPLC. [0184]
  • The following abbreviations have the meanings set forth below: [0185]
  • Tris HCl—Tris(hydroxymethyl)aminomethane-HCl (a 10X solution) from BioWhittaker, Walkersville, Md. [0186]
  • HPLC—high performance liquid chromatography [0187]
  • BSA—bovine serum albumin from Sigma Chemical Company, St. Louis, Mo. [0188]
  • EDTA—ethylenediaminetetetraacetate from Sigma Chemical Company [0189]
  • bp—base pairs [0190]
  • g—grams [0191]
  • mM—millimolar [0192]
  • TET—tetrachlorofluorescein [0193]
  • FAM—fluorescein [0194]
  • TAMRA—tetramethyl rhodamine [0195]
  • Reagents: [0196]
  • TET and FAMRA were purchased from Perkin Elmer (Foster City, Calif.) as were conjugates of TET, FAM and TAMRA with oligonucleotides. [0197]
  • Master Mix (2X): 20 mM Tris-HCl, 2.0 mM EDTA, pH 8.0 (8% Glycerol), [0198]
  • 10 mM MgCl[0199] 2, dATP 400 μM, dCTP 400 μM, dGTP 400 μM,
  • [0200] dUTP 400 μM, AmpliTaq Gold ® 0.1U/μI (from Perkin Elmer), Amperase
  • UNG® 0.02U/μl (from Perkin Elmer) [0201]
  • Probes and Primers: (10X) [0202]
  • Forward Primer: 3.5 [0203] μM 5′-TCA CCA CAT CCC AGT G-3′ (SEQ ID NO:1)
  • Reverse Primer 2.0 [0204] μM 5′-GAG GGA GGTTTG GCTG-3′ (SEQ ID NO:2)
  • Plasmid [0205] Allele 1 Probe: 2.0 μM (200 nM per reaction)
  • 5′ TET-CCA GCA ACC AAT GAT GCC CGT T-TAMRA-3′ (SEQ ID NO:3) [0206]
  • Plasmid [0207] Allele 2 Probe: 2.0 μM (200 nM per reaction)
  • 5′ FAM-CCA GCA AGC ACT GAT GCC TGT T-TAMRA-3′ (SEQ ID NO:4) [0208]
  • Target DNA: [0209]
  • Plasmid Allele-1: 10 fg/μl=approximately 1000 copies/μl [0210]
  • Plasmid Allele-2: 10 fg/μl=approximately 1000 copies/μl [0211]
    • Example 1
  • The experiment was set up to run in the following fashion (6 samples, a triplicate for Allelel and another triplicate for Allele-2) [0212]
  • 22 μl of Mastermix [0213]
  • 13 μl of probes and primers (both the probes are present) [0214]
  • 4.0 μl of Allele-1 or Allele-2 [0215]
  • 11 μl of buffer (10 mM Tris-HCl, 1 mM EDTA, pH8.0) [0216]
  • The above volumes were added to a PCR tubes and the reaction mixtures were cycled in the following fashion for 40 cycles. [0217]
  • Initial Steps: [0218]
  • The reaction mixtures were kept at 50° C. for 2 minutes for optimal AmpErase UNG activity. The 10 minute, 95° C. step was required to activate AmpliTaq Gold DNA Polymerase. [0219]
  • Each of the 40 cycles was performed on a Gene Amp ® system 9600 thermal cycler (Perkin Elmer) in the following fashion: [0220]
    Melt Anneal/Extend/Cleave
    15 seconds 60 seconds
    95° C. 60° C.
  • Results from experiments with Allele-1 are shown in FIG. 2. CE separation of the reaction products of [0221] Allele 1 after 0 and 40 cycles. CE instrument was Beckman P/ACE 5000 with LIF detection. BGE: 2.5% LDD30, 7 M urea, 1×TBE. Capillary: 100 μm i.d., 375 μm o.d., Lc=27 cm, Ld=6.9 cm. Detection: λex=488 nm, λem=520 nm. Injection: 5 s at 2.0 kV. Field strength: 100 V/cm at room temperature. Peaks: P=unreacted primer, P′=primer product.
  • Results from experiments with Allele-2 are shown in FIG. 3. CE separation of the reaction products of [0222] Allele 2 after 0 and 40 cycles. Experimental conditions were as given above for FIG. 2 experiment except for BGE composition: 2.0% LDD30, 1 ×TBE.
    • Example 2
  • A multiplexed reaction with both Allele 1 and [0223] Allele 2 present in equal ratio
  • The experiment was set up in the following fashion (3 reaction tubes, a triplicate) [0224]
  • 22 μl of Mastermix [0225]
  • 13 μl of probes and primers (both of the probes were present) [0226]
  • 4.0 μl of Allele-1 [0227]
  • 4.0 μl of Allele-2 [0228]
  • 7 μl of buffer (10 mM Tris-HCl, 1 mM EDTA, pH8.0) [0229]
  • The above volumes were added to a PCR tubes and the reaction mixtures were cycled in the following fashion for 40 cycles. [0230]
  • Initial Steps: [0231]
  • The reaction mixtures are kept at 50° C. for 2 minutes for optimal AmpErase UNG activity. The 10 minute, 95° C. step is required to activate AmpliTaq Gold DNA Polymerase. [0232]
  • Each of the 40 cycles is performed in the following fashion [0233]
    Melt Anneal/Extend/Cleave
    15 seconds 60 seconds
    95° C. 60° C.
  • The results are shown in FIG. 4. CE separation of a 1:1 mixture of the 40 cycles products of [0234] Alleles 1 and 2. Experimental conditions were as given above for the experiments of FIG. 2.
    • Example 3
  • A multiplexed reaction with both Allele 1 and Allele 2: [0235] Allele 1 is 10 times more concentrated than Allele 2.
  • The experiment was set up in the following fashion (3 reaction tubes, a triplicate) [0236]
  • 22 μl of Mastermix [0237]
  • 13 μl of probes and primers (both the probes were present) [0238]
  • 5.0 μl of [0239] Allele 1
  • 0.5 μl of [0240] Allele 2
  • 9.5 μl of buffer (10 mM Tris-HCI, 1 lmM EDTA, pH8.0) [0241]
  • The above volumes were added to respective PCR tubes and the reaction mixtures were cycled in the following fashion for 40 cycles. [0242]
  • Initial Steps: [0243]
  • The reaction mixtures were kept at 50° C. for 2 minutes for optimal AmpErase UNG activity. The 10 minute 95° C. step was required to activate AmpliTaq Gold DNA Polymerase. [0244]
  • Each of the 40 cycles is performed in the following fashion [0245]
    Melt Anneal/Extend/Cleave
    15 seconds 60 seconds
    95° C. 60° C.
  • The results are shown in FIG. 5. CE separation of a 1:10 mixture of the 40 cycles products of [0246] Alleles 1 and 2. Experimental conditions were as given for the experiments of FIG. 2.
    • Example 4
  • Electroseparation of Label Conjugates on Microfluidic Chip [0247]
  • Label conjugates comprising fluorescein linked to three different peptides, namely, KKAA, KKKA and KKKK were prepared as follows: The protected tetrapeptide was prepared on resin using Merrifield reagents. The N-terminus of the last aminoacid was reacted with fluorescein N-hydroxysuccinimide (Molecular Probes). The peptides were cleaved from the resin and purified by high performance liquid chromatography (HPLC). [0248]
  • The label conjugates prepared as described above and fluorescein were combined in an aqueous buffered and were separated and detected in an electrophoresis chip. Detection was 0.5 cm for the injection point on the anodal side of an electrophoresis channel. FITC-KKKK exhibited negative charge and FITC-KKKA and FITC-KKKK exhibited positive charge as determined by the migration time relative to EOF. The net charge of FITC-KKKK was greater than +1 and FITC-KKKA and FITC-KKKK migrated electrophoretically against the EOF. The results are shown in FIG. 6. [0249]
    • Example 5
  • Capillary Electrophoresis of CFTR PCR products with e-tag Probes on ABI 310 [0250]
  • The following example demonstrates separation in a gel based capillary electrophoresis of cleavage of a probe. The conditions employed were: Gel: 2.5% LDD30 in 1XTBE with 7M urea; CE: PE ABI 310; Capillary: 47 cm long; 36 cm to window; 75um ID; Running Buffer: 1X TBE. (LDD30 is a linear copolymer of N,N-diethyl acrylamide and N,N-dimethylacrylamide, 70:30). [0251]
  • The [0252] ABI3 10 was set up in accordance with the directions of the manufacturer. The parameters used were: Inj Secs 5; Inj kV 2.0; Run kV 9.4; Run C 45; Run Time 10 min. To determine the relationship of where each probe separated, a spike in system was used. First one digested probe was separated and its peak site determined, then a second probe was spiked into the first probe, and the two separated. Then, a third probe was spiked in and separated, and so on till the sites of all the six probes was determined. The single plex PCR runs were first separated followed by separation of the multiplex PCR, which was compared to the S1 digested separation.
    Type of Probe conc.
    Sample* probe (nM) vol (μl)
    10s FAM-T 32mer 20 10
    10s FAM-T dig 20 10
    10s FAM-T pcr 80 5
    10as HEX-T 32mer 20 10
    10as HEX-T dig 20 10
    10as HEX-T pcr 80 5
    11s HEX-A 28mer 20 10
    11s HEX-A dig 20 10
    11s HEX-A pcr 80 5
    11as TET-C 28mer 20 10
    11as TET-C dig 20 10
    11as TET-C pcr 80 5
    13s FAM-C 23mer 20 10
    13s FAM-C dig 20 10
    13s FAM-C pcr 80 5
    13as TET-A 23mer 20 10
    13as TET-A dig 20 10
    13as TET-A pcr 80 5
    MP10s11s13as pcr 80 5
    MP10as11as13a pcr 80 5
    MP10s10as11s11as13s13as pcr 80 5
    # the reaction mixture is multiplexed under the conditions described below
    • Example 6
  • Taq DNA Polymerase exhibits 5′ to 3′ exonuclease activity in which hybridized probes on the template DNA are cleaved during PCR. In the subject example, sequence specific probes with fluoroscent dye attached to the 5′ were employed. PCR was performed with these probes in a reaction and then separation performed in a gel based capillary electrophoresis to determine the cleavage of the probe. [0253]
    Primers, Probes, Mutation
    Name Location_SNP Mutation SNP
    CF1 Exon 11 R553X  C1789T
    CF2 Exon 19 R1162X C3616T
    CF4 Exon 3  G85E  G386A 
    CF5 Exon 4  R117H  G482A 
    CF6 Exon 7  R347P  G1172C
    CF7 Exon 10 V520F  G1690T
    CF8 Exon 11 G542X  G1756T
    CF9 Exon 11 G551D  G1784A
    CF10* Exon 11 R560T  G1811C
    CF11* Exon 18 D1152H G3586C
    CF13* Exon 22 G1349D G4178A
    Name Hyb_probe_length Probe_seq Probe_antisense
    CF1HYB 26 GTGGAGGTCAACGAGCAAGAATTTCT AGAAATTCTTGCTCGTTGACCTCCAC
    CF2HYB 25 AGATGCGATCTGTGAGCCGAGTCTT AAGACTCGGCTCACAGATCGCATCT
    CF4HYB 32 TTCTGGAGATTTATGTTCTATGGAATCTTTTT AAAAAGATTCCATAGAACATAAATCTCCAGAA
    CF5HYB 21 AAGGAGGAACGCTCTATCGCG CGCGATCGAGCGTTCCTCCTT
    CF6HYB 20 ATTGTTCTGCGCATGGCGGT ACCGCCATGCGCAGAACAAT
    CF7HYB 25 ATACAGAAGCGTCATCAAAGCATGC GCATGCTTTGATGACGCTTCTGTAT
    CF8HYB 29 CAATATAGTTCTTGGAGAAGGTGGAATCA TGATTCCACCTTCTCCAAGAACTATATTG
    CF9HYB 26 CTGAGTGGAGGTCAACGAGCAAGAAT ATTCTTGCTCGTTGACCTCCACTCAG
    CF10HYB* 32 TTCCATTTTCTTTTTAGAGCAGTATACAAAGA TCTTTGTATACTGCTCTAAAAAGAAAATGGAA
    CF11HYB* 28 AAACTCCAGCATAGATGTGGATAGCTTG CAAGCTATCCACATCTATGCTGGAGTTT
    CF13HYB* 23 CTAAGCCATGGCCACAAGCAGTT AACTGCTTGTGGCCATGGCTTAG
    Name product_size forward_seq Reverse_seq
    CF1PF/R 198 CCTTTCAAATTCAGATTGAGCATAC TTTACAGCAAATGCTTGCTAGAC
    CF2PF/R 127 TGTGAAATTGTCTGCCATTCTTA GGTTTGGTTGACTTGGTAGGTTTA
    CF4PF/R 239 TCTTTTGCAGAGAATGGGATAGA TGGAGTTGGATTCATCCTTTATATT
    CF5PF/R 151 CCAAAGCAGTACAGAATCTCTTA CCAAAAATGGCTGGGTGTAG
    CF6PF/R 137 TCTGTGCTTCCCTATGCACTAA CCAAGAGAGTCATACCATGTTTGTA
    CF7PF/R 146 TGGAGCCTTCAGAGGGTAAA TGCTTTGATGACGCTTCTGTA
    CF8PF/R 198 CCTTTCAAATTCAGATTGAGCATAC TTTACAGCAAATGCTTGCTAGAC
    CF9PF/R 198 CCTTTCAAATTCAGATTGAGCATAC TTTACAGCAAATGCTTGCTAGAC
    CF10PF/R* 108 GACCAGGAAATAGAGAGGAAATGTA CATCTAGGTATCCAAAAGGAGAGTCTA
    CF11PF/R* 188 GAAGGAGAAGGAAGAGTTGGTATTATC CGGTATATAGTTCTTCCTCATGCTATT
    CF13PF/R* 138 TTGGGCTCAGATCTGTGATAG GCAAGATCTTCGCCTTACTG
    Name Name Tm_prob, Tm_forward, Tm_reverse, oC forward_length, reverse_length
    CF1HYB CF1PF/R 66.83, 60.36, 58.78 25, 23
    CF2HYB CF2PF/R 68.65, 59.64, 60.51 23, 24
    CF4HYB CF4PF/R 64.24, 60.21, 59.2  23, 25
    CF5HYB CF5PF/R 65.06, 60.08, 60.36 23, 20
    CF6HYB CF6PF/R 68.18, 59.9,  59.48 22, 25
  • The procedure employed in carrying out the Single-plex PCR reaction was as follows: [0254]
  • 1. Make up Master Mix [0255]
    1x 6.5x
    13.2 ul  85.8 ul Water
      3 ul 19.5 ul 25 mM MgCl2
    2.5 ul 16.25 ul  10x PCR Buffer
      1 ul  6.5 ul 20 ng/ul DNA template
    0.2 ul  1.3 ul 25 mM dNTPs
    0.3 ul 1.95 ul 5 u/ul Taq Gold
    (this is added just prior to start of reaction)
  • 2. Aliquot 0.8 ul of 5 uM probe and 4 ul of 10 uM primer set to PCR tubes. [0256]
    Primer sets Probe
    10s CF10s
    10as CF10as
    11s CF11s
    11as CF11as
    13s CF13s
    13as CF13as
  • 4. Aliquot 20.2 ul of the Master Mix to each tube. [0257]
  • 5. In a PE2400 cycler, [0258]
  • 96C; 10 MIN [0259]
  • 35 CYCLES [0260]
  • 95C; 10 SEC [0261]
  • 55C; 30 SEC [0262]
  • 70C; 45 SEC [0263]
  • 35 CYCLES [0264]
  • 70C; 10 MIN [0265]
  • 4C; 24 hours [0266]
  • 6. After PCR, run the 2.5 ul of each sample on a 2.5% agarose gel. [0267]
  • 7. EtBr stain the gel, take image with camera equipped UV source. [0268]
  • Results clearly demonstrated the formation of a unique electrophoretic tag with distinct mobility (Table 1 ) for each amplified sequence. [0269]
  • Multiplex Amplification of CFTR Fragments with e-tag Probes [0270]
  • In this study the reaction involved a plurality of probes in the same PCR reaction mixture for different snps in CFTR. In the subject system, sequence specific probes with fluorescent dye attached to the 5′ terminus of the probe were employed. PCR was performed with these probes and then separation performed in gel based capillary electrophoresis to determine the cleavage of the probe. The following table indicates the fragment, the mutation reference and the specific nucleotide difference and number inb the sequence. [0271]
  • The procedure employed for performing the multiplex amplification was as follows: [0272]
  • Make up Master Mix [0273]
    1x 2.2x
    8 ul 17.6 ul  25 mM MgCl2
    2.5 ul   5.5 ul 10x PCR Buffer
    8 ul 17.6 ul  10 ng/ul DNA template
    .2 ul  .44 ul 25 mM dNTPs
    1 ul 2.2 ul 5 u/ul Taq Gold
    (this is added just prior to start of reaction)
  • 8. Aliquot 0.8 ul of each 5 uM probes CF10s, CF11s, CF10as, CF11as, CF13as and 1 ul of each 10 uM primer sets 10s, 11s, 10as, 11as,13as in one PCR tube. [0274]
  • 9. Aliquot 19.7 ul of the Master Mix to each tube. [0275]
  • 10. In a PE2400 cycler, [0276]
  • 96C; 10 MIN [0277]
  • 40 CYCLES [0278]
  • 95C; 10 SEC [0279]
  • 55C; 30 SEC [0280]
  • 65C; 1 MIN [0281]
  • 40 CYCLES [0282]
  • 70C; 10 MIN [0283]
  • 4C; storage p[0284] 1 11. After PCR, The amplified products were separated as described in the previous section. The results are shown in FIG. 7. Even in the multiplexed amplification each detection probe gives rise to a unique e-tag with distinct mobility.
    • Example 7
  • Electroseparation of Nine Electrophoretic Tags on Microfluidic Chip [0285]
  • Label conjugates comprising 9 different fluorescein derivatives linked to thymine, (Table 1 in Example 6; 1-9): Poly deoxy thymidine (20-mer; with a 5′ thiol group) is reacted with different maleamide functionalized fluoresceins. After the reaction the product is ethanol precipitated. In a reaction of 12 μl in volume, 10 μl of 25 μM oligo, 1.0 μl 10X S1 nuclease reaction buffer, 1 μl of S1 nuclease, incubate at 37° C. for 30 min followed by 96° C. for 25 min. The digested fragments are purified by HPLC. [0286]
  • The nine different c-tags prepared as described above and fluorescein were combined in an aqueous buffered and were separated and detected in an electrophoresis chip. Detection was 0.5 cm for the injection point on the anodal side of an electrophoresis channel. The results are shown in FIG. 8. [0287]
    • Example 8
  • RT-PCR Conditions [0288]
  • Ten ul from a total volume of 25 uls of each mRNA was analyzed in a total volume of 50 uls containing 0.5 uM of each of the oligonucleotide primers, 0.2 mM of each dNTP, 100 nM of each e-tag labeled oligonucleotide probe, 1×RT PCR buffer, 2.5 mM MgCl2, 0.1U/ul Tfl DNA polymerase and 0.1U/ul AMV Reverse Transcriptase (Promega Access, RT-PCR system). [0289]
  • Reverse Transcription was performed for 45 minutes at 48° C. followed by PCR. (40 thermal cycles of 30 s at 94'C, I min at 60'C and 2 min at 69° C. mRNA was obtained from M. Williams, Genentech Inc. Probe and primer design was performed as described in Analytical Biochemistry, 270, 41-49 (1999). Phosphorothioates were attached to 2, 3,4 and 5 phosphate moieties from the 5′ end. Separation was performed as described in the previous section. [0290]
  • FIG. 9[0291] a: Demonstrates the formation of 5 different cleavage products in the PCR amplification of ANF with electrophoretic tag labeled at the 5′ end of the sequence detection probe. In the second experiment, phosphate group at 2,3,4 and 5 position is converted into thiophosphate group. PCR amplification of ANF using thiophospate modified sequence detection probe yield only one cleavage product.
  • FIG. 9[0292] b Demonstrates the formation of 3 different cleavage products in the PCR amplification of GAPDH with e-tag labeled at the 5′ end of the sequence detection probe. In the second experiment, phosphate group at 2 and 3 position is converted into thiophosphate group. PCR amplification of ANF using thiophospate modified sequence detection probe yield only one predominant cleavage product.
  • Results clearly demonstrate that for two different genes that thiophosphates prevent cleavage at multiple sites of detection probes. [0293]
  • A single detectable entity (a single electrophoretic tag: FIG. 9[0294] a and 9 b) is generated as a consequence of amplification reaction.
    • Example 9
  • General Procedure for Synthesis of 6-Carboxyfluorescein Phosphoramidite Derivatives. [0295]
  • To a solution of 6-carboxyfluorescein (0.5 g, 1.32 mmol) in dry pyridine (5 mL) was added dropwise, isobutyric anhydride (0.55 mL, 3.3 mmol). The reaction was allowed to stir at room temperature under an atmosphere of nitrogen for 3 h. After removal of pyridine in vacuo the residue was redissolved in ethyl acetate (150 mL) and washed with water (150 mL). The organic layer was separated, dried over Na[0296] 2SO4, filtered, and concentrated in vacuo to yield a brownish residue. This material was dissolved in CH2Cl2 (5 mL) after which N-hydroxy succinimide (0.23 g, 2.0 mmol) and dicyclohexylcarbodiimide (0.41 g, 1.32 mmol) were added. The reaction was allowed to stir at room temperature for 3 h and then filtered through a fritted funnel to remove the white solid, which had formed. To the filtrate was added aminoethanol (0.12 mL, 2.0 mmol) dissolved in 1 mL of CH2Cl2. After 3 h the reaction was again filtered to remove a solid which had formed and then diluted with additional CH2Cl2 (50 mL). The solution was washed with water (150 mL) and then separated. The organic layer was dried over Na2SO4, filtered, and concentrated in vacuo to yield a white foam (0.7 g, 95%, 3 steps). 1H NMR: (DMSO) δ8.68 (t, 1H), 8.21 (d, 1H), 8.14 (d, 1H), 7.83 (s, 1H), 7.31 (s, 2H), 6.95 (s, 4H), 4.69 (t, 1H), 3.45 (q, 2H), 3.25 (q, 2H), 2.84 (h, 2H), 1.25 (d, 12 H). Mass (LR FAB+) calculated for C31H29NO9 (M+H+) 559.2, found: 560.
  • It is evident from the above results that the subject invention provides an accurate, efficient and sensitive process, as well as compositions for use in the process, to perform multiplexed reactions. The protocols provide for great flexibility in the manner in which determinations are carried out and maybe applied to a wide variety of situations involving hpatens, antigens, nucleic acids, cells, etc., where one may simultaneously perform a number of determinations on a single or plurality of samples and interrogate the samples for a plurality of events. The events may vary from differences in nucleic acid sequence to proteomics to enzyme activities. The results of the determination are readily read in a simple manner using electrophoresis or mass spectrometry. Systems are provided where the entire process, after addition of the sample and reagents, maybe performed under the control of a data processor with the results automatically recorded. [0297]
  • All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. [0298]
  • Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. [0299]

Claims (26)

What is claimed is:
1. A system for the simultaneous multiplexed determination of a plurality of events employing electrophoresis to distinguish the events, comprising an electrophoretic device for electrophoretic separation and detection, a container containing a first set of first agents comprising differing mobility regions defining differing target-binding regions and a second reagent comprising at least one active agent under conditions where said active agent modifies members of said first set bound to a target resulting in a change of electrophoretic mobility of said first agents bound to target to provide a modified member retaining said mobility region, and transfer of said at least one modified member to said electrophoretic device for separation and detection of said at least one modified member, with the proviso that when said first and second reagents comprise oligonucleotides, said mobility region is other than an oligomer.
2. A system for the simultaneous multiplexed determination of a plurality of events employing electrophoresis to distinguish the events, employing e-tags comprising a region having two functionalities, a first functionality for binding to or bound to a detectable label and a second functionality bonded to a target-binding region, said system comprising a vessel containing a plurality of e-tag moieties with each e-tag bonded to a different target-binding region, and a sample, whereby the presence in the sample of a target for each of said e-tag moieties results in a modification of said e-tag to produce modified e-tags with a change in mobility of said e-tag, and an electrophoresis device for separating and detecting said modified e-tags, means for moving said modified e-tags to said electrophoresis device and a data processor for receiving and processing data from said electrophoresis device, with the proviso that in the event that said first functionality is not bound to said detectable label, said system further comprising joining said modified e-tag to said detectable label and when said first and second reagents comprise oligonucleotides, said mobility region is other than an oligomer
3. A system according to claim 1, wherein said target-binding region is a polynucleotide.
4. A system according to claim 1, wherein said target-binding region is a poly(amino acid).
5. A system according to claim 1, wherein said second functionality or said target-binding region is cleavable and said system further comprises cleavage of said second functionality or said target-binding region, respectively.
6. A system according to claim 1, wherein said electrophoresis device is a capillary electrophoresis device.
7. A system according to claim 5, wherein said capillary electrophoresis device is a microfluidic device.
8. A method for performing multiplexed determinations in a nucleic acid sample, employing a reagent having a plurality of first members, each first member having an oligonucleotide sequence homologous to a target sequence and a non-oligomeric e-tag bonded to a nucleotide, and a second reagent having a nucleic acid sequence homologous to a target sequence proximal to said first member homologous sequence, with the proviso that when said first member comprises a DNA sequence interrupted by an RNA sequence a ribonuclease specific for a chimeric double stranded nucleic acid is substituted for said second reagent, said method comprising:
combining a target nucleic acid sample with said first and second reagents under conditions where said first and second reagents comprising nucleic acid sequences bind to homologous target sequences and said first and/or second reagent is modified to change the mobility of said e-tag by joining any first reagent and second reagent bound to target nucleic acid, releasing said e-tag from at least a portion of said sequence of said first reagent or cleaving said RNA interrupting said DNA to produce modified e-tags; and
separating said modified e-tags by electrophoresis, whereby the presence of target nucleic acid is determined.
9. A method according to claim 8, wherein at least one link in said nucleic acid sequence of said first reagent is resistant to nuclease cleavage.
10. A method according to claim 8, wherein a partitioning ligand is bonded to said first nucleic acid sequence where upon release of said e-tag, said partitioning ligand is retained with the remaining portion of said first sequence, and further including the step after said combining, of binding said partitioning ligand with a receptor to diminish any interference in said separating from components of said first and second reagents retaining said ligand.
11. A method according to claim 8, wherein said e-tag mobility variation is based at least in part on variation in substitution of a fluorescent label bonded to said e-tag.
12. A method according to claim 8, wherein said e-tag mobility variation is based at least in part on differences in the length of an alkylene or aralkylene group or combination of alkylene or aralkylene group joined by a polar group.
13. A method for detecting at least one target nucleic acid sequence in a nucleic acid sample, said method comprising:
combining under bond cleavage conditions: a reagent system capable of cleaving a cleavable bond of an e-tag linked target-binding sequence, said nucleic acid sample and a reagent pair consisting of a primer and said e-tag linked target-binding sequence, each reagent pair having sequences homologous for each nucleic acid sequence to be determined, wherein each said primer specifically binds to said target nucleic acid and said target-binding sequence binds to said target nucleic acid downstream from said primer, wherein each said target-binding sequence is characterized by being linked to a non-oligomeric e-tag specific for each said nucleic acid sequence;
executing at least one cycle of cleavage of said cleavable bond, whereby said e-tag is released substantially free of said target-binding sequence;
separating released e-tags into individual fractions; and
detecting said e-tag fractions,
whereby the presence in said target nucleic acid sample of said at least one nucleic acid sequence is detected;
with the proviso that, when separation is performed solely by means of differences in mass, the e-tags that are separated all have the same number of nucleotides bonded to the e-tag.
14. A method according to claim 13, wherein said bond cleavage conditions comprise a 5′-3′-nuclease.
15. A method according to claim 13, wherein said bond cleavage conditions comprise a reagent on said primer causing cleavage of said bond.
16. A method according to claim 15, wherein said reagent is an enzyme that produces singlet oxygen or hydrogen peroxide and said cleavable bond is oxidatively cleaved.
17. A method according to claim 13 wherein at least one link in said nucleic acid sequence of said target-binding sequence is resistant to nuclease cleavage.
18. A method according to claim 13, wherein a partitioning ligand is bonded to said e-tag linked target binding sequence where upon release of said e-tag, said partitioning ligand is retained with the remaining portion of said target-binding sequence, and further including the step after said combining, binding said partitioning ligand with a receptor to diminish any interference in said separating from ligand containing components .
19. A method according to claim 13, wherein said at least one target nucleic acid sequence comprises a snp and said bond cleavage conditions comprise a 5′-3′ nuclease, wherein either said target-binding sequence or said primer includes a nucleotide complementary to said snp.
20. A method for performing a plurality of simultaneous determinations in a vessel in relation to a plurality of targets, each target having at least one epitope, employing a first composition with different e-tags specific for each of said targets linked to a target- binding region that comprises a reciprocal binding member to said epitopes, or said first composition is different candidate enzyme substrates and said e-tags are specific for each enzyme substrate, said method comprising:
combining said first composition with a second composition, wherein said second composition is suspected of containing at least one target or contains at least one enzyme for said candidate substrates, and additional reagents, so that binding of said target-binding sequence to a target results in a change in the mass or electrophoretic mobility of said e-tag linked target-binding sequence to produce a product;
separating said products into discrete packets for identification;
whereby said determinations are made as to each of said e-tags.
21. A method according to claim 20, wherein said targets have a plurality of epitopes and said additional reagents comprise a receptor for said targets bound to a support and including the additional steps of separating said e-tags bound to said support from unbound e-tags and cleaving said cleavable bond releasing said e-tags from at least a portion of said reagent region.
22. A method according to claim 20, wherein said targets have a plurality of epitopes and said second composition is said enzyme, wherein said enzyme produces singlet oxygen or hydrogen peroxide.
23. A library comprising a plurality of non-oligomeric e-tags, said e-tags having a molecular weight in the range of about 150 to 5,000, each e-tag, with the entities to which it is attached, providing a different mobility in electrophoresis, wherein at least 5 of the e-tags comprise:
a mobility-identifying region comprising at least one negative or positive charge,
a target-binding region comprising at least one nucleotide or nucleotide analog, an amino acid or poly(amino acid), an enzyme substrate or a first functionality for bonding to any of them;
a detectable label or a second functionality for binding to a detectable label,
wherein when said mobility-modifying region is joined to or for joining to said poly(amino acid), said first functionality is a cleavable bond.
24. A library according to claim 23, wherein said target-binding region comprises a nucleotide or nucleotide analog.
25. A library according to claim 23, wherein said target-binding region is an oligonucleotide, wherein at least one linkage between nucleotides is nuclease resistant.
26. A library according to claim 23, wherein said second functionality is for bonding to a poly(amino acid).
US10/267,411 1999-04-30 2002-10-09 Electrophoretic tag libraries Abandoned US20030175747A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/267,411 US20030175747A1 (en) 1999-04-30 2002-10-09 Electrophoretic tag libraries

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US09/303,029 US6322980B1 (en) 1999-04-30 1999-04-30 Single nucleotide detection using degradation of a fluorescent sequence
US09/561,579 US6682887B1 (en) 1999-04-30 2000-04-28 Detection using degradation of a tagged sequence
US09/602,586 US6514700B1 (en) 1999-04-30 2000-06-21 Nucleic acid detection using degradation of a tagged sequence
US10/267,411 US20030175747A1 (en) 1999-04-30 2002-10-09 Electrophoretic tag libraries

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/602,586 Division US6514700B1 (en) 1999-04-02 2000-06-21 Nucleic acid detection using degradation of a tagged sequence

Publications (1)

Publication Number Publication Date
US20030175747A1 true US20030175747A1 (en) 2003-09-18

Family

ID=27072683

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/602,586 Expired - Fee Related US6514700B1 (en) 1999-04-02 2000-06-21 Nucleic acid detection using degradation of a tagged sequence
US10/267,411 Abandoned US20030175747A1 (en) 1999-04-30 2002-10-09 Electrophoretic tag libraries
US10/349,557 Abandoned US20040029139A1 (en) 1999-04-30 2003-01-23 System for simultaneous detection of multiple binding events in the same reaction

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/602,586 Expired - Fee Related US6514700B1 (en) 1999-04-02 2000-06-21 Nucleic acid detection using degradation of a tagged sequence

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/349,557 Abandoned US20040029139A1 (en) 1999-04-30 2003-01-23 System for simultaneous detection of multiple binding events in the same reaction

Country Status (13)

Country Link
US (3) US6514700B1 (en)
EP (1) EP1278760B1 (en)
JP (2) JP3566255B2 (en)
KR (1) KR100495242B1 (en)
AT (1) ATE398135T1 (en)
AU (2) AU1240201A (en)
CA (1) CA2403326C (en)
DE (1) DE60039196D1 (en)
DK (1) DK1278760T3 (en)
ES (1) ES2308999T3 (en)
HU (1) HUP0300371A3 (en)
PL (1) PL364923A1 (en)
WO (1) WO2001083502A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080233602A1 (en) * 2003-08-11 2008-09-25 Po-Ying Chan-Yui Detecting and profiling molecular complexes
US20090155818A1 (en) * 2003-07-17 2009-06-18 Monogram Biosciences, Inc. Measuring Receptor Homodimerization
US20090173631A1 (en) * 2002-11-08 2009-07-09 Travis Boone Single Cell Analysis of Membrane Molecules
US20090191559A1 (en) * 2007-12-20 2009-07-30 Monogram Biosciences, Inc. Her2 diagnostic methods
US8349574B2 (en) 2009-01-15 2013-01-08 Laboratory Corporation Of America Holdings Methods of determining patient response by measurement of Her-3
US8357277B2 (en) 2007-11-27 2013-01-22 Laboratory Corp. of America Holdings Enhanced method for detecting and/or quantifying an analyte in a sample
US8470542B2 (en) 2008-12-01 2013-06-25 Laboratory Corporation Of America Holdings Methods and assays for measuring p95 and/or p95 complexes in a sample and antibodies specific for p95
USRE44437E1 (en) 2003-04-01 2013-08-13 Monogram Biosciences, Inc. Methods for detecting receptor complexes comprising PI3K
US10451614B2 (en) 2016-03-15 2019-10-22 Laboratory Corporation Of America Holdings Methods of assessing protein interactions between cells

Families Citing this family (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6613523B2 (en) * 2001-06-29 2003-09-02 Agilent Technologies, Inc. Method of DNA sequencing using cleavable tags
JP2006509183A (en) * 2002-03-05 2006-03-16 アクララ バイオサイエンシーズ， インコーポレイテッド Multiplex analysis using membrane-bound sensitizers.
US20040229380A1 (en) * 2002-05-21 2004-11-18 Po-Ying Chan-Hui ErbB heterodimers as biomarkers
US20040126890A1 (en) * 2002-06-10 2004-07-01 Gjerde Douglas T. Biomolecule open channel solid phase extraction systems and methods
CN101711866A (en) 2002-07-15 2010-05-26 健泰科生物技术公司 Method for identifying tumors that are responsive to treatment with anti-ErbB2 antibodies
WO2004011128A1 (en) * 2002-07-26 2004-02-05 Aclara Biosciences, Inc. Methods and compositions for screening cell binding molecules
US20040053263A1 (en) * 2002-08-30 2004-03-18 Abreu Maria T. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease
FR2846331B1 (en) * 2002-10-29 2006-11-17 Synth Innove Lab HIGH PURITY PHTHALINE AND PROCESS FOR PREPARING THE SAME
US20060127947A1 (en) * 2003-01-17 2006-06-15 Maurizio Fusco Receptor deorphanization using tagged molecular libraries
EP1606419A1 (en) 2003-03-18 2005-12-21 Quantum Genetics Ireland Limited Systems and methods for improving protein and milk production of dairy herds
EP1613205B1 (en) 2003-04-01 2013-04-24 Monogram BioSciences, Inc. Erbb surface receptor complexes as biomarkers
US20050106602A1 (en) * 2003-11-17 2005-05-19 Hashem Akhavan-Tafti Simplified methods for isolating nucleic acids from cellular materials
US20050136477A1 (en) * 2003-11-17 2005-06-23 Hashem Akhavan-Tafti Methods for isolating nucleic acids from biological and cellular materials
US20050106589A1 (en) * 2003-11-17 2005-05-19 Hashem Akhavan-Tafti Compositions and methods for releasing nucleic acids from solid phase binding materials
US20050106576A1 (en) * 2003-11-17 2005-05-19 Hashem Akhavan-Tafti Methods of using cleavable solid phases for isolating nucleic acids
WO2005112544A2 (en) 2004-02-19 2005-12-01 The Governors Of The University Of Alberta Leptin promoter polymorphisms and uses thereof
WO2005085850A1 (en) * 2004-02-27 2005-09-15 Tianxin Wang Methods for multiplexed analyte detection
US8911942B2 (en) * 2004-05-20 2014-12-16 Quest Diagnostics Investments Incorporated Single label comparative hybridization
EP1883909A2 (en) * 2005-05-17 2008-02-06 Explo Track, Llc System and method for detecting, monitoring, tracking and identifying explosive materials
US20070268135A1 (en) * 2006-05-17 2007-11-22 Morhard Robert C System and method for detecting, monitoring, tracking and identifying explosive materials using visibility devices
US20070188330A1 (en) * 2006-01-24 2007-08-16 Morhard Robert C System and method for detecting, monitoring, tracking and identifying explosive materials using ID marks
US20070008115A1 (en) * 2005-05-17 2007-01-11 Morhard Robert C System, method and devices for detecting, monitoring, tracking and identifying explosive materials using RFID tags
US20080042805A1 (en) * 2005-05-17 2008-02-21 Morhard Robert C System and method for detecting, monitoring, tracking and identifying explosive materials
WO2007008472A2 (en) * 2005-07-08 2007-01-18 Colorado Seminary, Which Owns And Operates The University Of Denver Photoinduced signal amplification through externally sensitized photofragmentation in masked photosensitizers
US20090247420A1 (en) * 2005-12-12 2009-10-01 Kutateladze Andrei G Method for encoding and screening combinatorial libraries
JP2008111709A (en) * 2006-10-30 2008-05-15 Japan Science & Technology Agency Labelling agent and measuring method of target substance
US7902345B2 (en) * 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US8133701B2 (en) * 2006-12-05 2012-03-13 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US7507539B2 (en) * 2007-07-30 2009-03-24 Quest Diagnostics Investments Incorporated Substractive single label comparative hybridization
US8735167B2 (en) * 2007-08-20 2014-05-27 Colorado Seminary, Which Owns And Operates The University Of Denver Photoinduced signal amplification through externally sensitized photofragmentation in masked photosensitizers and photoamplified fluorescence turn-off system
US9404150B2 (en) 2007-08-29 2016-08-02 Sequenom, Inc. Methods and compositions for universal size-specific PCR
US8741858B2 (en) 2007-09-21 2014-06-03 Zhongxu Ren Oligomer-nucleoside phosphate conjugates
US20100233732A1 (en) * 2009-01-15 2010-09-16 Laboratory Corporation Of America Holdings Methods of Determining Patient Response By Measurement of HER-2 Expression
CN102428191A (en) * 2009-03-18 2012-04-25 塞昆纳姆股份有限公司 Use Of Thermostable Endonucleases For Generating Reporter Molecules
JP6120449B2 (en) * 2011-05-06 2017-04-26 キアゲン ゲーエムベーハー Oligonucleotides comprising a label attached via a linker
EP2904390B1 (en) 2012-10-02 2016-11-16 Roche Diagnostics GmbH Methods of specifically releasing a sub-group of objects
US9540699B2 (en) 2013-03-13 2017-01-10 William Beaumont Hospital Methods of diagnosing increased risk of developing MRSA
KR101847748B1 (en) 2013-08-22 2018-04-10 소니 주식회사 Water soluble fluorescent or colored dyes and methods for their use
EP3050886A1 (en) * 2015-02-02 2016-08-03 Bürkert Werke GmbH Fluorescent dyes and dye precursors
US11084932B2 (en) 2015-02-26 2021-08-10 Sony Group Corporation Phenylethynylnaphthalene dyes and methods for their use
KR20170120677A (en) 2015-02-26 2017-10-31 소니 주식회사 Water-soluble fluorescent or colored dyes including conjugated groups
CN107709470B (en) 2015-05-11 2021-01-29 索尼公司 Super bright dimeric or polymeric dyes
CN105510420B (en) * 2015-12-20 2017-12-12 青岛科技大学 A kind of method based on Beads enrichment and DNA marker gold nanoparticle probe detection ATP contents
CN109415574B (en) 2016-04-01 2021-05-28 索尼公司 Superbright dimeric or polymeric dyes with rigid spacer groups
JP7049113B2 (en) 2016-04-01 2022-04-06 ソニーグループ株式会社 Super bright dimer or polymer dye
RU2021124058A (en) 2016-04-06 2021-09-10 Сони Корпорейшн ULTRA BRIGHT DIMERIC OR POLYMERIC PAINTS WITH SPACER LINKER GROUPS
US11390754B2 (en) 2016-05-10 2022-07-19 Sony Corporation Compositions comprising a polymeric dye and a cyclodextrin and uses thereof
EP3455238A1 (en) 2016-05-10 2019-03-20 Sony Corporation Ultra bright polymeric dyes with peptide backbones
CN109071961B (en) 2016-05-11 2021-04-27 索尼公司 Ultra-bright dimeric or polymeric dyes
WO2017214165A1 (en) 2016-06-06 2017-12-14 Sony Corporation Ionic polymers comprising fluorescent or colored reporter groups
EP3691690A1 (en) 2017-10-05 2020-08-12 Sony Corporation Programmable polymeric drugs
CN111836645A (en) 2017-11-16 2020-10-27 索尼公司 Programmable polymeric pharmaceuticals
US20200353094A1 (en) * 2018-01-12 2020-11-12 Sony Corporation Phosphoalkyl ribose polymers comprising biologically active compounds
JP2021520423A (en) 2018-03-19 2021-08-19 ソニーグループ株式会社 Use of divalent metals to enhance fluorescent signals
CN112119083A (en) 2018-03-21 2020-12-22 索尼公司 Polymeric tandem dyes with linker groups
JP2021529194A (en) * 2018-06-27 2021-10-28 ソニーグループ株式会社 Polymer dye with linker group containing deoxyribose
WO2021062176A2 (en) 2019-09-26 2021-04-01 Sony Corporation Polymeric tandem dyes with linker groups

Citations (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4274240A (en) * 1978-07-18 1981-06-23 Rene Soum Concrete floor slab constructed from basic prefabricated slabs
US4331590A (en) * 1978-03-13 1982-05-25 Miles Laboratories, Inc. β-Galactosyl-umbelliferone-labeled protein and polypeptide conjugates
US4650750A (en) * 1982-02-01 1987-03-17 Giese Roger W Method of chemical analysis employing molecular release tag compounds
US4675300A (en) * 1985-09-18 1987-06-23 The Board Of Trustees Of The Leland Stanford Junior University Laser-excitation fluorescence detection electrokinetic separation
US4709016A (en) * 1982-02-01 1987-11-24 Northeastern University Molecular analytical release tags and their use in chemical analysis
US4767699A (en) * 1985-05-02 1988-08-30 Allied Corporation Diagnostic reagent, kit and method employing polynucleotide displacement, separation, enzymatic cleavage and adenosine phosphate detection
US4780421A (en) * 1986-04-03 1988-10-25 Sclavo Inc. Cleavable labels for use in binding assays
US4876187A (en) * 1985-12-05 1989-10-24 Meiogenics, Inc. Nucleic acid compositions with scissile linkage useful for detecting nucleic acid sequences
US5057412A (en) * 1984-03-26 1991-10-15 London Biotechnology Limited Enzymic method of detecting analytes and novel substrates therefor
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5324401A (en) * 1993-02-05 1994-06-28 Iowa State University Research Foundation, Inc. Multiplexed fluorescence detector system for capillary electrophoresis
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5451503A (en) * 1992-01-22 1995-09-19 Gen-Probe Incorporated Method for use of branched nucleic acid probes
US5470705A (en) * 1992-04-03 1995-11-28 Applied Biosystems, Inc. Probe composition containing a binding domain and polymer chain and methods of use
US5494793A (en) * 1986-12-15 1996-02-27 British Technology Group Usa Inc. Monomeric phthalocyanine reagents
US5514543A (en) * 1992-04-03 1996-05-07 Applied Biosystems, Inc. Method and probe composition for detecting multiple sequences in a single assay
US5536834A (en) * 1991-05-22 1996-07-16 Behringwerke Ag Cyclic ether compounds
US5552028A (en) * 1993-12-17 1996-09-03 The Perkin-Elmer Corporation Polymers for separation of biomolecules by capillary electrophoresis
US5560811A (en) * 1995-03-21 1996-10-01 Seurat Analytical Systems Incorporated Capillary electrophoresis apparatus and method
US5602273A (en) * 1982-02-01 1997-02-11 Northeastern University Release tag compounds producing ketone signal groups
US5650270A (en) * 1982-02-01 1997-07-22 Northeastern University Molecular analytical release tags and their use in chemical analysis
US5719028A (en) * 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5721099A (en) * 1992-10-01 1998-02-24 Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5766481A (en) * 1995-04-06 1998-06-16 Arqule, Inc. Method for rapid purification, analysis and characterizations of collections of chemical compounds
US5789172A (en) * 1992-10-01 1998-08-04 Trustees Of The Columbia University In The City Of New York Methods of determining the structure of a compound encoded by identifiers having tags
US5837450A (en) * 1992-12-07 1998-11-17 Third Wave Technologies, Inc. Detection of target nucleic acid molecules using thermostable 5' nuclease
US5843666A (en) * 1994-09-02 1998-12-01 Lumigen, Inc. Chemiluminescent detection methods using dual enzyer-labeled binding partners
US5843654A (en) * 1992-12-07 1998-12-01 Third Wave Technologies, Inc. Rapid detection of mutations in the p53 gene
US5843655A (en) * 1995-09-18 1998-12-01 Affymetrix, Inc. Methods for testing oligonucleotide arrays
US5846839A (en) * 1995-12-22 1998-12-08 Glaxo Group Limited Methods for hard-tagging an encoded synthetic library
US5846717A (en) * 1996-01-24 1998-12-08 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
US5874213A (en) * 1994-08-24 1999-02-23 Isis Pharmacueticals, Inc. Capillary electrophoretic detection of nucleic acids
US5888780A (en) * 1992-12-07 1999-03-30 Third Wave Technologies, Inc. Rapid detection and identification of nucleic acid variants
US5952654A (en) * 1997-10-29 1999-09-14 Northeastern University Field-release mass spectrometry
US5958202A (en) * 1992-09-14 1999-09-28 Perseptive Biosystems, Inc. Capillary electrophoresis enzyme immunoassay
US5985557A (en) * 1996-01-24 1999-11-16 Third Wave Technologies, Inc. Invasive cleavage of nucleic acids
US5994069A (en) * 1996-01-24 1999-11-30 Third Wave Technologies, Inc. Detection of nucleic acids by multiple sequential invasive cleavages
US6001579A (en) * 1993-10-01 1999-12-14 The Trustees Of Columbia University Supports and combinatorial chemical libraries thereof encoded by non-sequencable tags
US6027890A (en) * 1996-01-23 2000-02-22 Rapigene, Inc. Methods and compositions for enhancing sensitivity in the analysis of biological-based assays
US6045676A (en) * 1996-08-26 2000-04-04 The Board Of Regents Of The University Of California Electrochemical detector integrated on microfabricated capilliary electrophoresis chips
US6121001A (en) * 1994-12-23 2000-09-19 Dade Behring Marburg Gmbh Detection of nucleic acids by target-catalyzed product formation
US6251581B1 (en) * 1991-05-22 2001-06-26 Dade Behring Marburg Gmbh Assay method utilizing induced luminescence
US6312893B1 (en) * 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
US20010049105A1 (en) * 1999-04-30 2001-12-06 Sharat Singh Methods employing generalized target-binding e-tag probes
US6331530B1 (en) * 1999-07-13 2001-12-18 The Trustees Of Columbia University In The City Of New York Hydrophilic carrier for photosensitizers that cleaves when they catalyze the formation of singlet oxygen
US6335201B1 (en) * 1998-03-06 2002-01-01 The Regents Of The University Of California Method and apparatus for detecting enzymatic activity using molecules that change electrophoretic mobility
US20020045178A1 (en) * 2000-06-13 2002-04-18 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing
US20020098478A1 (en) * 1998-01-27 2002-07-25 Barbara J. Wold Method of detecting a nucleic acid

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69217497T2 (en) * 1991-09-18 1997-06-12 Affymax Tech Nv METHOD FOR SYNTHESISING THE DIFFERENT COLLECTIONS OF OLIGOMERS
US6087186A (en) * 1993-07-16 2000-07-11 Irori Methods and apparatus for synthesizing labeled combinatorial chemistry libraries
DE19627032C2 (en) * 1996-07-04 1999-04-15 Deutsches Krebsforsch Process for the degradation of potentially modified nucleic acids
WO1999042838A1 (en) * 1998-02-18 1999-08-26 Dade Behring Inc. Chemiluminescent compositions for use in detection of multiple analytes
WO2000055368A2 (en) 1999-03-15 2000-09-21 Pe Corporation (Ny) Probe/mobility modifier complexes for multiplex nucleic acid detection
AU3519900A (en) * 1999-03-19 2000-10-09 Aclara Biosciences, Inc. Methods for single nucleotide polymorphism detection

Patent Citations (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4331590A (en) * 1978-03-13 1982-05-25 Miles Laboratories, Inc. β-Galactosyl-umbelliferone-labeled protein and polypeptide conjugates
US4274240A (en) * 1978-07-18 1981-06-23 Rene Soum Concrete floor slab constructed from basic prefabricated slabs
US5360819A (en) * 1982-02-01 1994-11-01 Northeastern University Molecular analytical release tags and their use in chemical analysis
US4650750A (en) * 1982-02-01 1987-03-17 Giese Roger W Method of chemical analysis employing molecular release tag compounds
US4709016A (en) * 1982-02-01 1987-11-24 Northeastern University Molecular analytical release tags and their use in chemical analysis
US5650270A (en) * 1982-02-01 1997-07-22 Northeastern University Molecular analytical release tags and their use in chemical analysis
US5610020A (en) * 1982-02-01 1997-03-11 Northeastern University Release tag compounds producing ketone signal groups
US5604104A (en) * 1982-02-01 1997-02-18 Northeastern University Release tag compounds producing ketone signal groups
US5602273A (en) * 1982-02-01 1997-02-11 Northeastern University Release tag compounds producing ketone signal groups
US5057412A (en) * 1984-03-26 1991-10-15 London Biotechnology Limited Enzymic method of detecting analytes and novel substrates therefor
US4767699A (en) * 1985-05-02 1988-08-30 Allied Corporation Diagnostic reagent, kit and method employing polynucleotide displacement, separation, enzymatic cleavage and adenosine phosphate detection
US4675300A (en) * 1985-09-18 1987-06-23 The Board Of Trustees Of The Leland Stanford Junior University Laser-excitation fluorescence detection electrokinetic separation
US4876187A (en) * 1985-12-05 1989-10-24 Meiogenics, Inc. Nucleic acid compositions with scissile linkage useful for detecting nucleic acid sequences
US4780421A (en) * 1986-04-03 1988-10-25 Sclavo Inc. Cleavable labels for use in binding assays
US5494793A (en) * 1986-12-15 1996-02-27 British Technology Group Usa Inc. Monomeric phthalocyanine reagents
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5578498A (en) * 1991-05-22 1996-11-26 Behringwerke Ag Metal chelate containing compositions for use in chemiluminescent assays
US5536834A (en) * 1991-05-22 1996-07-16 Behringwerke Ag Cyclic ether compounds
US6251581B1 (en) * 1991-05-22 2001-06-26 Dade Behring Marburg Gmbh Assay method utilizing induced luminescence
US5451503A (en) * 1992-01-22 1995-09-19 Gen-Probe Incorporated Method for use of branched nucleic acid probes
US5777096A (en) * 1992-04-03 1998-07-07 The Perkin-Elmer Corporation Probe composition containing a binding domain and polymer chain and methods of use
US5580732A (en) * 1992-04-03 1996-12-03 The Perkin Elmer Corporation Method of DNA sequencing employing a mixed DNA-polymer chain probe
US5807682A (en) * 1992-04-03 1998-09-15 The Perkin-Elmer Corporation Probe composition containing a binding domain and polymer chain and method of use
US5470705A (en) * 1992-04-03 1995-11-28 Applied Biosystems, Inc. Probe composition containing a binding domain and polymer chain and methods of use
US5624800A (en) * 1992-04-03 1997-04-29 The Perkin-Elmer Corporation Method of DNA sequencing employing a mixed DNA-polymer chain probe
US5989871A (en) * 1992-04-03 1999-11-23 The Perkin-Elmer Corporation Kits for DNA sequencing employing a mixed DNA-polymer chain probe
US5703222A (en) * 1992-04-03 1997-12-30 The Perkin-Elmer Corporation Probe composition containing a binding domain and polymer chain and methods of use
US5514543A (en) * 1992-04-03 1996-05-07 Applied Biosystems, Inc. Method and probe composition for detecting multiple sequences in a single assay
US5958202A (en) * 1992-09-14 1999-09-28 Perseptive Biosystems, Inc. Capillary electrophoresis enzyme immunoassay
US5721099A (en) * 1992-10-01 1998-02-24 Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5789172A (en) * 1992-10-01 1998-08-04 Trustees Of The Columbia University In The City Of New York Methods of determining the structure of a compound encoded by identifiers having tags
US5719028A (en) * 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5837450A (en) * 1992-12-07 1998-11-17 Third Wave Technologies, Inc. Detection of target nucleic acid molecules using thermostable 5' nuclease
US5843654A (en) * 1992-12-07 1998-12-01 Third Wave Technologies, Inc. Rapid detection of mutations in the p53 gene
US5888780A (en) * 1992-12-07 1999-03-30 Third Wave Technologies, Inc. Rapid detection and identification of nucleic acid variants
US5324401A (en) * 1993-02-05 1994-06-28 Iowa State University Research Foundation, Inc. Multiplexed fluorescence detector system for capillary electrophoresis
US6001579A (en) * 1993-10-01 1999-12-14 The Trustees Of Columbia University Supports and combinatorial chemical libraries thereof encoded by non-sequencable tags
US5567292A (en) * 1993-12-17 1996-10-22 The Perkin-Elmer Corporation Polymers for separation of biomolecules by capillary electrophoresis
US5552028A (en) * 1993-12-17 1996-09-03 The Perkin-Elmer Corporation Polymers for separation of biomolecules by capillary electrophoresis
US5916426A (en) * 1993-12-17 1999-06-29 The Perkin-Elmer Corporation Polymers for separation of biomolecules by capillary electrophoresis
US5874213A (en) * 1994-08-24 1999-02-23 Isis Pharmacueticals, Inc. Capillary electrophoretic detection of nucleic acids
US5843666A (en) * 1994-09-02 1998-12-01 Lumigen, Inc. Chemiluminescent detection methods using dual enzyer-labeled binding partners
US6121001A (en) * 1994-12-23 2000-09-19 Dade Behring Marburg Gmbh Detection of nucleic acids by target-catalyzed product formation
US5560811A (en) * 1995-03-21 1996-10-01 Seurat Analytical Systems Incorporated Capillary electrophoresis apparatus and method
US5766481A (en) * 1995-04-06 1998-06-16 Arqule, Inc. Method for rapid purification, analysis and characterizations of collections of chemical compounds
US5843655A (en) * 1995-09-18 1998-12-01 Affymetrix, Inc. Methods for testing oligonucleotide arrays
US6368874B1 (en) * 1995-12-22 2002-04-09 Affymax, Inc. Methods for hard-tagging an encoded synthetic library
US5846839A (en) * 1995-12-22 1998-12-08 Glaxo Group Limited Methods for hard-tagging an encoded synthetic library
US6312893B1 (en) * 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
US6027890A (en) * 1996-01-23 2000-02-22 Rapigene, Inc. Methods and compositions for enhancing sensitivity in the analysis of biological-based assays
US5994069A (en) * 1996-01-24 1999-11-30 Third Wave Technologies, Inc. Detection of nucleic acids by multiple sequential invasive cleavages
US5985557A (en) * 1996-01-24 1999-11-16 Third Wave Technologies, Inc. Invasive cleavage of nucleic acids
US5846717A (en) * 1996-01-24 1998-12-08 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
US6045676A (en) * 1996-08-26 2000-04-04 The Board Of Regents Of The University Of California Electrochemical detector integrated on microfabricated capilliary electrophoresis chips
US5952654A (en) * 1997-10-29 1999-09-14 Northeastern University Field-release mass spectrometry
US20020098478A1 (en) * 1998-01-27 2002-07-25 Barbara J. Wold Method of detecting a nucleic acid
US6335201B1 (en) * 1998-03-06 2002-01-01 The Regents Of The University Of California Method and apparatus for detecting enzymatic activity using molecules that change electrophoretic mobility
US20010049105A1 (en) * 1999-04-30 2001-12-06 Sharat Singh Methods employing generalized target-binding e-tag probes
US6916612B2 (en) * 1999-04-30 2005-07-12 Aclara Biosciences, Inc. Sets of oligonucleotide-binding e-tag probes
US6331530B1 (en) * 1999-07-13 2001-12-18 The Trustees Of Columbia University In The City Of New York Hydrophilic carrier for photosensitizers that cleaves when they catalyze the formation of singlet oxygen
US20020045178A1 (en) * 2000-06-13 2002-04-18 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090173631A1 (en) * 2002-11-08 2009-07-09 Travis Boone Single Cell Analysis of Membrane Molecules
USRE44437E1 (en) 2003-04-01 2013-08-13 Monogram Biosciences, Inc. Methods for detecting receptor complexes comprising PI3K
US20090155818A1 (en) * 2003-07-17 2009-06-18 Monogram Biosciences, Inc. Measuring Receptor Homodimerization
US8247180B2 (en) 2003-07-17 2012-08-21 Monogram Biosciences, Inc. Measuring receptor homodimerization
US8198031B2 (en) 2003-08-11 2012-06-12 Monogram Biosciences, Inc. Detecting and profiling molecular complexes
US20080233602A1 (en) * 2003-08-11 2008-09-25 Po-Ying Chan-Yui Detecting and profiling molecular complexes
US8357277B2 (en) 2007-11-27 2013-01-22 Laboratory Corp. of America Holdings Enhanced method for detecting and/or quantifying an analyte in a sample
US20090191559A1 (en) * 2007-12-20 2009-07-30 Monogram Biosciences, Inc. Her2 diagnostic methods
US10416162B2 (en) 2007-12-20 2019-09-17 Monogram Biosciences, Inc. Her2 diagnostic methods
US8470542B2 (en) 2008-12-01 2013-06-25 Laboratory Corporation Of America Holdings Methods and assays for measuring p95 and/or p95 complexes in a sample and antibodies specific for p95
US9081019B2 (en) 2008-12-01 2015-07-14 Laboratory Corporation Of America Holdings Methods and assays for measuring p95 and/or p95 complexes in a sample and antibodies specific for p95
US10273308B2 (en) 2008-12-01 2019-04-30 Laboratory Corporation Of America Holdings Methods of producing antibodies specific for p95
US9110066B2 (en) 2009-01-15 2015-08-18 Laboratory Corporation Of America Holdings HER-3 antibodies and methods of use
US9766242B2 (en) 2009-01-15 2017-09-19 Laboratory Corporation Of America Holdings Methods of determining patient response by measurement of HER-3 and P95
US8349574B2 (en) 2009-01-15 2013-01-08 Laboratory Corporation Of America Holdings Methods of determining patient response by measurement of Her-3
US10775382B2 (en) 2009-01-15 2020-09-15 Laboratory Corporation Of America Holdings Methods of determining patient response by measurement of HER-3
US10451614B2 (en) 2016-03-15 2019-10-22 Laboratory Corporation Of America Holdings Methods of assessing protein interactions between cells

Also Published As

Publication number Publication date
KR20030032939A (en) 2003-04-26
ATE398135T1 (en) 2008-07-15
CA2403326A1 (en) 2001-11-08
AU1240201A (en) 2001-11-12
ES2308999T3 (en) 2008-12-16
JP3566255B2 (en) 2004-09-15
AU2001212402B2 (en) 2004-11-04
EP1278760A1 (en) 2003-01-29
JP2003532092A (en) 2003-10-28
WO2001083502A1 (en) 2001-11-08
HUP0300371A2 (en) 2003-06-28
DE60039196D1 (en) 2008-07-24
US20040029139A1 (en) 2004-02-12
CA2403326C (en) 2010-03-30
EP1278760B1 (en) 2008-06-11
HUP0300371A3 (en) 2005-09-28
KR100495242B1 (en) 2005-06-14
DK1278760T3 (en) 2008-10-13
US6514700B1 (en) 2003-02-04
JP2004117376A (en) 2004-04-15
PL364923A1 (en) 2004-12-27

Similar Documents

Publication Publication Date Title
US6514700B1 (en) Nucleic acid detection using degradation of a tagged sequence
US6916612B2 (en) Sets of oligonucleotide-binding e-tag probes
US7001725B2 (en) Kits employing generalized target-binding e-tag probes
US7037654B2 (en) Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents
US6444682B1 (en) Base analogues
US6673550B2 (en) Electrophoretic tag reagents comprising fluorescent compounds
US6627400B1 (en) Multiplexed measurement of membrane protein populations
US6579704B2 (en) Modified nucleotides and methods useful for nucleic acid sequencing
US6682887B1 (en) Detection using degradation of a tagged sequence
US20040248150A1 (en) Methods employing oligonucleotide-binding e-tag probes
US6313286B1 (en) Nucleoside analogues
US20050053939A1 (en) Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents
US20040197815A1 (en) Methods for detecting aggregations of proteins
US20020142329A1 (en) Compositions and methods employing cleavable electrophoretic tag reagents
WO2003042658A2 (en) Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION