CN1264428A - In vivo modification of galactomannans in guar by expression of UDP-galactose epimerase antisense RNA - Google Patents
In vivo modification of galactomannans in guar by expression of UDP-galactose epimerase antisense RNA Download PDFInfo
- Publication number
- CN1264428A CN1264428A CN98807406A CN98807406A CN1264428A CN 1264428 A CN1264428 A CN 1264428A CN 98807406 A CN98807406 A CN 98807406A CN 98807406 A CN98807406 A CN 98807406A CN 1264428 A CN1264428 A CN 1264428A
- Authority
- CN
- China
- Prior art keywords
- seminose
- lactosi
- semi
- galactose
- ratio
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
Abstract
An in vivo modification process is described. The process affects the mannose-to-galactose ratio of either an organism (or part thereof) capable of producing a mannose/galactose containing compound or of a mannose/galactose containing compound thereof. The in vivo modification process comprises expressing a nucleotide sequence that has an effect on: (a) the mannose-to-galactose ratio of mannose and galactose components of a mannose/galactose containing compound; and/or (b) the mannose-to-galactose ratio of mannose and galactose precursors for a mannose/galactose containing compound; and wherein the nucleotide sequence is antisense to at least a part of the gene for a UDP-galactose epimerase enzyme.
Description
The present invention relates to a kind of modifying method.
Specifically, the present invention relates to modifying method in a kind of body.
Polygalactomannan is one group of inhomogenous cell wall polysaccharides, is made up of the mannosans main chain that the β-1-4 key with galactose side that different number α-1,6 keys connect connects.
Polygalactomannan with most important industrial use derives from the endosperm of leguminous plants guar-bean (Caymopsis tetragonolobus) and angle beans (Ceratonia siliqua).The galactose content difference of these polygalactomannan, the semi-lactosi of guar-bean is about 1: 1.6 with the ratio of seminose, and this ratio of carob bean gum (LBG) is about 1: 3.4.
The difference of galactose content has remarkable influence to the functional performance of guar gum and LBG.Two kinds of polygalactomannan (1-2%) under lower concentration all form very heavy-gravity solution, but LBG has another characteristic, promptly can form firm gel with other polysaccharide such as xanthan gum, carrageenan and agarose.The extensively real LBG that uses of foodstuffs industry is used for milk-product (particularly ice-creams), salad seasonings, sauce, goods low in calories and pet food.Yet the use of LBG is subjected to high price and the irregularly restriction of supply.
Therefore, wish to produce on a large scale polygalactomannan, with LBG such as improving functional performance owing to improving the ratio (such as similar) of seminose with semi-lactosi with improvement functional performance.
Owing to have chemical similarity between guar gum and the LBG on kind, and the price of guar gum is much lower, therefore, outer guar gum is converted into of tentative aspect has the polygalactomannan that LBG sample characteristic and chemical constitution are similar to LBG.
An example of this extracorporeal treatment comprises the use alpha-galactosidase.Aspect this, referring to McCleary etc. 1983 and EP-A-0255153.
By using the alpha-galactosidase from the guar seed purifying, having obtained galactose content is the guar gum (Bulpin etc. 1990) of 10-34%.The analysis revealed of the guar gum gelling behavior of modifying, galactose content are 24% preparation and carrageenan formation mixed gel, show the similar rheological properties with LBG.By contrast, the galactose content 38% of untreated guar gum, and the galactose content of LBG is 23%.
Yet from the viewpoint of industry, the external galactosyl that takes off of guar gum relates to many problems.
The first, must prepare a large amount of alpha-galactosidases, because about 40% semi-lactosi in the necessary removal guar gum.
The second, between incubation period, it is highly important that the hydrolysis that the mannosans main chain does not take place, this must use the alpha galactosides zymin of highly purified no any mannosans enzymic activity vestige.Method (Overbeeke etc. 1986) from guar seed heterologous production alpha-galactosidase is disclosed.Yet, before the effect of research to guar gum, purifying the alpha-galactosidase of producing by the test species, prompting mannase problem remains unsolved.
The 3rd, the generation of polygalactomannan reduces, and is equivalent to few 15% guar gum of modifying because galactose content reduces by 40%.In end product, the semi-lactosi of release may be undesirable, may remove.
The 4th, and the alpha-galactosidase incubation period between, the risk of sizable polygalactomannan depolymerization is arranged.
In addition, there is contaminating microorganisms in reaction mixture, to settle down the risk that discharges the inscribe 'beta '-mannase.
At last, must be except that anhydrating from compound of reaction.Except that the cost that influences this method, this also causes can concentrating in order to the damping fluid that obtains optimum reaction conditions.
These example explanations, the method for modifying guar gum at present is relevant with various problems, and wherein some is relevant with sizable cost.
Therefore, need a kind of method of improved modification guar gum.
In this method, we propose, and modify the compound (such as guar gum) contain seminose/semi-lactosi, and wherein this is modified in the plant materials such as the guar-bean plant and takes place, and utilizes recombinant DNA technology.Particularly, we mentioned PCT/EP96/05581, and this patent is applied for (its content is attached to herein by reference) on December 2nd, 1996.
From generalized meaning, PCT/EP96/05581 relates in the biology that can synthesize this compound modifying in the body and contains seminose/glycosyl galactose compound (such as guar gum), its modifying method is not natural to this biology, such as the method for utilizing recombinant DNA technology.The generation of this modification can be relevant with any or multiple precursor (for example seminose and/or semi-lactosi) of this compound, or relevant with this compound itself (seminose and/or the galactose unit that promptly contain the compound of seminose/semi-lactosi).
Specifically, PCT/EP96/05581 relates to modifying method in a kind of body, this method affect, preferably improve or the ratio of the seminose of biological (or its part) and semi-lactosi or contain the ratio of seminose and semi-lactosi of the compound of seminose/semi-lactosi, wherein said biology can produce the compound that contains seminose/semi-lactosi.Modification is not the process of natural generation in this body.
Therefore, method in the body of PCT/EP96/05581 may change the seminose of the ratio of seminose and semi-lactosi inside in the organism and/or seminose/glycosyl galactose compound and the ratio of semi-lactosi.
A requirement of producing the guar gum of modifying in the body is an availability of suitable gene being introduced the method for guar-bean.Jorsboe and Okkels (1994) have finished this method on limited extent, but they have shifted a kind of selecting and screening-gene of method for transformation that be used to develop.These authors do not report with influencing the gene of seminose with the ratio of semi-lactosi and transform.This is important, because from the viewpoint of biotechnology, the major obstacle of producing the guar gum of modifying in the body is to lack the biosynthetic understanding of polygalactomannan.Up to now, separation and characterized are not controlled biosynthetic gene or gene product in the guar-bean colloid as yet.Yet in PCR/EP96/05581, we have determined biosynthetic some gene or gene product in the control guar-bean colloid, therefore make us to modify guar gum in the body.
Now, we provide the novel method of the compound (such as guar gum) that a kind of modification contains seminose/semi-lactosi.
According to a first aspect of the present invention, we provide modifying method in a kind of body, the ratio of this method affect or the seminose that can produce the biology (or its part) that contains seminose/glycosyl galactose compound and semi-lactosi or contain the ratio of seminose and semi-lactosi of the compound of seminose/semi-lactosi, wherein modifying method comprises and expresses the following nucleotide sequence of influence in this body: (a) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi component and the ratio of semi-lactosi; And/or (b) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi precursor and the ratio of semi-lactosi; And wherein said nucleotide sequence is the antisense base sequences of at least a portion of UDP-galactose epimerase gene.
According to a second aspect of the present invention, we provide a kind of purposes of nucleotide sequence, described nucleotide sequence influences or can produce the seminose of the biology (or its part) that contains seminose/glycosyl galactose compound and the ratio of semi-lactosi, the ratio of seminose and semi-lactosi that perhaps contains the compound of seminose/semi-lactosi, wherein said nucleotide sequence is the antisense base sequences of at least a portion of UDP-galactose epimerase gene, and wherein said nucleotide sequence influence: (a) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi component and the ratio of semi-lactosi; And/or (b) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi precursor and the ratio of semi-lactosi.
In an optimum implementation, described nucleotide sequence is the antisense base sequences of at least a portion of UDP-galactose epimerase encoding sequence.
Term " contains seminose/glycosyl galactose compound " and is meant the compound that comprises at least one mannose group and at least one semi-lactosi group.
Described seminose/preferred the polygalactomannan of glycosyl galactose compound that contains.
The described more preferably guar gum of seminose/glycosyl galactose compound that contains.
More preferably, the described biology that contains seminose/glycosyl galactose compound that can produce is the guar-bean plant, and its to contain seminose/glycosyl galactose compound be polygalactomannan.Yet, comprise that other produces the plant of polygalactomannan, such as trigonella and clover.The plant that is considered to not produce an amount of polygalactomannan belongs to Solanaceae and tobacco.
Term " generation contains the biology (or its part) of seminose/glycosyl galactose compound " also comprises can produce any suitable biology, particularly plant that contains seminose/glycosyl galactose compound, makes the interior seminose of this biological inner bulk and the ratio of semi-lactosi change.This term also comprises any part that can produce the biology that contains seminose/glycosyl galactose compound, makes the ratio of seminose and semi-lactosi of this part change.This term is also included within biological interior part or the part in the culture medium of living.This part is preferably in biology itself.The example of such part is a seed.
Term " seminose and semi-lactosi precursor " comprises as the or derivatives thereof of seminose own and/or the or derivatives thereof of semi-lactosi own that contain seminose/glycosyl galactose compound (preferably polygalactomannan) biosynthesizing precursor.In addition, this term comprises the precursor of the or derivatives thereof of seminose own and/or the precursor of semi-lactosi or derivatives thereof, described precursor and then as containing the biosynthetic precursor of seminose/glycosyl galactose compound (preferably polygalactomannan).Preferably, this term is meant as polygalactomannan, preferably own or derivatives thereof of the seminose of the precursor of guar-bean polygalactomannan (such as Man-6-P or GDP-seminose) and/or the or derivatives thereof of semi-lactosi own.
Preferably, this biology (or its part) or its contain this ratio that seminose and the ratio of semi-lactosi in the body of seminose/glycosyl galactose compound are higher than described guar-bean plant or its polygalactomannan.
More preferably, this biology (or its part) or its interior seminose of body that contains seminose/glycosyl galactose compound are roughly similar to this ratio of described angle beans plant or its polygalactomannan to the ratio of semi-lactosi.
Preferably, to contain seminose/glycosyl galactose compound be the glue of guar-bean plant or guar-bean plant for described biology (or its part) or its.
The present invention also comprises and contains seminose/glycosyl galactose compound with the inventive method preparation.This seminose/glycosyl galactose the compound that contains will be called according to the seminose/glycosyl galactose compound that contains of the present invention.
In addition, the present invention also comprises and comprises the foodstuff that contains seminose/glycosyl galactose compound according to of the present invention.
In addition, the present invention also comprises composition, such as foodstuff, described composition comprise with another kind of polysaccharide blended according to the seminose/glycosyl galactose compound that contains of the present invention.Preferably, other sugar is any or multiple in xanthan gum, carrageenan and the agarose.
In addition, the present invention includes the method for preparation, comprise and to mix with another kind of suitable ingredients according to the seminose/glycosyl galactose compound that contains of the present invention according to composition of the present invention or foodstuff.
Each broad aspect of the present invention can reach by using a kind of nucleotide sequence, and described nucleotide sequence is the antisense base sequences of at least a portion of UDP-galactose epimerase gene.The UDP-galactose epimerase is the UDP-semi-lactosi that mixes in the polygalactomannan with the UDP-conversion of glucose.Use this strategy, antisence UDP-galactose epimerase reduces this epimerization enzymic activity, and raising contains the interior seminose of body of biosynthetic seminose of mannose glycosylation compound (such as polygalactomannan) and semi-lactosi precursor and the ratio of semi-lactosi by this.
The preferred method of the present invention relates to the formation thing that comprises or express nucleotide sequence of the present invention.
Another preferred method of the present invention relates to the carrier that comprises or express formation thing of the present invention or nucleotide sequence.
Another preferred aspect of the present invention relates to the plasmid that comprises or express carrier of the present invention, formation thing or nucleotide sequence.
Another preferred aspect of the present invention relates to the genetically modified organism that comprises or express plasmid of the present invention, carrier, formation thing or nucleotide sequence.
Other preferred aspect of the present invention comprises expresses or allows to express or transform any of described nucleotide sequence, formation thing, plasmid, carrier, cell, tissue, organ or biology and their product.
Other preferred method of the present invention comprises that use according to antisense base sequences preparation of the present invention or processing foodstuff, comprises animal-feed.
The advantage of a key of the present invention is, by using described antisense sequences, may improve biology or it contains the seminose of mannose glycosylation compound (the particularly guar gum of modifying in the body) and the ratio of semi-lactosi.
Can be used in combination described antisense base sequences in vivo with one or more other nucleotide sequences, described other nucleotide sequence preferably utilizes recombinant DNA technology to prepare.
Equally, nucleotide sequence of the present invention can use in conjunction with one or more gene products, and with the ratio of the described seminose of further influence with semi-lactosi, described gene product preferably utilizes dna technique to prepare.Here, described gene product can be one or more among peptide, polypeptide, protein, enzyme and the RNA.Preferably, one of them kind gene generation is the enzyme of being expressed by the nucleotide sequence of non-natural nucleoside acid sequence.Here, term " natural nucleus glycoside acid sequence " is meant in its natural surroundings and the complete nucleotide sequence when functionally connecting with a natural complete promotor that is connected, and described promotor is also in its natural surroundings.
As an example, in some cases, preferably be used in combination according to antisense base sequences of the present invention with the gene of one or more following enzymes of encoding and/or the gene of one or more coding alpha-galactosidases, described enzyme is that the biosynthesizing of GDP-seminose is required, i.e. phosphomannose isomerase (PMI) and/or mannose-phosphate mutase and/or GDP-seminose Pyrophosphate phosphohydrolase.
Under more preferably situation, be used in combination according to the gene of nucleotide sequence of the present invention with coding phosphomannose isomerase (PMI) and/or coding alpha-galactosidase.In PCT/EP96/05581 (its content is attached to herein by reference), disclose and discussed preferred PMI and alpha-galactosidase.
The present invention also comprises varient, homologue or the segmental purposes according to nucleotide sequence of the present invention.Here, the term " varient " relevant, " homologue " or " fragment " with described nucleotide sequence, comprise any displacement, variation, modification, replacement, disappearance or the interpolation of (or a plurality of) nucleic acid in the described nucleotide sequence, as long as the gained nucleotide sequence is similar to the antisense base sequences of at least a portion of UDP-galactose epimerase gene, and wherein the nucleotide sequence of gained can influence the seminose of above definition and the ratio of semi-lactosi.The allelic variation synonym of these terms and described sequence.
Nucleotides sequence of the present invention is classified the UDP-galactose epimerase of the antisense base sequences of its gene order as, can be any suitable UDP-galactose epimerase.Nucleotides sequence of the present invention is classified the UDP-galactose epimerase of the antisense base sequences of its gene order as, preferably endogenous UDP-galactose epimerase or the enzyme with similar sequences (are at least 85% such as sequence similarity, the preferred sequence similarity is at least 90%, more preferably sequence similarity is at least 95%, and more preferably sequence similarity is at least 98%).
According to a preferred embodiment of the present invention, nucleotides sequence of the present invention is classified the UDP-galactose epimerase of the antisense base sequences of its gene order as, can be aminoacid sequence or its varient, its homologue or its fragment that maybe can comprise SEQ ID No.1 or SEQ ID No.2 proposition.
According to a preferred embodiment of the present invention, nucleotides sequence of the present invention is classified the UDP-galactose epimerase of the antisense base sequences of its gene order as, can be the aminoacid sequence that maybe can comprise SEQ ID No.1 or SEQ ID No.2 proposition.
In addition, according to a preferred embodiment more of the present invention, nucleotides sequence of the present invention is classified encoding sequence or its varient, its homologue or its segmental antisense base sequences of the UDP-galactose epimerase of SEQ ID No.1 or SEQ ID No.2 proposition as.
According to a preferred embodiment more of the present invention, nucleotides sequence of the present invention is classified the antisense base sequences of the encoding sequence of the UDP-galactose epimerase that SEQ IDNo.1 or SEQ ID No.2 propose as.
As mentioned above, with relevant term " varient ", " homologue " or " fragment " of aminoacid sequence about the preferred UDP-galactose epimerase of antisense base sequences of the present invention, comprise one (or a plurality of) amino acid whose any displacement, variation, modification, replacement, disappearance or interpolation in the described sequence, as long as the gained enzyme has UDP-galactose epimerase activity, preferably have at least and the identical activity that comprises the enzyme of sequence shown in SEQ ID No.1 or the SEQ ID No.2.Particularly, term " homologue " comprises the homology that relates to structure and/or function.For sequence homology, preferably be at least 75% with the homology that comprises the enzyme of sequence shown in SEQ ID No.1 or the SEQ ID No.2, more preferably be at least 85%, more preferably be at least 90%.More preferably be at least 95% with the homology that comprises the enzyme of sequence shown in SEQ ID No.1 or the SEQ ID No.2, more preferably be at least 98%.
With relevant term " varient ", " homologue " or " fragment " of nucleotide sequence about the coding UDP-galactose epimerase of antisense base sequences of the present invention, comprise any displacement, variation, modification, replacement, disappearance or the interpolation of (or a plurality of) nucleic acid in the described sequence, as long as nucleotide sequence coded maybe can the coding of gained has the active enzyme of UDP-galactose epimerase, described enzyme preferably has and the identical activity that comprises the enzyme of sequence shown in SEQ ID No.1 or the SEQ ID No.2 at least.Particularly, term " homologue " comprises the homology that relates to structure and/or function, as long as nucleotide sequence coded maybe can the coding of gained has the active enzyme of UDP-galactose epimerase.For sequence homology, preferably be at least 75% with the homology that comprises sequence shown in SEQ ID No.1 or the SEQ ID No.2, more preferably be at least 85%, more preferably be at least 90%.With the enzyme that comprises sequence shown in SEQ ID No.1 or the SEQ ID No.2 the homology of sequence, more preferably be at least 95%, more preferably be at least 98%.
With the relevant term " varient " of antisense base sequences of the present invention (antisense base sequences of the nucleotide sequence of the UDP-galactose epimerase of promptly encoding), " homologue " or " fragment ", comprise any displacement of (or a plurality of) nucleic acid in the described sequence, variation, modify, replace, disappearance or interpolation, as long as the gained nucleotides sequence is classified the antisense sequences of following sequence as: coding maybe can be encoded and be had the sequence of the active enzyme of UDP-galactose epimerase, and described enzyme preferably has and the identical activity that comprises the enzyme of sequence shown in SEQ ID No.1 or the SEQ ID No.2 at least.Particularly, term " homologue " comprises the homology that relates to structure and/or function, as long as the gained nucleotides sequence is classified the antisense sequences of following sequence as: coding maybe can be encoded and be had the sequence of the active enzyme of UDP-galactose epimerase.For sequence homology, preferably be at least 75% with the homology of the sequence that comprises following sequence, more preferably be at least 85%, more preferably be at least 90%, described sequence is the antisense sequences of sequence shown in SEQ ID No.1 or the SEQ ID No.2.More preferably be at least 95% with the homology of the sequence that comprises following sequence, more preferably be at least 98%, described sequence is the antisense sequences of sequence shown in SEQ ID No.1 or the SEQ ID No.2.
Genetically modified organism of the present invention comprises the biology that comprises any or multiple following material: according to nucleotide sequence of the present invention, according to formation thing of the present invention, according to carrier of the present invention, according to plasmid of the present invention, according to cell of the present invention, according to tissue of the present invention or their product, comprise their composition.For example, described genetically modified organism also can be included in any or multiple nucleotide sequence of the present invention under one or more allogeneic promoter controls.
In a highly preferred embodiment, described genetically modified organism (or its part) does not comprise a kind of promotor and according to the combination of nucleotide sequence of the present invention, wherein said promotor and described nucleotide sequence all are natural and are in its natural surroundings this biology (or its part).
Term " promotor " uses with the normal meaning in this area, for example is the RNA polymerase binding site in the Jacob-Mond genetic expression theory.Described promotor can comprise one or more features in addition, to guarantee or to improve expression in suitable host.For example, described feature can be a conserved regions, such as Pribnow frame or TATA frame.Described promotor even can contain other sequence of influential (such as keeping, strengthen, reducing) nucleotide sequence expression level of the present invention.For example, other suitable sequence comprises Shl intron or a kind of ADH intron.Other sequence comprises the induction type element, such as temperature, chemistry, light or stress induced element.
In addition, the appropriate members that can exist enhancing to transcribe or translate.The back a kind of element an example be TMW 5 ' signal sequence (referring to Sleat Gene 217[1987] 217-225; With Dawson Plant Mol.Biol.23[1993] 97).
Therefore, on the one hand, be under the described nucleotide sequence expression promoter control of permission according to nucleotide sequence of the present invention.Aspect this, described promotor can be the cell or tissue specificity promoter.If for example described biology is a kind of plant, then described promotor can be that the described nucleotides sequence of influence is listed in the one or more middle expression promoter in seed, stem, bud, root or the leaf texture.
As an example, the promotor that is used for nucleotide sequence of the present invention can be α-Amy 1 promotor (being also referred to as Amy1 promotor, Amy 637 promotors or α-Amy 637 promotors in other cases) described in PCT/EP95/02195.
Perhaps, the promotor that is used for nucleotide sequence of the present invention can be α-Amy 3 promotors (being also referred to as Amy 3 promotors, Amy351 promotor or α-Amy 351 promotors in other cases) described in PCT/EP95/02196.About Amy 351 promotors, can its part of inactivation, make the promotor of part inactivation express described nucleotide sequence, such as only in a kind of particular tissue type or organ, expressing in more specific mode.Term " inactivation " is meant the part inactivation on the meaning of modifying described promoter expression pattern, but the promotor of wherein said part inactivation still works as promotor.Yet as mentioned above, the promotor of described modification can be expressed described nucleotide sequence at least a (rather than owning) particular organization of original promotor.The example of the other parts inactivation of promoter sequence (needn't only be the sequence of Amy 351 promotors), comprise the folding pattern that changes described promoter sequence or with described nucleotide sequence bonded kind, make that the part of described nucleotide sequence is not discerned by for example a kind of specific RNA polymerase.The another kind and the best mode of part inactivation Amy 351 promotors are with its brachymemma, to form its fragment.Another kind of mode is at least a portion sudden change that makes described sequence, makes described RNA polymerase not combine with this part or another part.
The another kind of modification is the binding site sudden change that makes the adjusting albumen (for example known CreA albumen from filamentous fungus) that applies the inhibition of carbon catabolite, and eliminates the catabolite inhibition of described natural promoter thus.
Therefore, the present invention relates to utilize recombinant DNA technology to influence the ratio of seminose and semi-lactosi.
At Sambrook, J., Fritsch, E.F., Maniatis T. (editor) molecular cloning-laboratory manual. among the second edition .Cold Spring Harbour Laboratory Press.New York 1989, can find the general content of recombinant DNA technology.
The present invention also relates to such as influence plant or endophytic seminose ratio by the preparation transgenic plant with semi-lactosi.Even unexposed enzyme of the present invention and nucleotide sequence in EP-B-0470145 and CA-A-2006454, but these two documents provide some useful background comment that can be used for preparing according to the type of skill of transgenic plant of the present invention really.The modification technology of some in these background technologies is newly-increased to be included in the following comment.
The ultimate principle that makes up the plant of genetic modification is to insert genetic information in described Plant Genome, to obtain the stable maintenance of the genetic material that inserted.
Have several technology to insert described genetic information, two kinds of cardinal principles are directly to introduce described genetic information and utilize carrier system to introduce described genetic information.Can in the paper of Potrykus (Annu RevPhysiol Plant Mol Biol[1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech in March, 1994/April 17-27), find the summary of general technology.
Therefore, on the one hand, the present invention relates to a kind of carrier system, this carrier system carries according to nucleotide sequence of the present invention or constitutes thing, and can or constitute in the genome of thing introducing such as the biology of plant described nucleotide sequence.Described carrier system can comprise a kind of carrier, but it can comprise two kinds of carriers.Under the situation of two kinds of carriers, described carrier system is commonly referred to two carrier systems.At Gynheung An etc., (1980), Binary Vectors, PlantMolecular Biology Manual A3 has described two carrier systems in further detail among the 1-19.
One is widely used in given promotor or nucleotide sequence or the system that constitutes the thing transformed plant cells based on Ti-plasmids of agrobacterium tumefaciens (Agrobacterium tumefaciens) or the Ri plasmid of Agrobacterium rhizogenes (Agrobacterium rhizogenes).An etc. (1986), PlantPhysiol.81, (1980) such as 301-305 and Butcher D.N., Tissue Culture Methodsfor Plant Pathologists, editor: D.S.Ingrams and J.P.Helgeson, 203-208.
Several different being applicable to that has made up makes up the Ti-plasmids and the Ri plasmid of above-mentioned plant or vegetable cell formation thing.
Nucleotide sequence of the present invention or constitute between the T-DNA end sequence that thing should preferably insert Ti-plasmids or contiguous T-DNA sequence is inserted, to avoid destroying sequence, because it seems that one of these districts be that the T-DNA that will modify inserts in the Plant Genome necessary at least near-DNA edge.
As what understand according to above explanation, if should biology be plant, carrier system then of the present invention preferably contains at least one boundary member that infects necessary sequence of this plant (for example vir district) and T-DNA sequence, and described boundary member is positioned on the identical carrier of described gene formation thing.
In addition; this carrier system is Ti-plasmids or Ri plasmid of Agrobacterium rhizogenes or their derivative of agrobacterium tumefaciens preferably; because these plasmids are to know, and be widely used in the structure transgenic plant, have many carrier systems based on these plasmid or derivatives thereofs.
In transgenic plant make up, with nucleotide sequence of the present invention or constitute before thing inserts plant, can be at first described carrier can duplicate therein and the microorganism of easy handling in, make up described nucleotide sequence or constitute thing.The example of a kind of useful microorganism is intestinal bacteria, but can use other microorganism with above-mentioned characteristic.When in intestinal bacteria, making up the carrier of the above carrier system that defines, in case of necessity, it is transfected in the suitable agrobacterium strains, for example agrobacterium tumefaciens.Thus, the Ti-plasmids that preferably will have nucleotide sequence of the present invention or formation thing is transfected in the suitable agrobacterium strains, agrobacterium tumefaciens for example, so that the agrobatcerium cell that obtains to have nucleotide sequence of the present invention or constitute thing, described DNA is transfected in the vegetable cell to be finished subsequently.
As reporting among the CA-A-2006454, can obtain a large amount of cloning vectors, they contain dubbing system and a kind of mark that allows to select transformant in intestinal bacteria.Described carrier comprises for example pBR322, pUC series, M13 mp series, pACYC 184 etc.
Like this, can or constitute thing with Nucleotide of the present invention introduces in the suitable restricted position of this carrier.Institute contains the report plasmid and is used for being transformed in the intestinal bacteria.In suitable nutritional medium, cultivate described Bacillus coli cells, however results and cracking.Reclaim plasmid then.As analytical procedure, sequential analysis, restriction analysis, electrophoresis and other biological chemistry-molecular biology method of general use arranged.After each operation, used dna sequence dna can be carried out restrictive diges-tion, and be connected with following a kind of dna sequence dna.Every kind of sequence can be cloned in identical carrier or the different carrier.
After the every kind of method that will introduce according to formation thing nucleotide sequence of the present invention in the described plant, may must there be and/or inserts other dna sequence dna.If for example use Ti-plasmids or Ri plasmid to transform described vegetable cell, can connect the right margin at least of Ti-plasmids and Ri plasmid T-DNA, yet normally right margin and left margin are used as the flanking region of institute's calling sequence.Furtherd investigate use T-DNA transformed plant cells, and at EP-A-120516; Hoekema, The Binary Plant Vector System Offset-drukkerij Kanters B.B., Alblasserdam, 1985, the V chapters; Fraley etc., Crit.Rev.Plant Sci., 4:1-46; With An etc., be described among EMBO J. (1985) 4:277-284.
With Agrobacterium direct infection plant tissue is a kind of widely used simple technique, in (1980) such as Butcher D.N., Tissue Culture Mehtods for Plant Pathologists, editor: D.S.Ingrams and J.P.Helgeson have description among the 203-208.For other content of this theme, referring to Potrykus (Annu Rev Plant Physiol Plant Mol Biol[1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech in March, 1994/April 17-27).Use this technology, can carry out infection plant to certain part or the tissue of this plant, described part or tissue are the part of leaf, root, stem or this plant another part.
Usually,, treat infection plant and make wound, for example by carrying out with the razor cutting or with this plant of needle penetration or with abrasive material this plant that rubs for carrying the Agrobacterium direct infection plant tissue of nucleotide sequence of the present invention.Then, inoculate wound with Agrobacterium.The plant or the plant part of inoculation are grown on suitable medium then, and allow its growth be sophisticated plant.
When making up vegetable cell, these cells can be cultivated and keep according to the tissue culture method of knowing, such as described cell is cultivated in the substratum of suitable additional essential growth factor (such as amino acid, plant hormone, VITAMIN etc.).
With becoming known for from the method for cell or tissue culture regeneration plant, for example upload at the substratum that contains suitable nutrition, plant hormone etc. and be commissioned to train fosterly, transformant can be regenerated as the plant of genetic modification by the seedling that select to transform with microbiotic and with seedling.
In EP-A-0449375, can find further content about Plant Transformation.
Can in Danish Patent Application No. 940662 (in application on June 10th, 1994) and/or UK Patent Application No. 9702592.8 (in application on February 7th, 1997), find other useful content for Plant Transformation.
Even can be with reference to (1995 Plant Cell Tissue Organ Culture, 40 1-15 pages or leaves) such as Spngstad, because these authors propose the summary about the transgenic plant structure.
As an example,, transform the guar-bean cotyledon explant, can obtain according to transgenosis guar-bean plant of the present invention with agrobacterium tumefaciens lba4404 by using method according to the method (PCT/DK95/00221) of Joersbo and Okkels.
Following sample is according to budapest treaty, be preserved in state-run industry of the depositary institution of admitting and marine microorganism preservation company limited (NCIME) on May 23rd, 1997,23 St.MacharDrive, Aberdeen, Scotland, Britain, AB21RY:1. bacillus coli DH 5 alpha pGEPI42. preserving number is NCIMB 40881.NCIMB 40881 contains this clone of clone GEPI42-and comprises SEQ ID No.1.2. bacillus coli DH 5 alpha pGEPI48. preserving number is NCIMB 40882.NCIMB 40882 contains this clone of clone GEPI48-and comprises SEQ ID No.2.
Therefore, according to a preferred embodiment, nucleotide sequence of the present invention is the antisense sequences of UDP-galactose epimerase encoding sequence, and described encoding sequence derives from preserving number NCIMB 40881 or No. 40882, NCIMB or its varient, homologue or fragment.
According to a preferred embodiment, nucleotide sequence of the present invention is the antisense sequences of UDP-galactose epimerase encoding sequence, and described encoding sequence derives from preserving number NCIMB40881 or NCIMB No. 40882.
Only the present invention is described now by embodiment.From guar-bean (Cyamopsis tetragonoloba), clone UDP-galactose epimerase gene and it is carried out the Partial Feature evaluation
The Biochemical Research that the UDP-semi-lactosi 4-epimerase (EC 5.1.3.2.) of guar-bean is carried out shows, even find that the activity of this enzyme is quite high, but the proteic amount of UDP-galactose epimerase is considerably less, has hindered the preparation purifying that is used for amino acid analysis.Therefore, clone's strategy of selection is to have complementary functions in galE-intestinal bacteria mutant.The cDNA library
In plasmid pcDNAII (Invitrogen Corporation), make up the cDNA expression library of representative, and it is transformed among the coli strain Top10F ' from the mRNA of prematurity guar seed.By plasmid purification from the isolating Top10F ' bacterium colony of choosing at random in a large number, the quality in control cDNA library.Restricted enzyme cutting analysis shows that the plasmid of all inspections is all recombinated.UDP-galactose epimerase defective escherichia coli bacterial strain
Coli strain PL-2 is because galE genetic flaw and energy metabolism semi-lactosi not, and two kinds of other gene galE of gal operon and galT are complete (Buttin, J Mol Biol, 7,164-182 (1963); Wu and Kalckar, Proc Nat Acad Sci, USA 55,622-629 (1966).Therefore, activated UDP-galactose epimerase gene is inserted among the PL-2, will allow this bacterial strain on semi-lactosi, to grow.The conversion of PL-2 and selection
With the method for Hanahan (Techniques for transformation of E.coli IRLPress, Oxford (ISBN 0-947946-18-17), 109-135 (1985), making the PL-2 cell is competence.The titre that obtains is 5 * 10
6Cell/μ g library plasmid.
Selecting substratum is the minimum medium that adds semi-lactosi basically, comprise M9 salt (Maniatis etc., molecular cloning-laboratory manual, Cold Spring Harbor, New York (ISBN 0-87969-136-0), and add 0.05g/l Threonine, 0.05g/l leucine, 0.05g/l methionine(Met), 1.0g/l vitamin, 50mg/l penbritin, 0.8g/l fructose, 0.9g/l agarose and 6 or the 8g/l semi-lactosi.This substratum is called M9-ES6 (containing the 6g/l semi-lactosi) or M9-ES8 (containing the 8g/l semi-lactosi) hereinafter.
With guar-bean cDNA library transformed competence colibacillus PL-2 cell, with the cell plating to selecting on matrix M9-ES6 or the M9-ES8.In 37 ℃ after 2 days, bacterium colony (about transformant sum 1%) appears.48 bacterium colonies have altogether been selected.UDP-galactose epimerase to selected bacterium colony is analyzed
For the ability of on semi-lactosi, growing of establishing acquisition whether owing to there is UDP-galactose epimerase activity, with the crude extract that also produces by centrifugal clarification subsequently by supersound process, the UDP-galactose epimerase activity of having tested all selected bacterium colonies.The analysis of UDP-galactose epimerase is carried out according to the method (Phytochem, 23,729-732 (1984)) of Dey basically.As expection, UDP-galactose epimerase activity is zero (negative control) in the PL-2 extract, and finds the activity of significant quantity in DH5 α (positive control).Option table reveals the active conversion of high-level UDP-galactose epimerase PL-2 bacterium colony, is used for further analysis.Use plasmid DNA to transform again from bacterium colony 42 and 48
Purifying be transformed into again in the competence PL-2 cell, and the cell plating is to M9-ES6 or M9-ES8 from the plasmid of bacterium colony 42 and bacterium colony 48.At two again in the transformation experiment, in 37 ℃ after 2 days, a large amount of bacterium colonies appears.Each experimental analysis the UDP-galactose epimerase activity of about 10 independent bacterium colonies, active all high-level similar to discovery in primary colony 42 and 48 of UDP-galactose epimerase that all extracts contain.This experiment showed, that detected UDP-galactose epimerase activity is inserted fragment coding by described cDNA in PL-2 deutero-bacterium colony 42 and 48.
To inserting segmental dna sequence analysis in bacterium colony 42 and 48
With Termo sequence fluorescence cycle sequencing kit (Amersham) and ALF dna sequencing instrument (Pharmacia), the described partial nucleotide sequence that contains the clone of UDP-semi-lactosi-4-epimerase of mensuration.
Serial ID No.1 and No.2 have shown segmental partial nucleotide sequence of insertion and deduced amino acid in bacterium colony 42 and 48 respectively.The antisense experiment
Preparation above-mentioned purpose clone's antisense base sequences, and be used for by above-mentioned technical transform guar gum.
The analysis of gained discloses, and by inserting one or more those antisense sequences, may improve the seminose of guar gum and the ratio of semi-lactosi.Therefore, the present invention is based on following wonderful discovery:, may improve the seminose of guar gum and the ratio of semi-lactosi by being inserted as the nucleotide sequence of antisense base sequences.
Other amending method of the present invention for those skilled in the art and conspicuous.
Reference
Bojsen etc. (1993) PCT patent application WO 94/20627
Bulpin P V, Gidley M J, Jeffcoat R, the Underwood D R. exploitation of the biotechnological means of plant alpha galactosides enzyme modification polygalactomannan.Carbohydr.Polymers?1990，12：155。
Edwards M, Bulpin P V, Dea I C M, the external biological of the polygalactomannan of Reid J S G. seeds of leguminous plant is synthetic.Planta.1989，178：41。
Conversion .PCT patent application PCT/DK95/00221 of Jorsboe M and Okkles F T (1994) guar-bean.
McCleary B V, Critchley P, the processing of Bulpin B.V. polysaccharide.European patent application, 1983, EP-A-0 121 960.
Maniatis T, Fritsch E F, Sambrook J (1982), molecular cloning-laboratory manual.Cold?Spring?Harbor?Laboratory.Cold?Spring?Harbor，New?York.ISBN：0-87969-136-0。
Overbeeke N, Fellinger A J, Hughes S G. produces the guar-bean alpha-galactosidase by usefulness recombinant DNA method host transformed, european patent application, 1986, EP-A-0 255153.
Reid J S G, the polygalactomannan in the Edwards M E. seed and other cell walls store polysaccharide.Food polysaccharides and their application. edits: A MStephen, Marcel Dekker, 1995, the 155-186 pages or leaves.
* * * * * * * * * * * * * * * * the translation * of nucleotide sequence * * * * * * * * * * * * * * * GEPI42 carries out at dna sequence dna. Base adds up to: 381.
10 20 30 40 50 60
| | | | | |
GAATTCCTGAAATCTGAAGTGTGAAGAAGAATAATAATAAGGAACAGTGAGTGGGATTTG
70 80 90 100 110 120
| | | | | |
AAGGGAAAGAAGAAGAAGAAGAAGATGGTGTCGTCGAGGATGGCGTCAGGGGAAACAATT
M V S S R M A S G E T I
130 140 150 160 170 180
| | | | | |
CTGGTAACTGGAGGAGCTGGATTCATCGGATCTCACACGGTGGTTCAGCTTCTGAAGCAA
L V T G G A G F I G S H T V V Q L L K Q
190 200 210 220 230 240
| | | | | |
GGGTTTCACGTATCCATCATCGACAATCTCTACAACTCCGTCATCGACGCCGTCCATAGG
G F H V S I I D N L Y N S V I D A V H R
250 260 270 280 290 300
| | | | | |
GTTCGCCTTTTGGTGGGTCCACTCCTCTCCAGCAACCTCCATTTCCATCACGGCGACCTC
V R L L V G P L L S S N L H F H H G D L
310 320 330 340 350 360
| | | | | |
CGCAACATCCATGACCTCGACATCCTCTTCTCTAAAACCAAATTTGATGCCGTGATCCAA
R N I H D L D I L F S K T K F D A V I Q
370 380
| |
CTTGCGGGCCCCAAAGGTGTG
The translation * * * * * * * * * * * * * * * * * of L A G P K G V SEQ ID NO.1***************** nucleotide sequence carries out on dna sequence dna GEPI48.Base adds up to: 351.
10 20 30 40 50 60
| | | | | |GAATTCCTTCAAAGCTATCCATACCGCTTACGCATTCATTCACTCCACCTTCTCTTTCTC
70 80 90 100 110 120
| | | | | |TCTCAGCTCCCTTCAATTATGTCATCCCAAACGGTTCTCGTCACCGGCGGAGCCGGTTAC
M S S Q T V L V T G G A G Y
130 140 150 160 170 180
| | | | | |ATCGGCAGCCACACCGTCCTTCAGCTTCTCCTCGGTGGTTTCAAGGCCGTTGTCGTTGAC?I G S H T V L Q L L L G G F K A V V V D
190 200 210 220 230 240
| | | | | |AACCTCGATAATTCTTCCGAGACCGCCATCCACAGAGTCAAGGAACTCGCCGGTAAATTC?N L D N S S E T A I H R V K E L A G K F
250 260 270 280 290 300
| | | | | |GCCGGTAATCTCTCCTTTCACAAGTTAGACCTTCGGGACAGAGATGCGCTGGAAAAAATT?A G N L S F H K L D L R D R D A L E K I
310 320 330 340 350
| | | | |TTTTCTTCCACAAAGTTTGATTCTGTCATACATTTTGCTGGACTGAAAGCA?F S S T K F D S V I H F A G L K ASEQ?ID?NO.2
Claims (18)
1. modifying method in the body, the ratio of this method affect or the seminose that can produce the biology (or its part) that contains seminose/glycosyl galactose compound and semi-lactosi or contain the ratio of seminose and semi-lactosi of the compound of seminose/semi-lactosi, modifying method comprises the Nucleotide of expressing the following ratio of influence in the wherein said body:
(a) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi component and the ratio of semi-lactosi; And/or
(b) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi precursor and the ratio of semi-lactosi; And wherein said nucleotide sequence is the antisense base sequences of at least a portion of UDP-galactose epimerase gene.
2. the purposes of a nucleotide sequence, the ratio of the influence or the seminose that can produce the biology (or its part) that contains seminose/glycosyl galactose compound and semi-lactosi or contain the ratio of seminose and semi-lactosi of the compound of seminose/semi-lactosi in the described nucleotide sequence body, wherein said nucleotide sequence is the antisense base sequences of at least a portion of UDP-galactose epimerase gene, and the influence of wherein said nucleotide sequence:
(a) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi component and the ratio of semi-lactosi; And/or
(b) contain the seminose of the seminose of seminose/glycosyl galactose compound and semi-lactosi precursor and the ratio of semi-lactosi.
3. according to the invention of claim 1 or claim 2, the wherein said seminose/glycosyl galactose compound that contains is a polygalactomannan.
4. according to each invention among the claim 1-3, the wherein said biology that contains seminose/glycosyl galactose compound that can produce is the guar-bean plant.
5. according to each invention among the claim 1-4, wherein said biology (or its part) or its contain the described ratio that seminose and the ratio of semi-lactosi in the body of seminose/glycosyl galactose compound are higher than described guar-bean plant or its polygalactomannan.
6. according to each invention among the claim 1-5, it is roughly similar to the described ratio of described angle beans or its polygalactomannan to the ratio of semi-lactosi that wherein said biology (or its part) or its contain in the body of seminose/glycosyl galactose compound seminose.
7. the formation thing that comprises a kind of nucleotide sequence, described nucleotides sequence are classified the antisense sequences of UDP-galactose epimerase gene at least a portion as.
8. the carrier that comprises a kind of nucleotide sequence, described nucleotides sequence are classified the antisense sequences of UDP-galactose epimerase gene at least a portion as.
9. the plasmid that comprises a kind of nucleotide sequence, described nucleotides sequence are classified the antisense sequences of UDP-galactose epimerase gene at least a portion as.
10. comprise a kind of genetically modified organism (or its part) of nucleotide sequence, described nucleotides sequence is classified the antisense sequences of UDP-galactose epimerase gene at least a portion as.
11. according to the genetically modified organism (or its part) of claim 10, wherein said biology is the guar-bean plant.
12. according to the invention of arbitrary aforementioned claim, wherein said nucleotides sequence is classified the antisense sequences of UDP-galactose epimerase encoding sequence at least a portion as.
13. contain seminose/glycosyl galactose compound with the preparation of the method for claim 1 or its arbitrary dependent claims.
14. comprise the foodstuff that contains seminose/glycosyl galactose compound according to claim 13.
15. a composition comprises with another polysaccharide blended is a kind of and contains seminose/glycosyl galactose compound according to claim 13.
16. a composition, comprise with xanthan gum, carrageenan and agarose in any or multiple blended is a kind of contains seminose/glycosyl galactose compound according to claim 13.
17. prepare the method for composition or foodstuff, comprise the seminose/glycosyl galactose compound that contains according to claim 13 is mixed with another suitable component.
18. method as described herein basically.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB9710990.4A GB9710990D0 (en) | 1997-05-28 | 1997-05-28 | Modification process |
| GB9710990.4 | 1997-05-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1264428A true CN1264428A (en) | 2000-08-23 |
Family
ID=10813167
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN98807406A Pending CN1264428A (en) | 1997-05-28 | 1998-05-27 | In vivo modification of galactomannans in guar by expression of UDP-galactose epimerase antisense RNA |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP0983369A1 (en) |
| JP (1) | JP2002500515A (en) |
| KR (1) | KR20010012962A (en) |
| CN (1) | CN1264428A (en) |
| AU (1) | AU733483B2 (en) |
| BR (1) | BR9809493A (en) |
| CA (1) | CA2291449A1 (en) |
| GB (2) | GB9710990D0 (en) |
| NZ (1) | NZ500951A (en) |
| WO (1) | WO1998054335A1 (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9710990D0 (en) * | 1997-05-28 | 1997-07-23 | Danisco | Modification process |
| ITPD980169A1 (en) | 1998-07-06 | 2000-01-06 | Fidia Advanced Biopolymers Srl | AMIDES OF HYALURONIC ACID AND ITS DERIVATIVES AND PROCESS FOR THEIR PREPARATION. |
| CA2716429A1 (en) * | 1999-02-10 | 2000-08-17 | E. I. Du Pont De Nemours And Company | Udp-glucose modifiers |
| US6992236B1 (en) | 1999-02-10 | 2006-01-31 | E. I. Du Pont De Nemours And Company | Plant UDP-glucose epimerases |
| GB9914210D0 (en) | 1999-06-17 | 1999-08-18 | Danisco | Promoter |
| AU2003290793A1 (en) | 2002-11-14 | 2004-06-15 | Pioneer Hi-Bred International, Inc. | Genes for galactomannan production in plants and methods of use |
| ITPD20050056A1 (en) | 2005-03-02 | 2006-09-03 | Fidia Farmaceutici | AMIDID DERIVATIVES OF HYALURONIC ACID IN OSTEOARTROSI |
| US7585818B2 (en) | 2005-05-10 | 2009-09-08 | Halliburton Energy Services, Inc. | Nonnatural galactomannans and methods of use |
| WO2008112170A1 (en) | 2007-03-09 | 2008-09-18 | Corning Incorporated | Three dimensional gum matrices for cell culture, manufacturing methods and methods of use |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK198089D0 (en) * | 1989-04-24 | 1989-04-24 | Danske Spritfabrikker | DNA MATERIALS AND USE THEREOF |
| GB9524752D0 (en) * | 1995-12-04 | 1996-02-07 | Danisco | Modification process |
| GB9710990D0 (en) * | 1997-05-28 | 1997-07-23 | Danisco | Modification process |
-
1997
- 1997-05-28 GB GBGB9710990.4A patent/GB9710990D0/en active Pending
-
1998
- 1998-05-27 GB GB9927197A patent/GB2342920B/en not_active Expired - Fee Related
- 1998-05-27 CN CN98807406A patent/CN1264428A/en active Pending
- 1998-05-27 AU AU74463/98A patent/AU733483B2/en not_active Ceased
- 1998-05-27 BR BR9809493-9A patent/BR9809493A/en not_active IP Right Cessation
- 1998-05-27 WO PCT/IB1998/000891 patent/WO1998054335A1/en not_active Application Discontinuation
- 1998-05-27 EP EP98921695A patent/EP0983369A1/en not_active Withdrawn
- 1998-05-27 CA CA002291449A patent/CA2291449A1/en not_active Abandoned
- 1998-05-27 KR KR1019997010932A patent/KR20010012962A/en not_active Application Discontinuation
- 1998-05-27 NZ NZ500951A patent/NZ500951A/en unknown
- 1998-05-27 JP JP50042399A patent/JP2002500515A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| AU7446398A (en) | 1998-12-30 |
| GB9710990D0 (en) | 1997-07-23 |
| GB9927197D0 (en) | 2000-01-12 |
| GB2342920B (en) | 2001-08-15 |
| WO1998054335A1 (en) | 1998-12-03 |
| GB2342920A (en) | 2000-04-26 |
| NZ500951A (en) | 2001-09-28 |
| CA2291449A1 (en) | 1998-12-03 |
| AU733483B2 (en) | 2001-05-17 |
| EP0983369A1 (en) | 2000-03-08 |
| KR20010012962A (en) | 2001-02-26 |
| BR9809493A (en) | 2000-06-20 |
| JP2002500515A (en) | 2002-01-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1137997C (en) | Cold-inducible promoter sequences | |
| CA2624973C (en) | Production of hyaluronan from plants transgenic for hyaluronan synthase, gfat and udp-glucose dehydrogenase | |
| CA2624592C (en) | Gfat-expressing plants with increased hyaluronan production | |
| CN1280624A (en) | Nucleic and molecules which encode proteins having fructosyl transterase activity and methods for producing long-chain inulin | |
| CA2624496A1 (en) | Plants with an increased production of hyaluronan ii | |
| CN1196092A (en) | Inhibition of gene expression | |
| CN1196093A (en) | Inhibition of gene expression | |
| CN113151211B (en) | Alpha-1, 3-fucosyltransferase mutant and application thereof in preparing 3-fucosyllactose | |
| CN1264428A (en) | In vivo modification of galactomannans in guar by expression of UDP-galactose epimerase antisense RNA | |
| CN1207772A (en) | Modification process | |
| CN1374404A (en) | Expression box and plasmid for constitutive gene strong expression | |
| CN1265704A (en) | Process for increasing yield in plants | |
| CN1134541C (en) | Use of tomato E8-derived promoters to express heterologous genes, E.G. 5-adenosylmethionine hydrolase, in ripening fruit | |
| US20060156430A1 (en) | Novel cytochrome P450 monooxygenase | |
| CA2698989C (en) | Plants which synthesize increased amounts of glucosaminoglycans | |
| DK1951878T3 (en) | Plants with increased hyaluronanproduktion | |
| EP1272645A1 (en) | Production of non-cariogenic sugars in transgenic plants | |
| CN1330719A (en) | Means and methods for influencing flowering behavious of plants | |
| CN110628778B (en) | Gene, protein, vector, recombinant gene engineering bacterium for accelerating fruit maturation and application thereof | |
| WO1998044116A1 (en) | Gene encoding recombinant trehalose phosphorylase, vector containing the gene, transformant transformed by the gene, and method for producing recombinant trehalose phosphorylase with the use of the transformant | |
| CN101277610B (en) | Improved methods and means for producing hyaluronan | |
| CN1180380A (en) | Expression of sucrose phosphorylase in plants | |
| CN1259997A (en) | Enzyme | |
| DK1951030T3 (en) | IMPROVED METHODS AND MEANS FOR THE PRODUCTION OF hyaluronan | |
| CN116790620A (en) | Rice yield regulating gene Os04t0686700, encoding protein, expression vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |