CA2135330A1 - Live vaccine vectors based on mycoplasma gallisepticum and nucleic acid probes therefrom - Google Patents
Live vaccine vectors based on mycoplasma gallisepticum and nucleic acid probes therefromInfo
- Publication number
- CA2135330A1 CA2135330A1 CA 2135330 CA2135330A CA2135330A1 CA 2135330 A1 CA2135330 A1 CA 2135330A1 CA 2135330 CA2135330 CA 2135330 CA 2135330 A CA2135330 A CA 2135330A CA 2135330 A1 CA2135330 A1 CA 2135330A1
- Authority
- CA
- Canada
- Prior art keywords
- mycoplasma
- sequence
- thr
- gene
- gallisepticum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Abstract
ABSTRACT
The present invention relates to production of recombinant DNA constructs, vaccines and a detection system for mycoplasma. The invention also relates to Mycoplasma. nucleotide sequences and a method of manipulating the mycoplasma genome.
The present invention relates to production of recombinant DNA constructs, vaccines and a detection system for mycoplasma. The invention also relates to Mycoplasma. nucleotide sequences and a method of manipulating the mycoplasma genome.
Description
LIYE YACICINE VECTO:E~S BASED ON MYCOPLASMA ~ALLISEP~ICUM AND
BACKGROIJND OF T~IE INV:ENTION
The present invention relates to conserved nucleotide sequences in mycoplasma, 10 to repetition of the conserved sequences and to repeat sequences within ~e conserved sequences. The invention also relates to the use of such sequences in production of recombinant DNA constructs, vaccines, diagnostic tests for the presence of mycoplasma in animals, including humans and to manipulation of the mycoplasma genome.
Bacteria of the genus mycoplasma which do not have cell walls are implicated 15 in a variety of diseases including primary atypical pneumonia in humans caused by M.
pneumoniae, non gonococcal urethritis in humans, possibly caused by M. genitalium, pneurnonia, air saculitis, coryza and salpingitis in poul~y caused by M. gallisepticum, respiratory disease and arthritis in poultry caused by M. synoviae and pneumonia, arthritis and urogenital disease in a range of other animals. They are also common 20 contaminants of cell cultures, with significance particularly in eukaryotic cell cultures used in the production of vaccines and other biological products.
Of particular economic importance to the poultry industry are the respiratory diseases caused by M. gallisepticum. Such diseases, which particularly effect chickens and turkeys, retard weight gain, result in downgrading of carcasses, reduced egg25 production and reduced production yields. Although vaccines for mycoplasma infection and other infections in poultry exist, it is desirable to produce more effective vaccines and to be able to determine whether the animals are already infected with mycoplasma.
It has been noted that once infected the vaccine has no protective effect on the animals.
It has been proposed to administer mycoplasma vaccines which consist of live 30 attenuated vaccines to poultry. Although these vaccines may provide some protection, there is a need to provide a more commercially viable vaccine for poultry which is effective and reduces costs to the farmer.
.
941107,p:~opcl\Jmw,20889.C~n,l :';
~ .
BACKGROIJND OF T~IE INV:ENTION
The present invention relates to conserved nucleotide sequences in mycoplasma, 10 to repetition of the conserved sequences and to repeat sequences within ~e conserved sequences. The invention also relates to the use of such sequences in production of recombinant DNA constructs, vaccines, diagnostic tests for the presence of mycoplasma in animals, including humans and to manipulation of the mycoplasma genome.
Bacteria of the genus mycoplasma which do not have cell walls are implicated 15 in a variety of diseases including primary atypical pneumonia in humans caused by M.
pneumoniae, non gonococcal urethritis in humans, possibly caused by M. genitalium, pneurnonia, air saculitis, coryza and salpingitis in poul~y caused by M. gallisepticum, respiratory disease and arthritis in poultry caused by M. synoviae and pneumonia, arthritis and urogenital disease in a range of other animals. They are also common 20 contaminants of cell cultures, with significance particularly in eukaryotic cell cultures used in the production of vaccines and other biological products.
Of particular economic importance to the poultry industry are the respiratory diseases caused by M. gallisepticum. Such diseases, which particularly effect chickens and turkeys, retard weight gain, result in downgrading of carcasses, reduced egg25 production and reduced production yields. Although vaccines for mycoplasma infection and other infections in poultry exist, it is desirable to produce more effective vaccines and to be able to determine whether the animals are already infected with mycoplasma.
It has been noted that once infected the vaccine has no protective effect on the animals.
It has been proposed to administer mycoplasma vaccines which consist of live 30 attenuated vaccines to poultry. Although these vaccines may provide some protection, there is a need to provide a more commercially viable vaccine for poultry which is effective and reduces costs to the farmer.
.
941107,p:~opcl\Jmw,20889.C~n,l :';
~ .
Currently diagnosis of mycoplasma infections in poultry is achieved by conventional culture methods. This is unsatisfactory as it is a time consurning and costly process.
There is a need, therefore, to develop effective vaccines for a variety of diseases 5 such as mycoplasma infection in animals including poultry and to develop a rapid method for assessing mycoplasrna infections.
SUMMARY OF INVENTION
The present inventors have discovered that there are regions of conserved nucleotide sequences adjacent to the M. gallisepticum adhesin (pMGA) gene complex.
The pMGA gene encodes a 67 kDa hemagglutinin from M. gallisepticum. The pMGA
gene complex is a group of 40 or so contiguous genes linked end to end. The conserved nucleotide sequence occurs at the beginning and/or end of these genes. Furthermore the 1~ inventors have recognised that the conserved nucleotide sequence contains repeated sequences consisting of direct repeats of the nucleotide triplet &AA. The conserved sequence at the 5' end of ~e pMGA gene is of particular interest since this sequence encodes a strong promoter and leader sequence which enables pMGA to be extruded through the cell membrane to the surface of the cell.
Accordingly, a first aspect of the present invention relates $o an isolated nucleotide sequence comprising a promoter region derivable from the S' conservedsequence of M. gallisepticum mentioned above.
In a further aspect the invention relates to a method of producing a multivalentmycoplasma live vaccine vector, said method comprising placing at least one foreign antigen gene under the control of a promoter region derivable from a 5' conserved sequence of 1l~. gallisepticum, or a functional part, homologue, analogue, mutan~, variant or derivative thereof, in a mycoplasma strain and obtaining expression of said foreign antigen gene.
In a still fur~er aspect the invention relates to a multivalent live vaccine vector 30 which comprises an attenuated mycoplasma strain, the genome of which encodes at least one foreign antigen under the control of the promoter regicn derivable -from a 5' conserved region of the pMGA gene, wherein native mycoplasma antigens and at least 941107,p:\op/ r\jmw,20889.Can,2 '. '~' one foreign antigen are expressed.
In yet a further aspect the invention relates to a method of vaccinating an animal against mycoplasma infection and at least one other aetiological agent the method comprising adrninistering an effective amount of the live vaccine vector according to the 5 invention.
In a yet ~rther aspect the invention relates to a method of determining whether a bird vaccinated with ~he live vaccine vector is infected with the vaccine vector or a wild-type M. gallisepticum wherein the live vaccine vector has a gene for the foreign antigen inserted into an inessential antigen gene in the live vaccine vector, which 10 inessential antigen gene is shared with a corresponding wild-type mycoplasma, the method comprising detec~ing the presence of said inessential antigen or an antibody specific therefor in a sample from the bird.
In a further aspect the invention relates to a detection system for mycoplasma, including detection of different strains within a species, where the detection system is l S a method which comprises contacting a sample suspected of containing mycoplasma with at least one nucleic acid probe specific ~or a mycoplasma under appropriate hybridisation conditions to stably hybridise the probe to a genetic sequence from said mycoplasma and then detecting hybridisation.
In a still ~rther aspect the invention relates to a kit comprising at least tvvo20 containers having a first container comprising at least one oligonucleotide probe according to the invention, and a second container comprising one or more reagents which detect the presence of said probe in a hybridised state.
BRIEF DESCRIPTION OF T~IE DRAWINGS
The present invention is -further described ~,vith reference to the -following non-limiting Figures and Exarnples. In the Figures:
Figure 1: PMGA-specific oligonucleotides: the oligonucleotides probes A and B
were assembled from amino acid analysis of peptides T3 and C7 respectively. The syrnbol N denotes the simultaneous addition of all four - nucleotides at the positions shown.
94 11 07,p:\oper\jmw,20889.Can,3 Figure 2: Reactivity of pM(3A oligonucleotides with M. gallisepticum DNA.
PUC18/pMGA and gf~nomic DNA of M. gallisepticum was digested with Eco Rl and subjected to s~ thern transfer using oligonucleotide probes A and B (Fig. 2A) for detection of complementary sequences. Lane 1 and 2 of both panels are Eco R1 digests of pUC18/pMGA DNA and M.
gallisepticum genomic DNA respectively. Probes A and B presented in Fig. 1 were hybridised to Panels A and B respectively.
Figure 3 :The complete nucleotide sequence of pMGA1.2 and the partial sequenceof pMGA1.3 are shown. The deduced amino acid sequence is shown above the first nucleotide of each codon. The amino acid sequence fi om pMGA is underlined and differences are in parentheses above the corresponding amino acid. The TGA codon for tryptophan in pMGA1.2 is underlined. The proposed promoter regions preceding transcription starts of pMGAl.2 and 1.3 are underlined ~nd labeled -35, -10. The leader sequence runs from the valine codon ~rough to the serine codon just before the start of the sequence encoding ~e mature protein, at the cysteine codon. Stem and loop structures are indicated by arrows found at nueleotide positions 81 and 2374. The restriction enzyme positions used ~or subcloning are in parenthesis -following the enzyrne used: Pstl (177), BglII (1409) and BglII (2803).
Figure 4: Aligmnent of pMGA 1.2, 1.3, 1.4 and 1.5/1.6. Note the GAA repeats vary from S to lS in length.
Figure Sa: Alignment of conserved sequences in pMGA 1.2, 1.3, 1.4 and l.S
Figure Sb: Illustrates a consensus sequence.
Figure 6: Amplification of the conserved sequence by polymerase chain reaction.Lanes 1 and 10 are molecular weight markers lane 2=cloned 10kb fragment, lane 3= M. gallisepticum DNA, l~ne 4--M. pullorum DNA, lane S= M. synoviae DNA, larle 6--M. g~llinarum DNA9 lanes 7, 8 and 9 are negative controls.
D~ESClRlPTION OF PlREF~ERRED EMlBODIMENTS
941107,p:\oper\jmw,20889.C~n.4 ~ ~
- s -In a first aspect the present invention relates to an isolated nucleotide sequence comprising a promotor region derivable *om a 5' conserved region adjacent a pMGAgene of M. gallisepticum. The term "derivable from M. gallisepticum" means that the nucleic acid may be derived from that source but is not limited to being so derived. The nucleic acid sequence may be present in other ~ycoplasma species or may be derived from synthetic sources.
The present invention also extends to an isolated nucleotide sequence comprisinga promoter region in the 5' conserved sequence of M. gallisepticum according to Figures 3, 4, 5a or 5b herein, or functional fragments, homologues, analogues, mutants, variants or derivatives thereof.
The term "promotor region" refers to a nucleic acid sequence capable of promotor activity when placed adjacent an appropriate coding sequence.
The terrn "functional *agments thereof~' used herein refers to a nucleic acid sen.uence which, although smaller than the promotor region described, retains the functional characteristics thereof such as an ability to ~unction as a promotor.The terrn "homologues; analogues, mutants, variants and derivatives" refers to rllcleotide sequences which, while different from the promotor region, retain the functional characteristics thereof. The homologues, analogues, mutants, variants and derivatives rnay be the result of natural or artificial insertion, deletion and/or substitution of the nucleic acid bases when compared to the nucleic acid sequence of the promotor region described herein.
In addition the present invention also provides an isolated nucleotide sequence comprising a leader sequence *om the S' conserved sequence from A~I. gallisepticum mentioned above. The invention also extends to polypeptides and fragments thereof encoded by the leader sequence. The terln "leader sequence" may also include thecleavage signal sequence which is responsible for cleavage of the nascent peptide and possible acylation of the mature protein. The cleavage signal sequence is thought to be the peptide sequence AA~S adjacent to the cysteine, the first amino acid of mature pMGA.
The invent;on also relates to use of the promoter region in the expression of genes and/or the use of the leader sequence in the location of the gene products in a host cell. The promoter region may be usecl to express A~: gallisep~icum genes from 941 107,p:\oper\jmw,20889.Cr~n,5 organisms other than M. gallisepticum. The host cell may be any cell capable of recognising the promoter but is most preferably a mycoplasma, more preferably M
gallisepticum.
The invention further provides a method of manipulating the genome of a S mycoplasma bacterium. Such a method may involve the isolation of genes, insertion or deletion of genes and the alteration of expression of genes. Such manipulation can be used to facilitate the production of vaccines, such as to produce attenuated strains or filrther improve the characteristics of attenuated strains.
Preferred promoter regions of the present invention include the nucleotide sequence commencing at the end of the GAA repeat through to about 100, preferably about 80, still more preferably about 70, still more preferable about 60 and even more preferably about S0 bases downstream of the 5' conserved region described in theFigures 3, 4, ~a and 5b herein; and to functional fragments, homologues, analogues, mutants, variants and derivatives l S thereof.
Preferred nucleotide sequences encoding leader sequences of the present invention include the nucleotide sequence encoding the first amino acid that is transcribed (i.e.
valine or methionine) through to cysteine of the 5' conserved sequence of Figures 3, 4 and 5 herein; and to functional fragments, homologues, analogues, mutants, variants and derivatives thereof. The term "functional fragments" and "homologues, analogues,mutants, vatiants and derivatives" have the same rneaning, when applied to the sequences encoding the leader sequence as described above. The leader sequences occur adjacent to the promoter sequences shown in Figures 3, 4, 5a and Sb. The invention also extends to isolated polypeptides and -fragments thereof encoded by the leader sequence.
The mlcleotide sequences of the present invention may comprise a plurality of nucleotides, including oligonucleotides and various forms of nucleotide molecules. The term "nucleotide", for purposes of the invention, encompasses a nucleotide sequence comprised of one or both of 2~deoxyribose and ribose nucleic acids. It also includes the various purine and pyrimidine bases that can be interchanged. Ihe chains may be 30 circularized or linear. They may also be single or double stranded.
In a particularly preferred ernbodiment of the invention, the promoter region ofthe invention described above is used io express one or more exogenous or foreign genes 94 1 107,p:\ope~\jm~,20889.Cn:l,6 in mycoplasma, preferably M. gallisepticum. Where attachment of the exogenous gene product to the mycoplasma cell membrane is required9 the nucleotide sequence encoding the leader sequence of the present invention described above may be inserted between the promoter and the start of the exogenous gene. Preferably the nucleotide sequence of the leader sequence of the present invention described above is inserted between the promoter and the foreign antigen gene so that the antigen produced is attached to the 3urface of the cell membrane of the host.
Accordingly the present invention, in another aspect, relates to an isolated nucleotide molecule comprising the promoter region of the present invention preferably linked to a gene encoding an exogenous antigen with said nucleotide sequence encoding the leader sequence of the present invention optionally linked to said gene. Thenucleotide molecule may be present on a plasmid or other suitable nucleic acid vector.
A fi~rther aspect the present invention provides a method for constructing a multivalent mycoplasma live vaccine vector comprising placing at least one exogenous or foreign ant1gen gene ~mder the control of the promoter region from the 5' conserved region of pMGA gene and optionally placing said foreign gene adjacent the nucleotide sequence encoding a leader sequence from the 5' conserved region of pMGA in an mycoplasma strain such that foreign antigens expressed are located at the cell membrane of said mycoplasma strain. Preferably the mycoplasma is an attenuated strain.
Construction of the multivalent mycoplasma live vaccine vector may be facilitated by sequences 1 and 2 described in a further aspect of the invention.Sequences I and 2 may be used to obtain site specific recombination, or homologous recombination for insertion into mycoplasma genome.
Accordingly, another aspect of the present invention provides a multivalent livevaccine vector which comprises an attenuated strain of mycoplasma, the genome ofwhich encodes at least one exogenous or foreign antigen under the control of thepromoter region from the 5' conserved nucleotide sequence of the pMGA gene and optionally the nucleotide sequence encoding the leader sequence from the 5' conserved nucleotide sequence of the pMGA gene is placed adjacent to said -foreign antigen gene 30 to enable attachrnent of said foreign antigen to the cell membrane of said vector. The terrn "genome" used her in refers to the complete complement of genetic information contained in, f`or exarnple, the rnycoplasma cell including extra-chromosomal elements.
941 107,p:\oper\jmw,208~9.Can,7 Where the mycoplasma live vaccille is constructed for use in poultry preferred exogenous or foreign genes which rnay be coupled to the promoter region and/or the nucleotide sequence encoding the signal sequence of the present invention include antigens from the aetiological agents ca~lsing infectious bronchitis, infectious bursal disease, avian influenza, avian encephalomyelitis, chicken anaemia agent and infectious laryngotracheitis. In addition antigens including those from Esc~erichia coli and Newcastle Disease virus can be used as exogenous or foreign genes.
In a most preferred aspect the multivalent vaccine vector is a vaccine for poultry against M. gu/lisepficum and at least one other poultry pathogen including the aetiological agents described above. Most preferably the vaccine vector is a vaccine for chickens, turkeys or ducks.
The attenuated mycoplasma strain used in production of the multivalent live vaccine vector may be newly constructed or may be one that is comrnercially available such as the M. gallisepticum attenuated strains ts-11 (Whithear et al, 1990) or Intervet lS 6/85 (Evans & Hafez, 1992).
In the case of poultry vaccine vector described above, the advantage is that thebird infected with the live vaccine vector has life long protection since the M.galliseptic~m colonises the bird to produce a persistent infection. Hence the bird has ongoing exposure to the relevant antigens which keeps circulating antibody levels high.
The vaccine of the present invention may be administered in ~my convenient rnanner. In the case of the live vaccine of the invention described above it may be adrministered by eye-drop, spraying, in drinking water or any other convenient way. Eye-drop administration is prefelTed since the extra costs involved in handling the birds are outweighed by the benefits of obtaining protection against a number of pathogens from 2~ the one administration.
Accordingly, in another aspect the present invention relates to a vaccinc composition comprising the multivalent live vaccine vector of the invention together with a pharmaceutically or veterinarily acceptable calTier, diluent or excipient. The appropriate acceptable calTiers, diluents or excipients will be well known to those skilled in the art.
In a ~Irther aspect the present invention relates to a method of vaccinating an animal against mycoplasma infection ancl at least one other aetiological agent said 9~1 107,p:\oper~jm~,20889.Cnn,8 method comprising administering an effective amount of the multivalent live vaccine vector of the present invention to said animal. The effective amount is sufficient to stimulate an immunoprotective response in the animal. Preferably said method relates to a method for vaccinating poultry, more preferably chickens, turkeys or ducks against 5 mycoplasma infection, most preferably against M. gallisepticum infection.
In a particularly preferred embodiment of the live multivalent vaccine vector described above the foreign antigen is inserted into an antigenic gene which is shared with wild type M. gallisepticum so that the gene is inactivated to enable serological tests to be conducted to deterrnine whether the bird is infected with live vaccine or a wild-10 type M. gallisepticum strain.
Accordingly, in another aspect the present invention provides a method of deterrnining whether a bird is infected with the live vaccine vector of the present invention or with wild-type mycoplasma, wherein said live vaccine vector has undergone inacti~ation of expression of a gene which it shares with a corresponding wild-type 15 mycoplasma and wherein a detection means is used to detect expression of said gene.
Preferably the gene inactivated encodes an antigen inessential to the functioning of the live vector. More preferably the gene inactivated is the p45 gene. Various detection means may be used such as those described in the Examples or throughout the specification.
In another aspect of the present invention contemplates a detection system for mycoplasma, including detection of different strains within a species, which method cornprises contacting a sample suspected of containing said mycoplasma with at least one nucleotide probe under appropriate hybridisation conditions to stably hybridise the probe to a genetic sequence from said mycoplasma and then detecting hybridisiation.
25 In a preferred embodiment, the invention is directed to a method for detecting M.
gallisepticum or different strains thereof. The present invention is especially useful for detecting mycoplasma infection in poultry.
In addition, the invention provides in another aspect polypeptides or fragments thereof encoded by the probes (or nucleotide sequences encodLng the probes) and 30 antibodies specific therefor.
The invention also provides a kit for detection of mycoplasma comprising nucleotide probes together with appropriate reagents and buffers.
941 107,p:\oper\jmw,20889.CDn,9 ~ ' ~ ' '; ' ' ' ' " ' ~ ' ' `' ;' .' ` ,-,~, ,.,~,~,1 , Preferred nucleotide probes of the present invention include the following polynucleotide sequence referred hereinafter as "sequence 1":
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGWAGAAGAA
CiAAGAAGTTCTTAGGAGTTCKGGGGTTTDSGKY'rGGTYT
S &ATCDGMGAAAATWAASBCGATTTATTMCATWAYTGAAC
TTTATATATTCTTTARWYAATAATAGACGTGKTKAACGT
AAGTTATTGRCTTAAYTTTAAGTGAARARAAAAAACATW
TTAAAGIITTGTTAGTTTATTAGGTATTGGTTCGTTTGTA
ATGTl RGCWGCWGCTAGTTGT
10 or a fragment (preferably comprising 7 or more nucleotides) which hybridises specifically therewith or nucleotide sequence homologues, analogues, mutants, variants cmd derivatives thereof which includes an anti-sense sequences, sequences with base substitutions, additions and/or deletions which are hybridisable under low, prei`erably medium and most pre~erably high stringency conditions to s ~id sequence I wherein K
15 denotes G or T, M denotes A or C, R denotes A or G, Y denotes C or T, W denotes A
or T, S denotes G or C. The term "homologues, analogues, mutants, variants and derivatives" has the sarne meaning as described above. Seqllence 1 described above includes the promoter regions and nucleotide sequence encoding the leader sequence described above. In a preferred aspect the invention relates to clones designated 0.5 kb, 20 0.95 kb, 1.2 kb, 1.4 kb and 5.0 kb described herein.
The invention also comprises another polynucleotide sequence hereina-fter called"sequence 2" which comprises the repeated base sequence "5' (GAA)n 3' " where n is between 2 and 30 preferably 4 to 13, or a nucleotide sequence homologues, analogues, mutants, variants md derivatives 25 thereof which includes cul anti-sense sequence, sequences w~th base substitutions, additions cmd/or deletions, homologues, analogues, mutants, variants and derivatives thereof or a hybridisable fragment thereof which is hybridisable under low, preferably medium and most preferably high stringency conditions (2) to said sequence 2.
The nucleotide sequences of the present invention may comprise a plurality of 30 nucleotides, including oligonucleotides and various forms of nucleotide molecules. The term "nucleotide", for purposes of the invention, encompasses a nucleotide sequence comprised of one or both of 2-deoxyribose and ribose nucle;c acids. It also includes the 941 107,p:\oper\jmw,20889.Can,10 ~-~S`f~
vc-arious purine and pyrimidine bases that can be interchanged. The chains may be circularized or linear. They may also be single or double stranded.
The nucleotide sequence or probe will comprise at least one single stranded basesequence substantially complernentary to or homologous with the sequence to be S detected. However, such base sequence need not be a single continuous nucleotide segment, but can be comprised of a fragment that will stably hybridise to the target sequence (including mismatches). When using nucleotides as probes, hybridisationconditions need to be controlled for successful detection of the target conserved genomic sequence(s).
The homologous region of the probe can be flanked at the 3' - and 5' - terrnini by nonhomologous sequenees, such as those comprising the DNA or RNA of a vector into which the homologous sequenee has been inserted for propagation. In either instance, the probe as presented as an analytical reagent will exhibit detectable hybrid;sation at one or more points with sample nueleic acids of interest. Linear or 15 circular single stranded polynucleotides can be used as the probe element, with major or minor portions being duplexed with a complementary polynucleotide strand or strands, provided that the critical homologous sequence or sequenee fragments are in single stranded form and available for hybridisation with sc~nple DNA or RNA.
Praetiee of the analytical methods of the present invention is not limited to any 20 partieular hybridisation format. Any conventional hybridisation technique can be used.
As improvements are made and as concephlally new formats are developed, such can be readily applied to earrying out the present compositions and methods. Conventional hybridisation forms whieh are partieularly useful inelude those wherein the sample nueleie aeid or the polynueleotide probe is immobilised on a solid support (solid-phase 25 hybridisation) and those wherein the polynucleotide species are all in solutions (solution hybridisation). E~ybridisation of the probes to the target nueleie acids may be aecomplished by Southern, dot or slot blotting techniques, or other well-known hybridisation teehnique.
The invention also ineludes fragments of sequenees 1 or 2 that are eapable of 30 stably hybridising with the target sequences as previously described. The terln "stably hybridisable fragments thereof" means any ~ragments of the claimed sequenees that may stably hybridise to the eons~rved sequence of the instant invention (and includes 941 107,p:\oper\jmw,20889.CDn,l I
mismatches). As is known to those of ordinary skill, the shorter the polynucleotide probe, the more strin~ent the hybridisation conditions must be. Greater stringency requires that the hybridisation occur under higher temperatures, closer to the melting point (Tn~) of the hybrid. A convenient method of calculating the Tm for probe lengths 5 of from 14 to as high as 60-70 bases is described in Sambrook, et al (2). The following equiation estimates the Tm for short polynucleotide probes:
Tm = 81.5 ~ 16.6(1Ogl0~Na+]) -~ 0.41(% G + C) - (600/N), where N = chain length.
This equation will enable one of ordinary skill to calculate the Tm for any length 10 fragment of sequences 1 or 2, and adjust the hybridisation conditions to find the optimurn temperature for hybridisation. Other -factors that contribute to the stringency of hybridisiation include the G/C content, md the salt concentration.
The stringency conditions may be low, preferably medium and more preferably high stringency conditions. The level of stringency is well-known by skilled persons and 15 is generally described as by Siambrook et al, Molecular Cloning: A Laboratory Manual.
Cold Spring Hlrbour Laboratory, Cold Spring Harbour, New York, USA., pp.387-389 where the washing step at paragraph 11 is considered high stringency.
The nucleotide probes of the present invention hybridise to conserved homologous regions adjacent to the pMGA gene in several different strains and species 20 of mycoplasma. The pMGA gene and variants thereof are thought to occur in a number of pathogenic mycoplasma including M. pneumoniae, M. gallisepticum, and M.
genitalium, given the close phylogenetic relationship between these organisms. Given the central role this gene plays in immune evasion it may be common to many different mycoplasmas. In a particularly important aspect the sequences of the instant invent;on 25 can be used to differentiate between strains of mycoplasma such as for example between M. gallisepfic~m and M. synoviae, M. pullorum and M. gallinclrum.
Essentially iany nucleic acid hybridisation format c~ be followed for the purposes of the presient invention in which either the hybrids formed between the probe and the sequence to be deterrnined or the probe which has not hybridised with the 30 sequence of interest are capable of being labelled with a selected label. As is l~lown in the art, the labeling of such hybrids or unhybridised probe can be accomplishesl before or after the actual hybridisation reaction. Normally, the probe is either labeled or 941107,p:\opcr~jmv~,20889.Cnn,12 labelable through a specific binding reaction or the formed hybrids are subsequently labeled, usually through a specific binding reaction.
The probe can be directly labeled in such a way that the hybrid itself is directly detectable. Thes~ methods are well known, and include radiolabeling, chemiluminescent labeling, iluorometric labeling, chromophoric labeling, and labeled antibody binding.
Detection can be achieved by directly labeling the probe with a ligand as, for example, biotin which specifically binds to the protein streptavidin, and that protein can be a carrier for a chemiluminescent reaction component, as for example streptavidin linked covalently to alkaline phosphatase or horseraclish peroxidase. All of these methods ar~
well-known to one of ordinary skill in the art, and render the polynucleotide detectably labeled.
Direct radiolabeling of the probes of the present invention is possible by attaching radioactive isotopes such as 32p to the phosphate groups of the phosphate-sugar backbone of the probe molf cule. Those of ordinary skill in the art will appreciate that labelling with other radioactive labels such as 3H, or l25I or 35S iS aIso possible. Once the probes are labeled radioactively, detection is accomplished by exposure to X-ray sensitive photographic film. Subsequent development of the film will enable one to visually detect the presence or absence of hybridisation. These methods are well-known to those of ordinary skill in the art. See Sambrook, et al., (2).
Erlzyme-linked immunoassay is another technique useful for labeling the polynucleotide probes of the present invention. The antibody reagent used in thepre~erred embodiments of the present invention is principally characterised by its ability to bind to the hybrids formed between the probe and complementary sample nucleicacids through binding of the detectably labeled polynucleotide. The antibody reagent can consist of whole antibodies, antibody fragments, polyfunctional antibody aggreg~es, monoclonal antibodies, single-chain antigen-binding molecules, or in general anysubstance comprising one or more spes~ific binding sites -from an anti-hybrid antibody.
When in the form of whole antibody, it can belong to any of the classes and subclasses of known immunoglobulins, e.g., IgG, IgM, and so forth. Any fragment of any such30 antibody which retains specific binding affinity for the hybridised probe can also be employed, for instance, the -fragments of IgG conventionally known as Fab, F(ab'), and F(ab')2. In addition, aggregates, polymers, derivatives and conjugates of 9~1 107,p:\oper\jmw,20889.C~m,13 immunoglobulins or their fragments can be used where appropriate.
The immunoglobulin source for the antibody reagent can be obtained in any available manner such as conventional antiserurn, monoclonal antibody techniques, and recombinant genetic engineering of single-chain antigen-binding molecules. Antiserum S can be obtained by well-established techniqwes involving immunisation of an animal, such as a mouse, rabbit, guinea pig, sheep or goat, with all appropriate immunogen. The immunoglobulins can also be obtained by somatic cell hybridisation techniques, such resulting in what are cornmonly referred to as monoclonal antibodies, also involving the use of an appropriate immunogen. Single-chain antigens are recombinantly engineered by insertion of a DNA segment cocling for a linker polypeptide into a plasmid such that the linker will be expressed linking the two antigen-binding vlriable domains.
When the antibody reagent is used to detect hybrids, it will usually be labeled with an enzyme such as alkaline phosphatase, horseradish peroxidase, or ~-galactosidase, attached by suitable synthetic mecms. Alternatively, the antibody reagent can be detected based on a native property such as its own antigenicity. Further, antibody can be detected by complement fixation or the use of labeled protein A, as well as other techniques known in the ar1i for detecting antibodies.
In a preferred embodiment the antibody reagent is labeled. The labeling moiety and the antibody reagent are associated or linked to one another by direct chemical linkage such as involving covalent bonds, or by indirect linkage such as by incorporation of the label in a microcapsule or liposome which is in turn linked to the antibody.
Labeling techniques are well-known in the art and any convenient method can be used in the present in~ention. Where the sample of mycoplasma is limited PCR amplification may be employed before hybridisation is carried out (3).
One of ordinary skill will appreciate that other enzymes may be coupled to the bound antibodies for purposes of detection, including horseradish peroxidase, and corresponding color-developing reagentis applied. Specifically, the chemiluminescent reagent "LUMI-PHOS 530(~"1 LuminGen, Inc., Detroit~ Michigan, allows the detection of hybrids on conventional X-ray ~llm. ~Iternatively, antidigoxigenin conjugates that 30 would be suggested to one of ordinary sk;ll include the fluoresces anti-digoxigenin-rhodarnine, and ~mti-digoxigenin-fluorescein; and for electron microscopy anti-digoxigenin-(second antibody conjugated to gold).
941 107.p:10pcr\jmw,20889.C~n.14 The use of chromophoric labels can be detected by sight or by conventional means, such as by a light microscope. Recordation is by conventional color microphotography. Fluorescent or chemiluminescent labels emit light that may be detected by sight or by photomultiplier type. Gold-conjugated labeling is used in S electron microscopy to detect hybridisation and to image the larger rnorphological features of the iniFected cell. Radiolabeled probes may be exposed to X-ray sensitive film.
In the present invention certain aspects of the detectably labeled nucleotide probe may be immunogenic. For instance, a diL,oxigenin-dUTP spacer arm is recognizable by 10 anti-digoxigenin antibodies or fragments thereoi~. Thus, -for purposes of this invention and in this context, the digoxigenin-dUTP moiety is an antigen. Similarly, in certain situations the dNTP tail can be an antigen. It is well-known that antibodies that are raised in an appropriately stimulated host will produce antibodies specific for epitopes of the antigen. The dNTP tail may present sufficient size to present epitopes 15 recognizable iby antibodies, and thus offer another method of labeling the hybrid.
The hybridisation mixture of the present invention includes a sample containing or suspected of containing mycoplasma DNA or RNA sequences, a hybridisation buffer, and a detectably labeled probe having the sequence of either one of, or both of,sequences l or 2. More speci~lcally the sample may be a tissue sample or other 20 biological sample from any area that may harbor mycoplasma.
The hybridisa~ion buffer of the present invention may comprise any buffer solution that enables binding of the polynucleotide probes to ~e target sequences. There are many variations of such buffers. Variables -that should be considered when selecting an appropriate buffer are solvent and temperature, volume of solvent and length of 25 hybridisation time, degree and method of agitation, use of pre-hybridisation solution, blocking agents (to block attachment of probes to non-specific surfaces), concentration of probe and its specific activity, use of PEG or Dextran sul-fate to increase effective concentration of probes in solution, and the stringency of washing following hybridisation. Various guidelines are available in the public domain for the construction 30 of hybridisation solutions. See~ (2).
A preferred method of detecting mycoplasma comprises contacting a sample with a detectably labeled probe, or a stably hybridisable fragment thereo-f, comprising any one 941 107,p:\opcr\jmw,20889.CDn,15 of sequences 1 or 2 or with a mixture of both under appropriate hybridisation conditions to stably hybridise the probe or probes fragments to the sample, and subsequently detecting the label. The label may be incorporated directly into the unique sequences of this invention, or labeling may occur post-hybridisation, both methods being outlined in greater detail elsewhere in this specification. The type of label is also not limiting, and many types of labels are discussed herein.
The sample is preferably derived from a swab taken from an animal. The animal can ~e swabbed at the appropriate place where mycoplasma may be present such as the nasal area or respiratory tract.
The present invention also relates to use of the sequences 1 and/or 2 described herein as primers in PCR in order ~o amplify pMC~A genes or genes related thereto.
This is particularly useful where a sarnple suspected of containing mycoplasma contains insufficient genetic information to malce a deterrnination by direct hybridisation. PCR
arnplification can be used to amplify any pMGA genes, or genes related therelo in the 1 5 sarnple.
PCR is based on the armealing and extension of two oligonucleotide primers that flanlc the target region. The primers are annealed to the separated strands and are extended along the template strand by DNA polymerase. Redundancy in the genetic code means that sequences suf~1ciently related for the primers to hybridise to, will also 20 be ampli-fied. Hence the polynucleotide sequences of the instant invention can be used to arnplify a variety of pMC~A genes and related genes. This invention also includes use of sequences 1 and/or 2 as primers in PCR techniques which represent advancements over present PCR techniques (3).
The present invention also includes a kit, which contains all the necessary 25 elements to carry out the assays contemplated herein. Specifically, the kit contains, in close confinement, at least two containers which comprise a first container comprising any one of sequences 1 or 2 or polypeptides encoded thereby or a rnixture thereof, and a second container comprising one or more reagents capable of indicating the presence of the polynucleotides or polypeptides. The kit may also contain reagents for PCR
30 amplification of pMGA genes and genes related thereto, such as DNA polymerase, pre~erably Taq l~NA polymerase or other therrnostable polymerase and appropriatebuffers.
941 107,p:\opor\jmw,20889.Can,16 In detail, a compartmentalised kit includes any kit in which reagents are contained in separate containers. These containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow one to efficiently transfer reagents from one cs)mpartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of the container can be added in a quan-titative fashion from one compartment to another. Such containers will include a container for polynucleotide solutions, or polypeptide or antibody solutions, for radiolabels, for enzymes, fluorochromes or chemiluminescent agents to couple to the antibodies, for color-developing reagents such as X-phosphate/NBT, and containers for phosphate buffered saline, prehybridisation and hybridisation solutions, and other buffers.
The application of the polymerase chain reaction to mycoplasma identifilcation can be successfully applied to numerous mycoplasma. Although the genome of each mycoplasma is unique, they share interspersed regions of DNA homology, particularly around the pMGA genes.
The invention also relates to polypeptide sequences encoded by the nucleotide sequences of the invention and derivatives and variants thereof and antibodies specific therefor which may be used to identify the presence of the organisms in infectedanimals, c~ll line cultures or to identify a serological response mounted by the host against these organisms.
The nucleotide molecules of the invention or parts thereof can be used to manipulate the mycoplasma genome. These sequences, or parts thereof appear to besignals for site specific recombination in mycoplasma and therefore can be used to insert or delete genes from the genome such as genes responsible for antigenicity and/or pathogenicity to construct strains useful for vaccines and/or improve or modify existing vaccine strains. Positioning these sequences on either side of a cloned gene enables it to be incorporated after transforma~ion into the genome of the mycoplasma at a particular site.
In addition probes based on the nucleotide sequences can be used to clone genes by PCR methods. For example sequences 1 and 2 can be used to amplify across a hemagglutinin gene so that the entire gene may be cloned. Cloning of new hemagglutinin genes is important in the construction of new vaccines.
941 107,p:\op~r\jmw,20889.Cnn,17 S EXAMPLlE I
1. Materials and Methods Bacterial strain~ and culture condl;tiollsO M. gallisepticum strain S6 was grownat 37C in broth medium (4) supplemented with 10% swine serum (5). ~scherichia coli DH5a was grown (with shaking) at 37C in Luria broth (LB) containing 50~g/ml of ampicillin or on LB agar also containing 50,ug/ml of ampicillin.
Isolation of Mycoplasnna DNA. Mycoplasma cells were grown till late log phase and harvested by cen~ gation (20,000 x g for 30 min). The cells were resuspended in 0.1 M phosphate buf~er pH 7.4 containing 0.33 M NaCl and spun at 20,000 x g for 20 min. This step was repeated once more. The pellet was resuspended in 10 mM Tris, pH 8.0 (HCl) containing 10 mM EDTA, 10 mM NaCI and the cells Iysed by the addition OI SDS (25%, .02 volumes~. To ~e Iysate 100 ~lg/ml of proteinase K (Boehringer Mannheim) was added and incubated at 37C overnight. Tothe solution 1 ,ug/ml of RNAse A (Sigma) was added and incubated at 37C for a further 30 min. The mixture was extracted with an equal volume of phenol equilibrated with 0.1 M Tris pH 8.0, once with phenol-chloroform (1:1) and once with chloroform-isoamyl alcohol (24:1). Sodium acetate (2.5 M, 0.1 volumes) was added to the solution and the DNA precipitated with ethanol.
Enzymatic digest of pMGA. Approximately 1 mg of pMGA was affinity purified using a monoclonal antibody affimily column as described previously (6). The material was first dialysed against 1 mM ammonia to remove salt and then subjected to reduction and carboxamidomethylation with iodoacetamide. Digestions were conducted 30 using cyanogen bromide or, in separate experiments with the enymes trypsin (Worthington) or endoproteinase-glu-c ~Boehringer Mannheim). For CNBr digestions, pMGA samples (100-1000 ~lg) were dissolved in 70% (vol/vol) formic acid containing 9~11 107.p:\op~r\jmw,20889.Cf~n, 18 25 mg/ml CNBr (Merck). Digests were incubated for 16-20 h and volatile reagents removed by vacuum centrii~ugation. Enzyme digestions were conducted at an E:S ratio of 5 95 (w/w) and a ~mal protein cs)ncentration of 1 mg/ml using NH4HCO3 as digestion buffer.
Peptide isolation a~d purification. CNBr digests were subjected to SDS-PAGE
using a tricine buffer system to facilitate -the resolution of low molecular weight fragments (7). The gels were subjected to electrophoretic transfer to polyvinyldifluoride membranes (Millipore), stained with Coomassie brilliant blue and peptide zones were 10 excised ~or protein sequence analysis.
Digests with proteolytic enzymes were subjected to reversed phase HPLC
essentially as described previously ($~. Briefly, each digest was chromatographed using a C18 column (Pharmacia, Pep RPC) and elution of peptide i~ractions monitored byabsorbance at 214 mn: fractions were collected manually, rotary evaporated to dryness 15 and appropriate samples rechromatographed on the same column. The initial -fractionation was conducted using 10 m~f -formic acid pH 40 (NaOH) as a buffer and the secondary fractionation was conducted using unbuffered 0.1% (v/v) trifluoracetic acid (Applied Biosystems Inc., ABI). Linear acetonitrile gradients were used to elute peptides (0-90% acetonitlile, delivered at 1 ml/min over 90 min). P~lrified peptides were 2() then sequenced.
E~mall degradation. The automated ~dman degradation was performed using an ABI model 471A protein sequencer equipped with a Brownlee Laboratories microgradiene delivery to conduct chromatographic identification of PTH amino acids.
'~S
Preparation of synthetic oligonucleotide probes. The nucleotide sequence predicted for pPpticles T3 and C7 were used in constructing 23 and 20 mer degenerated oligonucleotides respectively. The result~mt oligonucleotides were produced on a PCR
MATE (ABI), cleaved from the solid support and purified by passage over an OPC ~ i 30 column (ABI).
Conxtluctioll of Mycopl.lsma gell~3mic lDNA Lilbr~ry. .1~co Rl ~Boehringer 9~11107,p:\ope~\jmw,20889.Cnn,19 Mannheim) restricted genomic mycoplasma DNA i~ragments were cloned into Eco Rl cut pUC18 vector. Recombinant plasmids were transformed into E. coli DH5u cells according to methods as described in Sarnbrook et al (2).
S Screening of recombinant library. Screening of the recombinant library for probe reactive DNA was conducted using standard techniques detailed by Sambrook et al (2). Briefly, duplica$e lii~ts using Hybond-~ (Amersham) membranes were made of recombinant ~. coli colonies grown on agar. Membranes were incubated in prehybridisation buffer containing 6x SSPE (20x SSPE is SM NaCI, lM
NaOrthophosphate and 0.2M EDTA), 0.5% SDS, 0.2% non-~at skim milk powder, lx Denhardt solution and 100 ~g/ml of single stranded salmon sperm (Sigma) DNA at 42C
for 4 h. Oligonucleotide probes were 5'-labeled with (y-32P)ATP (Amersharn) utilising Boehringer Mannheim polynucleotide kinase, ullincoryorated label was removed using a G-50 (Pharmacia) spin column as described in Sambrook et al (2). Labeled oligonucleotide probes were allowed to hybridise with individual membranes at 42C
overnight. The membranes were washed t;wice in 6x SSPE containing 0.5% SDS for 10 min each at 60C. The membranes were blotted dry then exposed to XAR-5 film (Eastman Kodak) ~md developed.
Southern blot hybridisation. Genomic DNA of M. gallisepticum strain S6 was digested to completion w;th I~NA restriction enzymes ~Iind III (Pharmacia) and Eco Rl (Pharmacia). The digested DNA together with 32P-labeled ~ DNA markers (Bresa) were subjected to electrophoresis in 0.7% agar gel and blotted onto Hybond-N membranes as described before. E3[ybridisation of oligonucleotide probes to membranes was carried out using the same conditions as described previously. Mycoplasma DNA used for hybridisation was purified using methods as described below except the Prey A-Gene (Boehringer M~nheim) purified clone insert was random prime radiolabeled (Amersham) following the manufacturers instructions. The radioactively lc~eled clone inserts were hybridised to individual membranes overnight at 55C and the rnembranes finally washed in 0.1x SSPE with 0.5% SDS for l0 min each at 66C. Subsequently M. gallisepticum strain S6 genomic DNA uras digested with Eco Rl, Hino III, Cla I, Sac I, Sal I, and BglI and pairs of these enzymes and probed with cloned fragments of 941 107,p:\opcr\jmw,2088g.Cnn,20 mycoplasma DNA under similar conditions to determine the extent of the repeated gene family.
Subcloning of myc~plasma ~or DNA sequencimg. Recombinant clones reactive 5 to both oligonucleotide probes were isolated and grown in LB broth at 37C ovemight with shaking. Plasmid DNA was extracted using the method of Sambrook et al (2) and a limited restriction map of the recombinant DNA ascertained. The DNA insert wasdigested by an appropriate DNA restriction enzyme, subjected to electrophoresis and the resultant fragments isolated from the gel. The excised fragments were purified using 10 Prep-A-Gene (Boehringer Mannlleim) as per manufacturers instructions, cloned into suitable digested pUC18 and used to transform E. coli DHSa cells. Cells were plated on Luria agar containing the chromagen S -bromo-4-chloro-3 -indoyl- ~-D-glucopyranoside (X-gal:Boehringer Mannheim). White colored colonies carrying the correct recombinant DNA insert were grown overnight in LB broth (as described before), the plasmid DNA
15 was harvested and purif;ed using Prep-A-Gene for subsequent DNA sequencing.
DNA ~equencing. The nucleotide sequence of the cloned DNA fragments was determined by the dideodxy-chain termination method using T7 DNA polymerase (Prornega) following the manufacturers instructions. The majority of the sequencing was 20 done by utilising synthetic oligonucleotide primers complimentary to regions 5' and 3' of the inserted DNA of pUC 18.
Synthetic oligonucleotide based on complimentary regions of previously sequenced DNA were used as primers to initiate and extend DNA sequencing.
Subsequently progressive unidirectional deletion of cloned fragments were generated 25 using exonuclease III to specifically digest DNA from 5' protruding or blunt end (10).
~he collection of unidirectional deletions were then sequenced as described above.
Computer analysis of the clones ~r;~gments. The DNA sequence was analyzed using the University of Wisconsin genetics computer group DNA programs package.
30 The amino acid sequence was analyzed using FASTA program using the algorithms of Pearson and Lipman (9). Multiple alignments of genes were conducted using the Clustal V progra~n (10).
941 107,p:\oper\jmw,20889.C~n,21 2) Result~
Partial ami~o acid analysis of pM[GA. The pMGA protein was purified using monoclonal antibody affinity chromatography and samples subjected to proteol~tic and chemical digestion.
Clonillg of a gene encoding a numbcr oî pMGA peptides. Synthetic oligonucleotides of 23 and 20 nucleotides in length were designed: their nucleotide sequences based on the amino acid sequence of trypic peptides T3 and C7 (Fig. 1).
Both oligonucleotides were radiolabeled and hybridised to Eco R1 cut genomic DNA10 of M. gallisepticl~m in sou~hern iransfer. Figure 2 show that the 23 mer (Lane 2 panel A) and 20 mer (I,anc 2 panel B) probes hybridised to 10, 8, 6 and 10, 6 kb bandsrespectively in southern transfer. A genomic library of EcoR1 cut M. gallisepticum DNA was constructed in pUC 18 and recombinant colonies were screened for their ability to hybridise to both radiolabeled oligonucleotide probes A and B. One doubly 15 reactive clone was isolated and found to contain a 10 kb insert of mycoplasma DNA
reactive with both oligonucleotide probes (Fig. 2, Lane 1 of Panels A and B). The DNA
insert was subjected to cleavage using a limited nurnber of restriction enzymes and a restriction map was deduced. Three separate fragments were subcloned into pUC 18 and designated a, b and c. The clones were subjected to DNA sequencing and where 20 necessary, oligonucleotide primers were prepared to continue DNA sequencing.
Nucleotide ailld amino acid sequences. The partial DNA sequence of the 10 kb insert and the respective amino acid sequence are presented in Fig. 3. The DNA
sequence is divided into two putative genes, pMGA1.2 and pMGA1.3 respectively. The 25 proposed PMGAI.2 gene begins at nucleotide position 109 with the start codon GTG
and ends at the position 2050 with the stop codon TAG. A 16 amino acid sequence (Beginning nt position 184) of pMGA1.2 has 87.5% homology (using the LFASTA
program (9)) to the arnino-terrninal sequence of pMGA (the plasma membrane protein expressed by cultured M. galliseptic2~m cells). The pMGAI.2 gene would encode a 30 precursor protein of 647 arnino acids (70.257 kDa) including a signal peptide of 25 amino acids. The start codon beginning nucleotide position 109 is followed by 3 basic residues then a stretch of 21 amino acids primarily hy~rophobic in na~re. The mature 941 107,p:\oper\jmw,20889.C~n.22 protein would contain 622 arnino acids with a molecular mass of 67.66 kDa.
Preceding the translational start of pMGA1.2 is a putative promoter region consisting of a -35 region ~nd a -10 region separated by 17 nucleotides (Fig. 3). A
similar region also occurs preceding the predicted translational start of pMGAl.3.
S Between the putative promoter region and the predicted translational start of pMGAl.2 and 1.3, an imperfect palindrome exists (indicated by arrows, Fig.3) with the potential to form a short base paired loop.
The postulated signal peptide sequences of pMGAl.2 and pMGAl.3 are identical except for the conservative replacement of arginine for Iysine at the second arnino acid 10 position of the signal sequence (Fig. 3). Differences in the amino-tenninal sequences are noted (Fig. 3) with pMGA1.2 and pMGAI.3 differing by 3 and 6 arnino acids respectively to pMGA. No sequence homology of any significance was found to any other protein sequence using computer searches of the standard protein data bases.
Subsequently the sequence of the entire lOkb fragment of ~. gallisepticum DNA
15 was deterrnined. Examination of the amino acid sequences deduced to be encoded by this DNA enabled the sequence to be divided into S putative geneis, three of which are encoded in their entirety by this fragment of DNA (designated pMGA1.2, pMGA1.3 and pMGAl.4 respectively) with the 5' end of a fourth gene (designated pMGA1.5) and the 3' end of a fi-fth gene (designated pMGJA1.6) also deduced to be present. Comparison 20 of the amino acid sequence of these genes using the ClustalV program to conduct multiple aligmnents (10) showed the 5 genes to be closely related with about 40% amino acid similarity between the 3 complete genes. The DNA sequence of ~he five genes and the regions between each gene were also compared (Figure 5). Two regions of veryhigh similarity were identified in the noncoding region between each gene and at the 5' 25 end of each gene. Additionally a highly conserved repeated element, consisting of seven or more repeats of the trinucleotide ('JAA were identified within the conserved noncoding region.
Extellt and Orgallis~tion OI Chromosomal Regiolls Encodin~ pMGA-like Genes Two cloned fragments of pMGAl.2 were used as hybridisation probes to establish the extent of the loci encoding genes in the pMGA family. Both fragments hybridised to 941 107,p \opcir\jmw,20889.C~n,23 - 2'1 -mostly the same fragments in restriction endonuclease digests of the genomic DNA of M. galliseptieurn strain S6. These fragments were mapped to two regions on the genome, one of 100 kb and a second of 20 kb, indicating that the genome contains at least a,~ different pMGA genes arranged in tandem.
Comparison of restriction fragments hybridising to the pMGA1.2 gene in three different strains of M. gallisepticum revealed a high degree of interstrain variability1 consistent with high frequency recombination or mutation within this region of the genome.
10 Use of Conser~ed Sequences to D~t~t M, gallisepticum by Polymera~e Chain Reaction Two short sequences separated by 216 bases within the conserved regions of the pMGA
loci were chosen and oligonucleotides synthesised. The sequences of the 15 oligonucleotides were Oligonucleotide 1: GAAGAAGAAGAAGAAGAAGAA&A
Oligonucleotide 2: ACGAACCAATACCTAATAAACTAACAA
20 Samples of DNA extracted from each of four avian mycoplasrna species (M.
gallisepticum, M, synoviae, M. pullorum and M. gallinarum) were added to separa~e tubes with a buffer containing I OmM dA*P, I OmM dTTP, 1 OmM dGTP, 1 OmM dCTP, lOmM KCl 20mM Tris-HCI (pH 8.8 at 25C), lOmM (NH4)2S04, 2mM MgSO4, 0.1%
Triton X-100, lOO,ug bovine serum albumin, 5~1M of each of the oligonucleotides and 25 1 ~mit of Vent DNA Polymerase. The reactions were subjected to 30 temperature cycles of 30 seconds at 94C, 30 seconds at 50C and 20 seconds at 72C. A fragment of DNA of 216 base pairs was amplifiled :from A~: gallisepticum DNA as predicted, and no fragments were amplified from other avian mycoplasmas (Figure 6).
Sequerleing of lOkb lkl. gallisep~icl~m DNA fragment 941 107,p:\0p~r\jmr/,20g89.CIul,24 Subclones based on the lOkb DNA fragment isola~ed in Example I were produced as follows. The 10kb fragment is represented diagrammatically below.
Subc1On~/E~zym~ E E3 P E~ B pMl;A ~5 .. ~==
S
D~signotion ~MG~ i pl1~;AI.~ 1 3 pl'll;~ pMGAlo ~
GAA . GAA ~a~ GP~ 1 kb 10 The diagram above gives details of the gene arrangement determined by sequencing an Eco RI 9719 base pa~r (bp) fragment of M. g{llliscpticum S6 strain genomic DNA
inserted in the plasmid pUC 18. The original clone (Clone 16) was selec~ed based on the plasmid insert being reactive to specific oligonucleotide probes. Subclones were made from the original plJC 18 Clone 16 for DNA sequencing as follows. (Read frorn 15 left to right of tne above diagram).
No Restriction Sites Clone length Lab Designation 1. E-B Eco Rl-Bgl II 382 bp 0.5 kb 2. B-P Bgl II-PstI 950 bp 0.95 kb 3. P-B Bgl lI-Bgl II 1248 bp 1.2 kb 4. B-B Bgl 1I-Bg1 II 14~9 bp 1.4 kb 5. B-E Bgl II-Eco Rl 5619 bp 5.0 kb The 1 st clone did not appear to contain the leader or promoter sequence whereas the 2nd 25 clone contains the leader and promoter sequences for pMGA 1.2. Clone 3 did not appear to contain any promoter or leader sequences whilst Clone 4 contains the leader and promoter sequences for pMGA 1.3. The final or 5th Clone contains the sequences ~or pMGA 1.4 and pMGA 1.5.
E~M[PLE 3 Production of ~ l~ve vaccine USillg the ts-l ll strain o~ ikI. g~lllise~icum 941 108,p:\oper\jn~w,20889,Can,25 The 5' conserved region identi-fied in Example 1 comprises a strong promoter andencodes the signal or leader sequence for pMGA which is responsible for pMGA being directed to the surface of M. gallisepticum and anchored in the membrane.
The 5' conserved region can be used for the expression of genes encoding S protective antigens from other respiratory pathogens such that these antigens appear on the surface of an attenuated M. gallisepticum strain such as ts-11 (Whithear et al ~1990) Aust. Vet.J. 67: 159-165). Genes encoding antigens from respiratory pathogens such as those causing the following conditions could be used: infectious bronchitis, Newcastle Disease, E. coli respiratory infection, infectious laryngotracheitis, turkey rhinopneumonitis, infectious bursal disease, avian inflwenza, avian encephalomyelitis and chicken anaemia agent.
The S' conserved region is spliced from the pMGA gene and ligated to the 5' end of the coding sequence of the required antigen. Most conveniently, the antigen will be one for which there are monoclonal antibodies, or other detection means available, for ready detection of recombinants. The recombinant *agment thus produced is transformed into ts-11 using electroporation and will integrate into the ts-11 genome.
Recombinants expressing the required antigen are detected using monoclonal antibodies or o~er convenient detection means. Recombinants detected in this way are examined for stability of expression.
Development of a specific serological marlcer can be achieved by insertional inactivation of an antigen in ts-11. Specifically the gene for the foreign antigen is inserted into the initial coding region of a deleted version of the gene for a non-essential, antigen common with the wild-type pathogen. This construct is used for insertion of the foreign gene into ts-11 by homologous recombination. Concurrently the gene encoding this deleted Mycoplasrna gallisepticum antigen is cloned and expressed in E. coli, f enabling a highly specific ELISA or l~atex agglutination test to be developed.
Thus ts-11 (engineered) vaccinated birds would test positive for pMGA, bu~
negative for the deleted antigen, while wild type exposed birds would test positive for both antigens. Use of these assays would retain the ability to maintain and confirm a wild type ll~coplusma gallisepticum-free status in conjunction with use of a ts-11 vector vaccme.
941 108,p:\oper\jmw,20889.C~n,26 I`he publications referred to at the end of the specification are herein incorporated by reference.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is S to be lmderstood that the invention includes all such variations and modifications which fall within its spirit and scope. The invention also includes all the steps, i~eatures, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
94 1 107,p:\oper\jmw,20889.Chn,27 - 2~ -1. Suggs, S.V., Wallace R.B., Hirose T., Kawashima E.H. and Itakura K. (1981) Use of synthetic oligonucleotide as hybridisation probes: Isolation of cloned cDNA sequences from hurnan ,B-microglobulin Proc.Natl.Acad.Sci 78: 6613 2. Sambrook et al. Conditions for Hybridisation of Polynucleotide Probes, in Molecular Cloning-A Lab Manual, 2d ed., p. 11.46, Cold Spring Harbor Press (1989).
3. Erhlich, H.A., Gelfand, D. and Sninsky J.T. ~1991) Recent advances in the Polymerase chain reaction, Science 252: 1643-1656 4. Frey, M.L., R.P. Hanson, and D.P. Anderson. 1968. A medium for the isolation of avian Mycoplasmas. Am. J. Vet.Res., 29: p. 2163-2171.
5. Whithear, K.G., D.D. Bowtell, E. Ghiocas, and K.L. Hughes. 1983. Evaluation and use of a micro broth dilution procedure for testing sensitivity of fermentative avian mycoplasmas to antibiotics. Avian Dis, 27: p. 937-949.
There is a need, therefore, to develop effective vaccines for a variety of diseases 5 such as mycoplasma infection in animals including poultry and to develop a rapid method for assessing mycoplasrna infections.
SUMMARY OF INVENTION
The present inventors have discovered that there are regions of conserved nucleotide sequences adjacent to the M. gallisepticum adhesin (pMGA) gene complex.
The pMGA gene encodes a 67 kDa hemagglutinin from M. gallisepticum. The pMGA
gene complex is a group of 40 or so contiguous genes linked end to end. The conserved nucleotide sequence occurs at the beginning and/or end of these genes. Furthermore the 1~ inventors have recognised that the conserved nucleotide sequence contains repeated sequences consisting of direct repeats of the nucleotide triplet &AA. The conserved sequence at the 5' end of ~e pMGA gene is of particular interest since this sequence encodes a strong promoter and leader sequence which enables pMGA to be extruded through the cell membrane to the surface of the cell.
Accordingly, a first aspect of the present invention relates $o an isolated nucleotide sequence comprising a promoter region derivable from the S' conservedsequence of M. gallisepticum mentioned above.
In a further aspect the invention relates to a method of producing a multivalentmycoplasma live vaccine vector, said method comprising placing at least one foreign antigen gene under the control of a promoter region derivable from a 5' conserved sequence of 1l~. gallisepticum, or a functional part, homologue, analogue, mutan~, variant or derivative thereof, in a mycoplasma strain and obtaining expression of said foreign antigen gene.
In a still fur~er aspect the invention relates to a multivalent live vaccine vector 30 which comprises an attenuated mycoplasma strain, the genome of which encodes at least one foreign antigen under the control of the promoter regicn derivable -from a 5' conserved region of the pMGA gene, wherein native mycoplasma antigens and at least 941107,p:\op/ r\jmw,20889.Can,2 '. '~' one foreign antigen are expressed.
In yet a further aspect the invention relates to a method of vaccinating an animal against mycoplasma infection and at least one other aetiological agent the method comprising adrninistering an effective amount of the live vaccine vector according to the 5 invention.
In a yet ~rther aspect the invention relates to a method of determining whether a bird vaccinated with ~he live vaccine vector is infected with the vaccine vector or a wild-type M. gallisepticum wherein the live vaccine vector has a gene for the foreign antigen inserted into an inessential antigen gene in the live vaccine vector, which 10 inessential antigen gene is shared with a corresponding wild-type mycoplasma, the method comprising detec~ing the presence of said inessential antigen or an antibody specific therefor in a sample from the bird.
In a further aspect the invention relates to a detection system for mycoplasma, including detection of different strains within a species, where the detection system is l S a method which comprises contacting a sample suspected of containing mycoplasma with at least one nucleic acid probe specific ~or a mycoplasma under appropriate hybridisation conditions to stably hybridise the probe to a genetic sequence from said mycoplasma and then detecting hybridisation.
In a still ~rther aspect the invention relates to a kit comprising at least tvvo20 containers having a first container comprising at least one oligonucleotide probe according to the invention, and a second container comprising one or more reagents which detect the presence of said probe in a hybridised state.
BRIEF DESCRIPTION OF T~IE DRAWINGS
The present invention is -further described ~,vith reference to the -following non-limiting Figures and Exarnples. In the Figures:
Figure 1: PMGA-specific oligonucleotides: the oligonucleotides probes A and B
were assembled from amino acid analysis of peptides T3 and C7 respectively. The syrnbol N denotes the simultaneous addition of all four - nucleotides at the positions shown.
94 11 07,p:\oper\jmw,20889.Can,3 Figure 2: Reactivity of pM(3A oligonucleotides with M. gallisepticum DNA.
PUC18/pMGA and gf~nomic DNA of M. gallisepticum was digested with Eco Rl and subjected to s~ thern transfer using oligonucleotide probes A and B (Fig. 2A) for detection of complementary sequences. Lane 1 and 2 of both panels are Eco R1 digests of pUC18/pMGA DNA and M.
gallisepticum genomic DNA respectively. Probes A and B presented in Fig. 1 were hybridised to Panels A and B respectively.
Figure 3 :The complete nucleotide sequence of pMGA1.2 and the partial sequenceof pMGA1.3 are shown. The deduced amino acid sequence is shown above the first nucleotide of each codon. The amino acid sequence fi om pMGA is underlined and differences are in parentheses above the corresponding amino acid. The TGA codon for tryptophan in pMGA1.2 is underlined. The proposed promoter regions preceding transcription starts of pMGAl.2 and 1.3 are underlined ~nd labeled -35, -10. The leader sequence runs from the valine codon ~rough to the serine codon just before the start of the sequence encoding ~e mature protein, at the cysteine codon. Stem and loop structures are indicated by arrows found at nueleotide positions 81 and 2374. The restriction enzyme positions used ~or subcloning are in parenthesis -following the enzyrne used: Pstl (177), BglII (1409) and BglII (2803).
Figure 4: Aligmnent of pMGA 1.2, 1.3, 1.4 and 1.5/1.6. Note the GAA repeats vary from S to lS in length.
Figure Sa: Alignment of conserved sequences in pMGA 1.2, 1.3, 1.4 and l.S
Figure Sb: Illustrates a consensus sequence.
Figure 6: Amplification of the conserved sequence by polymerase chain reaction.Lanes 1 and 10 are molecular weight markers lane 2=cloned 10kb fragment, lane 3= M. gallisepticum DNA, l~ne 4--M. pullorum DNA, lane S= M. synoviae DNA, larle 6--M. g~llinarum DNA9 lanes 7, 8 and 9 are negative controls.
D~ESClRlPTION OF PlREF~ERRED EMlBODIMENTS
941107,p:\oper\jmw,20889.C~n.4 ~ ~
- s -In a first aspect the present invention relates to an isolated nucleotide sequence comprising a promotor region derivable *om a 5' conserved region adjacent a pMGAgene of M. gallisepticum. The term "derivable from M. gallisepticum" means that the nucleic acid may be derived from that source but is not limited to being so derived. The nucleic acid sequence may be present in other ~ycoplasma species or may be derived from synthetic sources.
The present invention also extends to an isolated nucleotide sequence comprisinga promoter region in the 5' conserved sequence of M. gallisepticum according to Figures 3, 4, 5a or 5b herein, or functional fragments, homologues, analogues, mutants, variants or derivatives thereof.
The term "promotor region" refers to a nucleic acid sequence capable of promotor activity when placed adjacent an appropriate coding sequence.
The terrn "functional *agments thereof~' used herein refers to a nucleic acid sen.uence which, although smaller than the promotor region described, retains the functional characteristics thereof such as an ability to ~unction as a promotor.The terrn "homologues; analogues, mutants, variants and derivatives" refers to rllcleotide sequences which, while different from the promotor region, retain the functional characteristics thereof. The homologues, analogues, mutants, variants and derivatives rnay be the result of natural or artificial insertion, deletion and/or substitution of the nucleic acid bases when compared to the nucleic acid sequence of the promotor region described herein.
In addition the present invention also provides an isolated nucleotide sequence comprising a leader sequence *om the S' conserved sequence from A~I. gallisepticum mentioned above. The invention also extends to polypeptides and fragments thereof encoded by the leader sequence. The terln "leader sequence" may also include thecleavage signal sequence which is responsible for cleavage of the nascent peptide and possible acylation of the mature protein. The cleavage signal sequence is thought to be the peptide sequence AA~S adjacent to the cysteine, the first amino acid of mature pMGA.
The invent;on also relates to use of the promoter region in the expression of genes and/or the use of the leader sequence in the location of the gene products in a host cell. The promoter region may be usecl to express A~: gallisep~icum genes from 941 107,p:\oper\jmw,20889.Cr~n,5 organisms other than M. gallisepticum. The host cell may be any cell capable of recognising the promoter but is most preferably a mycoplasma, more preferably M
gallisepticum.
The invention further provides a method of manipulating the genome of a S mycoplasma bacterium. Such a method may involve the isolation of genes, insertion or deletion of genes and the alteration of expression of genes. Such manipulation can be used to facilitate the production of vaccines, such as to produce attenuated strains or filrther improve the characteristics of attenuated strains.
Preferred promoter regions of the present invention include the nucleotide sequence commencing at the end of the GAA repeat through to about 100, preferably about 80, still more preferably about 70, still more preferable about 60 and even more preferably about S0 bases downstream of the 5' conserved region described in theFigures 3, 4, ~a and 5b herein; and to functional fragments, homologues, analogues, mutants, variants and derivatives l S thereof.
Preferred nucleotide sequences encoding leader sequences of the present invention include the nucleotide sequence encoding the first amino acid that is transcribed (i.e.
valine or methionine) through to cysteine of the 5' conserved sequence of Figures 3, 4 and 5 herein; and to functional fragments, homologues, analogues, mutants, variants and derivatives thereof. The term "functional fragments" and "homologues, analogues,mutants, vatiants and derivatives" have the same rneaning, when applied to the sequences encoding the leader sequence as described above. The leader sequences occur adjacent to the promoter sequences shown in Figures 3, 4, 5a and Sb. The invention also extends to isolated polypeptides and -fragments thereof encoded by the leader sequence.
The mlcleotide sequences of the present invention may comprise a plurality of nucleotides, including oligonucleotides and various forms of nucleotide molecules. The term "nucleotide", for purposes of the invention, encompasses a nucleotide sequence comprised of one or both of 2~deoxyribose and ribose nucleic acids. It also includes the various purine and pyrimidine bases that can be interchanged. Ihe chains may be 30 circularized or linear. They may also be single or double stranded.
In a particularly preferred ernbodiment of the invention, the promoter region ofthe invention described above is used io express one or more exogenous or foreign genes 94 1 107,p:\ope~\jm~,20889.Cn:l,6 in mycoplasma, preferably M. gallisepticum. Where attachment of the exogenous gene product to the mycoplasma cell membrane is required9 the nucleotide sequence encoding the leader sequence of the present invention described above may be inserted between the promoter and the start of the exogenous gene. Preferably the nucleotide sequence of the leader sequence of the present invention described above is inserted between the promoter and the foreign antigen gene so that the antigen produced is attached to the 3urface of the cell membrane of the host.
Accordingly the present invention, in another aspect, relates to an isolated nucleotide molecule comprising the promoter region of the present invention preferably linked to a gene encoding an exogenous antigen with said nucleotide sequence encoding the leader sequence of the present invention optionally linked to said gene. Thenucleotide molecule may be present on a plasmid or other suitable nucleic acid vector.
A fi~rther aspect the present invention provides a method for constructing a multivalent mycoplasma live vaccine vector comprising placing at least one exogenous or foreign ant1gen gene ~mder the control of the promoter region from the 5' conserved region of pMGA gene and optionally placing said foreign gene adjacent the nucleotide sequence encoding a leader sequence from the 5' conserved region of pMGA in an mycoplasma strain such that foreign antigens expressed are located at the cell membrane of said mycoplasma strain. Preferably the mycoplasma is an attenuated strain.
Construction of the multivalent mycoplasma live vaccine vector may be facilitated by sequences 1 and 2 described in a further aspect of the invention.Sequences I and 2 may be used to obtain site specific recombination, or homologous recombination for insertion into mycoplasma genome.
Accordingly, another aspect of the present invention provides a multivalent livevaccine vector which comprises an attenuated strain of mycoplasma, the genome ofwhich encodes at least one exogenous or foreign antigen under the control of thepromoter region from the 5' conserved nucleotide sequence of the pMGA gene and optionally the nucleotide sequence encoding the leader sequence from the 5' conserved nucleotide sequence of the pMGA gene is placed adjacent to said -foreign antigen gene 30 to enable attachrnent of said foreign antigen to the cell membrane of said vector. The terrn "genome" used her in refers to the complete complement of genetic information contained in, f`or exarnple, the rnycoplasma cell including extra-chromosomal elements.
941 107,p:\oper\jmw,208~9.Can,7 Where the mycoplasma live vaccille is constructed for use in poultry preferred exogenous or foreign genes which rnay be coupled to the promoter region and/or the nucleotide sequence encoding the signal sequence of the present invention include antigens from the aetiological agents ca~lsing infectious bronchitis, infectious bursal disease, avian influenza, avian encephalomyelitis, chicken anaemia agent and infectious laryngotracheitis. In addition antigens including those from Esc~erichia coli and Newcastle Disease virus can be used as exogenous or foreign genes.
In a most preferred aspect the multivalent vaccine vector is a vaccine for poultry against M. gu/lisepficum and at least one other poultry pathogen including the aetiological agents described above. Most preferably the vaccine vector is a vaccine for chickens, turkeys or ducks.
The attenuated mycoplasma strain used in production of the multivalent live vaccine vector may be newly constructed or may be one that is comrnercially available such as the M. gallisepticum attenuated strains ts-11 (Whithear et al, 1990) or Intervet lS 6/85 (Evans & Hafez, 1992).
In the case of poultry vaccine vector described above, the advantage is that thebird infected with the live vaccine vector has life long protection since the M.galliseptic~m colonises the bird to produce a persistent infection. Hence the bird has ongoing exposure to the relevant antigens which keeps circulating antibody levels high.
The vaccine of the present invention may be administered in ~my convenient rnanner. In the case of the live vaccine of the invention described above it may be adrministered by eye-drop, spraying, in drinking water or any other convenient way. Eye-drop administration is prefelTed since the extra costs involved in handling the birds are outweighed by the benefits of obtaining protection against a number of pathogens from 2~ the one administration.
Accordingly, in another aspect the present invention relates to a vaccinc composition comprising the multivalent live vaccine vector of the invention together with a pharmaceutically or veterinarily acceptable calTier, diluent or excipient. The appropriate acceptable calTiers, diluents or excipients will be well known to those skilled in the art.
In a ~Irther aspect the present invention relates to a method of vaccinating an animal against mycoplasma infection ancl at least one other aetiological agent said 9~1 107,p:\oper~jm~,20889.Cnn,8 method comprising administering an effective amount of the multivalent live vaccine vector of the present invention to said animal. The effective amount is sufficient to stimulate an immunoprotective response in the animal. Preferably said method relates to a method for vaccinating poultry, more preferably chickens, turkeys or ducks against 5 mycoplasma infection, most preferably against M. gallisepticum infection.
In a particularly preferred embodiment of the live multivalent vaccine vector described above the foreign antigen is inserted into an antigenic gene which is shared with wild type M. gallisepticum so that the gene is inactivated to enable serological tests to be conducted to deterrnine whether the bird is infected with live vaccine or a wild-10 type M. gallisepticum strain.
Accordingly, in another aspect the present invention provides a method of deterrnining whether a bird is infected with the live vaccine vector of the present invention or with wild-type mycoplasma, wherein said live vaccine vector has undergone inacti~ation of expression of a gene which it shares with a corresponding wild-type 15 mycoplasma and wherein a detection means is used to detect expression of said gene.
Preferably the gene inactivated encodes an antigen inessential to the functioning of the live vector. More preferably the gene inactivated is the p45 gene. Various detection means may be used such as those described in the Examples or throughout the specification.
In another aspect of the present invention contemplates a detection system for mycoplasma, including detection of different strains within a species, which method cornprises contacting a sample suspected of containing said mycoplasma with at least one nucleotide probe under appropriate hybridisation conditions to stably hybridise the probe to a genetic sequence from said mycoplasma and then detecting hybridisiation.
25 In a preferred embodiment, the invention is directed to a method for detecting M.
gallisepticum or different strains thereof. The present invention is especially useful for detecting mycoplasma infection in poultry.
In addition, the invention provides in another aspect polypeptides or fragments thereof encoded by the probes (or nucleotide sequences encodLng the probes) and 30 antibodies specific therefor.
The invention also provides a kit for detection of mycoplasma comprising nucleotide probes together with appropriate reagents and buffers.
941 107,p:\oper\jmw,20889.CDn,9 ~ ' ~ ' '; ' ' ' ' " ' ~ ' ' `' ;' .' ` ,-,~, ,.,~,~,1 , Preferred nucleotide probes of the present invention include the following polynucleotide sequence referred hereinafter as "sequence 1":
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGWAGAAGAA
CiAAGAAGTTCTTAGGAGTTCKGGGGTTTDSGKY'rGGTYT
S &ATCDGMGAAAATWAASBCGATTTATTMCATWAYTGAAC
TTTATATATTCTTTARWYAATAATAGACGTGKTKAACGT
AAGTTATTGRCTTAAYTTTAAGTGAARARAAAAAACATW
TTAAAGIITTGTTAGTTTATTAGGTATTGGTTCGTTTGTA
ATGTl RGCWGCWGCTAGTTGT
10 or a fragment (preferably comprising 7 or more nucleotides) which hybridises specifically therewith or nucleotide sequence homologues, analogues, mutants, variants cmd derivatives thereof which includes an anti-sense sequences, sequences with base substitutions, additions and/or deletions which are hybridisable under low, prei`erably medium and most pre~erably high stringency conditions to s ~id sequence I wherein K
15 denotes G or T, M denotes A or C, R denotes A or G, Y denotes C or T, W denotes A
or T, S denotes G or C. The term "homologues, analogues, mutants, variants and derivatives" has the sarne meaning as described above. Seqllence 1 described above includes the promoter regions and nucleotide sequence encoding the leader sequence described above. In a preferred aspect the invention relates to clones designated 0.5 kb, 20 0.95 kb, 1.2 kb, 1.4 kb and 5.0 kb described herein.
The invention also comprises another polynucleotide sequence hereina-fter called"sequence 2" which comprises the repeated base sequence "5' (GAA)n 3' " where n is between 2 and 30 preferably 4 to 13, or a nucleotide sequence homologues, analogues, mutants, variants md derivatives 25 thereof which includes cul anti-sense sequence, sequences w~th base substitutions, additions cmd/or deletions, homologues, analogues, mutants, variants and derivatives thereof or a hybridisable fragment thereof which is hybridisable under low, preferably medium and most preferably high stringency conditions (2) to said sequence 2.
The nucleotide sequences of the present invention may comprise a plurality of 30 nucleotides, including oligonucleotides and various forms of nucleotide molecules. The term "nucleotide", for purposes of the invention, encompasses a nucleotide sequence comprised of one or both of 2-deoxyribose and ribose nucle;c acids. It also includes the 941 107,p:\oper\jmw,20889.Can,10 ~-~S`f~
vc-arious purine and pyrimidine bases that can be interchanged. The chains may be circularized or linear. They may also be single or double stranded.
The nucleotide sequence or probe will comprise at least one single stranded basesequence substantially complernentary to or homologous with the sequence to be S detected. However, such base sequence need not be a single continuous nucleotide segment, but can be comprised of a fragment that will stably hybridise to the target sequence (including mismatches). When using nucleotides as probes, hybridisationconditions need to be controlled for successful detection of the target conserved genomic sequence(s).
The homologous region of the probe can be flanked at the 3' - and 5' - terrnini by nonhomologous sequenees, such as those comprising the DNA or RNA of a vector into which the homologous sequenee has been inserted for propagation. In either instance, the probe as presented as an analytical reagent will exhibit detectable hybrid;sation at one or more points with sample nueleic acids of interest. Linear or 15 circular single stranded polynucleotides can be used as the probe element, with major or minor portions being duplexed with a complementary polynucleotide strand or strands, provided that the critical homologous sequence or sequenee fragments are in single stranded form and available for hybridisation with sc~nple DNA or RNA.
Praetiee of the analytical methods of the present invention is not limited to any 20 partieular hybridisation format. Any conventional hybridisation technique can be used.
As improvements are made and as concephlally new formats are developed, such can be readily applied to earrying out the present compositions and methods. Conventional hybridisation forms whieh are partieularly useful inelude those wherein the sample nueleie aeid or the polynueleotide probe is immobilised on a solid support (solid-phase 25 hybridisation) and those wherein the polynucleotide species are all in solutions (solution hybridisation). E~ybridisation of the probes to the target nueleie acids may be aecomplished by Southern, dot or slot blotting techniques, or other well-known hybridisation teehnique.
The invention also ineludes fragments of sequenees 1 or 2 that are eapable of 30 stably hybridising with the target sequences as previously described. The terln "stably hybridisable fragments thereof" means any ~ragments of the claimed sequenees that may stably hybridise to the eons~rved sequence of the instant invention (and includes 941 107,p:\oper\jmw,20889.CDn,l I
mismatches). As is known to those of ordinary skill, the shorter the polynucleotide probe, the more strin~ent the hybridisation conditions must be. Greater stringency requires that the hybridisation occur under higher temperatures, closer to the melting point (Tn~) of the hybrid. A convenient method of calculating the Tm for probe lengths 5 of from 14 to as high as 60-70 bases is described in Sambrook, et al (2). The following equiation estimates the Tm for short polynucleotide probes:
Tm = 81.5 ~ 16.6(1Ogl0~Na+]) -~ 0.41(% G + C) - (600/N), where N = chain length.
This equation will enable one of ordinary skill to calculate the Tm for any length 10 fragment of sequences 1 or 2, and adjust the hybridisation conditions to find the optimurn temperature for hybridisation. Other -factors that contribute to the stringency of hybridisiation include the G/C content, md the salt concentration.
The stringency conditions may be low, preferably medium and more preferably high stringency conditions. The level of stringency is well-known by skilled persons and 15 is generally described as by Siambrook et al, Molecular Cloning: A Laboratory Manual.
Cold Spring Hlrbour Laboratory, Cold Spring Harbour, New York, USA., pp.387-389 where the washing step at paragraph 11 is considered high stringency.
The nucleotide probes of the present invention hybridise to conserved homologous regions adjacent to the pMGA gene in several different strains and species 20 of mycoplasma. The pMGA gene and variants thereof are thought to occur in a number of pathogenic mycoplasma including M. pneumoniae, M. gallisepticum, and M.
genitalium, given the close phylogenetic relationship between these organisms. Given the central role this gene plays in immune evasion it may be common to many different mycoplasmas. In a particularly important aspect the sequences of the instant invent;on 25 can be used to differentiate between strains of mycoplasma such as for example between M. gallisepfic~m and M. synoviae, M. pullorum and M. gallinclrum.
Essentially iany nucleic acid hybridisation format c~ be followed for the purposes of the presient invention in which either the hybrids formed between the probe and the sequence to be deterrnined or the probe which has not hybridised with the 30 sequence of interest are capable of being labelled with a selected label. As is l~lown in the art, the labeling of such hybrids or unhybridised probe can be accomplishesl before or after the actual hybridisation reaction. Normally, the probe is either labeled or 941107,p:\opcr~jmv~,20889.Cnn,12 labelable through a specific binding reaction or the formed hybrids are subsequently labeled, usually through a specific binding reaction.
The probe can be directly labeled in such a way that the hybrid itself is directly detectable. Thes~ methods are well known, and include radiolabeling, chemiluminescent labeling, iluorometric labeling, chromophoric labeling, and labeled antibody binding.
Detection can be achieved by directly labeling the probe with a ligand as, for example, biotin which specifically binds to the protein streptavidin, and that protein can be a carrier for a chemiluminescent reaction component, as for example streptavidin linked covalently to alkaline phosphatase or horseraclish peroxidase. All of these methods ar~
well-known to one of ordinary skill in the art, and render the polynucleotide detectably labeled.
Direct radiolabeling of the probes of the present invention is possible by attaching radioactive isotopes such as 32p to the phosphate groups of the phosphate-sugar backbone of the probe molf cule. Those of ordinary skill in the art will appreciate that labelling with other radioactive labels such as 3H, or l25I or 35S iS aIso possible. Once the probes are labeled radioactively, detection is accomplished by exposure to X-ray sensitive photographic film. Subsequent development of the film will enable one to visually detect the presence or absence of hybridisation. These methods are well-known to those of ordinary skill in the art. See Sambrook, et al., (2).
Erlzyme-linked immunoassay is another technique useful for labeling the polynucleotide probes of the present invention. The antibody reagent used in thepre~erred embodiments of the present invention is principally characterised by its ability to bind to the hybrids formed between the probe and complementary sample nucleicacids through binding of the detectably labeled polynucleotide. The antibody reagent can consist of whole antibodies, antibody fragments, polyfunctional antibody aggreg~es, monoclonal antibodies, single-chain antigen-binding molecules, or in general anysubstance comprising one or more spes~ific binding sites -from an anti-hybrid antibody.
When in the form of whole antibody, it can belong to any of the classes and subclasses of known immunoglobulins, e.g., IgG, IgM, and so forth. Any fragment of any such30 antibody which retains specific binding affinity for the hybridised probe can also be employed, for instance, the -fragments of IgG conventionally known as Fab, F(ab'), and F(ab')2. In addition, aggregates, polymers, derivatives and conjugates of 9~1 107,p:\oper\jmw,20889.C~m,13 immunoglobulins or their fragments can be used where appropriate.
The immunoglobulin source for the antibody reagent can be obtained in any available manner such as conventional antiserurn, monoclonal antibody techniques, and recombinant genetic engineering of single-chain antigen-binding molecules. Antiserum S can be obtained by well-established techniqwes involving immunisation of an animal, such as a mouse, rabbit, guinea pig, sheep or goat, with all appropriate immunogen. The immunoglobulins can also be obtained by somatic cell hybridisation techniques, such resulting in what are cornmonly referred to as monoclonal antibodies, also involving the use of an appropriate immunogen. Single-chain antigens are recombinantly engineered by insertion of a DNA segment cocling for a linker polypeptide into a plasmid such that the linker will be expressed linking the two antigen-binding vlriable domains.
When the antibody reagent is used to detect hybrids, it will usually be labeled with an enzyme such as alkaline phosphatase, horseradish peroxidase, or ~-galactosidase, attached by suitable synthetic mecms. Alternatively, the antibody reagent can be detected based on a native property such as its own antigenicity. Further, antibody can be detected by complement fixation or the use of labeled protein A, as well as other techniques known in the ar1i for detecting antibodies.
In a preferred embodiment the antibody reagent is labeled. The labeling moiety and the antibody reagent are associated or linked to one another by direct chemical linkage such as involving covalent bonds, or by indirect linkage such as by incorporation of the label in a microcapsule or liposome which is in turn linked to the antibody.
Labeling techniques are well-known in the art and any convenient method can be used in the present in~ention. Where the sample of mycoplasma is limited PCR amplification may be employed before hybridisation is carried out (3).
One of ordinary skill will appreciate that other enzymes may be coupled to the bound antibodies for purposes of detection, including horseradish peroxidase, and corresponding color-developing reagentis applied. Specifically, the chemiluminescent reagent "LUMI-PHOS 530(~"1 LuminGen, Inc., Detroit~ Michigan, allows the detection of hybrids on conventional X-ray ~llm. ~Iternatively, antidigoxigenin conjugates that 30 would be suggested to one of ordinary sk;ll include the fluoresces anti-digoxigenin-rhodarnine, and ~mti-digoxigenin-fluorescein; and for electron microscopy anti-digoxigenin-(second antibody conjugated to gold).
941 107.p:10pcr\jmw,20889.C~n.14 The use of chromophoric labels can be detected by sight or by conventional means, such as by a light microscope. Recordation is by conventional color microphotography. Fluorescent or chemiluminescent labels emit light that may be detected by sight or by photomultiplier type. Gold-conjugated labeling is used in S electron microscopy to detect hybridisation and to image the larger rnorphological features of the iniFected cell. Radiolabeled probes may be exposed to X-ray sensitive film.
In the present invention certain aspects of the detectably labeled nucleotide probe may be immunogenic. For instance, a diL,oxigenin-dUTP spacer arm is recognizable by 10 anti-digoxigenin antibodies or fragments thereoi~. Thus, -for purposes of this invention and in this context, the digoxigenin-dUTP moiety is an antigen. Similarly, in certain situations the dNTP tail can be an antigen. It is well-known that antibodies that are raised in an appropriately stimulated host will produce antibodies specific for epitopes of the antigen. The dNTP tail may present sufficient size to present epitopes 15 recognizable iby antibodies, and thus offer another method of labeling the hybrid.
The hybridisation mixture of the present invention includes a sample containing or suspected of containing mycoplasma DNA or RNA sequences, a hybridisation buffer, and a detectably labeled probe having the sequence of either one of, or both of,sequences l or 2. More speci~lcally the sample may be a tissue sample or other 20 biological sample from any area that may harbor mycoplasma.
The hybridisa~ion buffer of the present invention may comprise any buffer solution that enables binding of the polynucleotide probes to ~e target sequences. There are many variations of such buffers. Variables -that should be considered when selecting an appropriate buffer are solvent and temperature, volume of solvent and length of 25 hybridisation time, degree and method of agitation, use of pre-hybridisation solution, blocking agents (to block attachment of probes to non-specific surfaces), concentration of probe and its specific activity, use of PEG or Dextran sul-fate to increase effective concentration of probes in solution, and the stringency of washing following hybridisation. Various guidelines are available in the public domain for the construction 30 of hybridisation solutions. See~ (2).
A preferred method of detecting mycoplasma comprises contacting a sample with a detectably labeled probe, or a stably hybridisable fragment thereo-f, comprising any one 941 107,p:\opcr\jmw,20889.CDn,15 of sequences 1 or 2 or with a mixture of both under appropriate hybridisation conditions to stably hybridise the probe or probes fragments to the sample, and subsequently detecting the label. The label may be incorporated directly into the unique sequences of this invention, or labeling may occur post-hybridisation, both methods being outlined in greater detail elsewhere in this specification. The type of label is also not limiting, and many types of labels are discussed herein.
The sample is preferably derived from a swab taken from an animal. The animal can ~e swabbed at the appropriate place where mycoplasma may be present such as the nasal area or respiratory tract.
The present invention also relates to use of the sequences 1 and/or 2 described herein as primers in PCR in order ~o amplify pMC~A genes or genes related thereto.
This is particularly useful where a sarnple suspected of containing mycoplasma contains insufficient genetic information to malce a deterrnination by direct hybridisation. PCR
arnplification can be used to amplify any pMGA genes, or genes related therelo in the 1 5 sarnple.
PCR is based on the armealing and extension of two oligonucleotide primers that flanlc the target region. The primers are annealed to the separated strands and are extended along the template strand by DNA polymerase. Redundancy in the genetic code means that sequences suf~1ciently related for the primers to hybridise to, will also 20 be ampli-fied. Hence the polynucleotide sequences of the instant invention can be used to arnplify a variety of pMC~A genes and related genes. This invention also includes use of sequences 1 and/or 2 as primers in PCR techniques which represent advancements over present PCR techniques (3).
The present invention also includes a kit, which contains all the necessary 25 elements to carry out the assays contemplated herein. Specifically, the kit contains, in close confinement, at least two containers which comprise a first container comprising any one of sequences 1 or 2 or polypeptides encoded thereby or a rnixture thereof, and a second container comprising one or more reagents capable of indicating the presence of the polynucleotides or polypeptides. The kit may also contain reagents for PCR
30 amplification of pMGA genes and genes related thereto, such as DNA polymerase, pre~erably Taq l~NA polymerase or other therrnostable polymerase and appropriatebuffers.
941 107,p:\opor\jmw,20889.Can,16 In detail, a compartmentalised kit includes any kit in which reagents are contained in separate containers. These containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow one to efficiently transfer reagents from one cs)mpartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of the container can be added in a quan-titative fashion from one compartment to another. Such containers will include a container for polynucleotide solutions, or polypeptide or antibody solutions, for radiolabels, for enzymes, fluorochromes or chemiluminescent agents to couple to the antibodies, for color-developing reagents such as X-phosphate/NBT, and containers for phosphate buffered saline, prehybridisation and hybridisation solutions, and other buffers.
The application of the polymerase chain reaction to mycoplasma identifilcation can be successfully applied to numerous mycoplasma. Although the genome of each mycoplasma is unique, they share interspersed regions of DNA homology, particularly around the pMGA genes.
The invention also relates to polypeptide sequences encoded by the nucleotide sequences of the invention and derivatives and variants thereof and antibodies specific therefor which may be used to identify the presence of the organisms in infectedanimals, c~ll line cultures or to identify a serological response mounted by the host against these organisms.
The nucleotide molecules of the invention or parts thereof can be used to manipulate the mycoplasma genome. These sequences, or parts thereof appear to besignals for site specific recombination in mycoplasma and therefore can be used to insert or delete genes from the genome such as genes responsible for antigenicity and/or pathogenicity to construct strains useful for vaccines and/or improve or modify existing vaccine strains. Positioning these sequences on either side of a cloned gene enables it to be incorporated after transforma~ion into the genome of the mycoplasma at a particular site.
In addition probes based on the nucleotide sequences can be used to clone genes by PCR methods. For example sequences 1 and 2 can be used to amplify across a hemagglutinin gene so that the entire gene may be cloned. Cloning of new hemagglutinin genes is important in the construction of new vaccines.
941 107,p:\op~r\jmw,20889.Cnn,17 S EXAMPLlE I
1. Materials and Methods Bacterial strain~ and culture condl;tiollsO M. gallisepticum strain S6 was grownat 37C in broth medium (4) supplemented with 10% swine serum (5). ~scherichia coli DH5a was grown (with shaking) at 37C in Luria broth (LB) containing 50~g/ml of ampicillin or on LB agar also containing 50,ug/ml of ampicillin.
Isolation of Mycoplasnna DNA. Mycoplasma cells were grown till late log phase and harvested by cen~ gation (20,000 x g for 30 min). The cells were resuspended in 0.1 M phosphate buf~er pH 7.4 containing 0.33 M NaCl and spun at 20,000 x g for 20 min. This step was repeated once more. The pellet was resuspended in 10 mM Tris, pH 8.0 (HCl) containing 10 mM EDTA, 10 mM NaCI and the cells Iysed by the addition OI SDS (25%, .02 volumes~. To ~e Iysate 100 ~lg/ml of proteinase K (Boehringer Mannheim) was added and incubated at 37C overnight. Tothe solution 1 ,ug/ml of RNAse A (Sigma) was added and incubated at 37C for a further 30 min. The mixture was extracted with an equal volume of phenol equilibrated with 0.1 M Tris pH 8.0, once with phenol-chloroform (1:1) and once with chloroform-isoamyl alcohol (24:1). Sodium acetate (2.5 M, 0.1 volumes) was added to the solution and the DNA precipitated with ethanol.
Enzymatic digest of pMGA. Approximately 1 mg of pMGA was affinity purified using a monoclonal antibody affimily column as described previously (6). The material was first dialysed against 1 mM ammonia to remove salt and then subjected to reduction and carboxamidomethylation with iodoacetamide. Digestions were conducted 30 using cyanogen bromide or, in separate experiments with the enymes trypsin (Worthington) or endoproteinase-glu-c ~Boehringer Mannheim). For CNBr digestions, pMGA samples (100-1000 ~lg) were dissolved in 70% (vol/vol) formic acid containing 9~11 107.p:\op~r\jmw,20889.Cf~n, 18 25 mg/ml CNBr (Merck). Digests were incubated for 16-20 h and volatile reagents removed by vacuum centrii~ugation. Enzyme digestions were conducted at an E:S ratio of 5 95 (w/w) and a ~mal protein cs)ncentration of 1 mg/ml using NH4HCO3 as digestion buffer.
Peptide isolation a~d purification. CNBr digests were subjected to SDS-PAGE
using a tricine buffer system to facilitate -the resolution of low molecular weight fragments (7). The gels were subjected to electrophoretic transfer to polyvinyldifluoride membranes (Millipore), stained with Coomassie brilliant blue and peptide zones were 10 excised ~or protein sequence analysis.
Digests with proteolytic enzymes were subjected to reversed phase HPLC
essentially as described previously ($~. Briefly, each digest was chromatographed using a C18 column (Pharmacia, Pep RPC) and elution of peptide i~ractions monitored byabsorbance at 214 mn: fractions were collected manually, rotary evaporated to dryness 15 and appropriate samples rechromatographed on the same column. The initial -fractionation was conducted using 10 m~f -formic acid pH 40 (NaOH) as a buffer and the secondary fractionation was conducted using unbuffered 0.1% (v/v) trifluoracetic acid (Applied Biosystems Inc., ABI). Linear acetonitrile gradients were used to elute peptides (0-90% acetonitlile, delivered at 1 ml/min over 90 min). P~lrified peptides were 2() then sequenced.
E~mall degradation. The automated ~dman degradation was performed using an ABI model 471A protein sequencer equipped with a Brownlee Laboratories microgradiene delivery to conduct chromatographic identification of PTH amino acids.
'~S
Preparation of synthetic oligonucleotide probes. The nucleotide sequence predicted for pPpticles T3 and C7 were used in constructing 23 and 20 mer degenerated oligonucleotides respectively. The result~mt oligonucleotides were produced on a PCR
MATE (ABI), cleaved from the solid support and purified by passage over an OPC ~ i 30 column (ABI).
Conxtluctioll of Mycopl.lsma gell~3mic lDNA Lilbr~ry. .1~co Rl ~Boehringer 9~11107,p:\ope~\jmw,20889.Cnn,19 Mannheim) restricted genomic mycoplasma DNA i~ragments were cloned into Eco Rl cut pUC18 vector. Recombinant plasmids were transformed into E. coli DH5u cells according to methods as described in Sarnbrook et al (2).
S Screening of recombinant library. Screening of the recombinant library for probe reactive DNA was conducted using standard techniques detailed by Sambrook et al (2). Briefly, duplica$e lii~ts using Hybond-~ (Amersham) membranes were made of recombinant ~. coli colonies grown on agar. Membranes were incubated in prehybridisation buffer containing 6x SSPE (20x SSPE is SM NaCI, lM
NaOrthophosphate and 0.2M EDTA), 0.5% SDS, 0.2% non-~at skim milk powder, lx Denhardt solution and 100 ~g/ml of single stranded salmon sperm (Sigma) DNA at 42C
for 4 h. Oligonucleotide probes were 5'-labeled with (y-32P)ATP (Amersharn) utilising Boehringer Mannheim polynucleotide kinase, ullincoryorated label was removed using a G-50 (Pharmacia) spin column as described in Sambrook et al (2). Labeled oligonucleotide probes were allowed to hybridise with individual membranes at 42C
overnight. The membranes were washed t;wice in 6x SSPE containing 0.5% SDS for 10 min each at 60C. The membranes were blotted dry then exposed to XAR-5 film (Eastman Kodak) ~md developed.
Southern blot hybridisation. Genomic DNA of M. gallisepticum strain S6 was digested to completion w;th I~NA restriction enzymes ~Iind III (Pharmacia) and Eco Rl (Pharmacia). The digested DNA together with 32P-labeled ~ DNA markers (Bresa) were subjected to electrophoresis in 0.7% agar gel and blotted onto Hybond-N membranes as described before. E3[ybridisation of oligonucleotide probes to membranes was carried out using the same conditions as described previously. Mycoplasma DNA used for hybridisation was purified using methods as described below except the Prey A-Gene (Boehringer M~nheim) purified clone insert was random prime radiolabeled (Amersham) following the manufacturers instructions. The radioactively lc~eled clone inserts were hybridised to individual membranes overnight at 55C and the rnembranes finally washed in 0.1x SSPE with 0.5% SDS for l0 min each at 66C. Subsequently M. gallisepticum strain S6 genomic DNA uras digested with Eco Rl, Hino III, Cla I, Sac I, Sal I, and BglI and pairs of these enzymes and probed with cloned fragments of 941 107,p:\opcr\jmw,2088g.Cnn,20 mycoplasma DNA under similar conditions to determine the extent of the repeated gene family.
Subcloning of myc~plasma ~or DNA sequencimg. Recombinant clones reactive 5 to both oligonucleotide probes were isolated and grown in LB broth at 37C ovemight with shaking. Plasmid DNA was extracted using the method of Sambrook et al (2) and a limited restriction map of the recombinant DNA ascertained. The DNA insert wasdigested by an appropriate DNA restriction enzyme, subjected to electrophoresis and the resultant fragments isolated from the gel. The excised fragments were purified using 10 Prep-A-Gene (Boehringer Mannlleim) as per manufacturers instructions, cloned into suitable digested pUC18 and used to transform E. coli DHSa cells. Cells were plated on Luria agar containing the chromagen S -bromo-4-chloro-3 -indoyl- ~-D-glucopyranoside (X-gal:Boehringer Mannheim). White colored colonies carrying the correct recombinant DNA insert were grown overnight in LB broth (as described before), the plasmid DNA
15 was harvested and purif;ed using Prep-A-Gene for subsequent DNA sequencing.
DNA ~equencing. The nucleotide sequence of the cloned DNA fragments was determined by the dideodxy-chain termination method using T7 DNA polymerase (Prornega) following the manufacturers instructions. The majority of the sequencing was 20 done by utilising synthetic oligonucleotide primers complimentary to regions 5' and 3' of the inserted DNA of pUC 18.
Synthetic oligonucleotide based on complimentary regions of previously sequenced DNA were used as primers to initiate and extend DNA sequencing.
Subsequently progressive unidirectional deletion of cloned fragments were generated 25 using exonuclease III to specifically digest DNA from 5' protruding or blunt end (10).
~he collection of unidirectional deletions were then sequenced as described above.
Computer analysis of the clones ~r;~gments. The DNA sequence was analyzed using the University of Wisconsin genetics computer group DNA programs package.
30 The amino acid sequence was analyzed using FASTA program using the algorithms of Pearson and Lipman (9). Multiple alignments of genes were conducted using the Clustal V progra~n (10).
941 107,p:\oper\jmw,20889.C~n,21 2) Result~
Partial ami~o acid analysis of pM[GA. The pMGA protein was purified using monoclonal antibody affinity chromatography and samples subjected to proteol~tic and chemical digestion.
Clonillg of a gene encoding a numbcr oî pMGA peptides. Synthetic oligonucleotides of 23 and 20 nucleotides in length were designed: their nucleotide sequences based on the amino acid sequence of trypic peptides T3 and C7 (Fig. 1).
Both oligonucleotides were radiolabeled and hybridised to Eco R1 cut genomic DNA10 of M. gallisepticl~m in sou~hern iransfer. Figure 2 show that the 23 mer (Lane 2 panel A) and 20 mer (I,anc 2 panel B) probes hybridised to 10, 8, 6 and 10, 6 kb bandsrespectively in southern transfer. A genomic library of EcoR1 cut M. gallisepticum DNA was constructed in pUC 18 and recombinant colonies were screened for their ability to hybridise to both radiolabeled oligonucleotide probes A and B. One doubly 15 reactive clone was isolated and found to contain a 10 kb insert of mycoplasma DNA
reactive with both oligonucleotide probes (Fig. 2, Lane 1 of Panels A and B). The DNA
insert was subjected to cleavage using a limited nurnber of restriction enzymes and a restriction map was deduced. Three separate fragments were subcloned into pUC 18 and designated a, b and c. The clones were subjected to DNA sequencing and where 20 necessary, oligonucleotide primers were prepared to continue DNA sequencing.
Nucleotide ailld amino acid sequences. The partial DNA sequence of the 10 kb insert and the respective amino acid sequence are presented in Fig. 3. The DNA
sequence is divided into two putative genes, pMGA1.2 and pMGA1.3 respectively. The 25 proposed PMGAI.2 gene begins at nucleotide position 109 with the start codon GTG
and ends at the position 2050 with the stop codon TAG. A 16 amino acid sequence (Beginning nt position 184) of pMGA1.2 has 87.5% homology (using the LFASTA
program (9)) to the arnino-terrninal sequence of pMGA (the plasma membrane protein expressed by cultured M. galliseptic2~m cells). The pMGAI.2 gene would encode a 30 precursor protein of 647 arnino acids (70.257 kDa) including a signal peptide of 25 amino acids. The start codon beginning nucleotide position 109 is followed by 3 basic residues then a stretch of 21 amino acids primarily hy~rophobic in na~re. The mature 941 107,p:\oper\jmw,20889.C~n.22 protein would contain 622 arnino acids with a molecular mass of 67.66 kDa.
Preceding the translational start of pMGA1.2 is a putative promoter region consisting of a -35 region ~nd a -10 region separated by 17 nucleotides (Fig. 3). A
similar region also occurs preceding the predicted translational start of pMGAl.3.
S Between the putative promoter region and the predicted translational start of pMGAl.2 and 1.3, an imperfect palindrome exists (indicated by arrows, Fig.3) with the potential to form a short base paired loop.
The postulated signal peptide sequences of pMGAl.2 and pMGAl.3 are identical except for the conservative replacement of arginine for Iysine at the second arnino acid 10 position of the signal sequence (Fig. 3). Differences in the amino-tenninal sequences are noted (Fig. 3) with pMGA1.2 and pMGAI.3 differing by 3 and 6 arnino acids respectively to pMGA. No sequence homology of any significance was found to any other protein sequence using computer searches of the standard protein data bases.
Subsequently the sequence of the entire lOkb fragment of ~. gallisepticum DNA
15 was deterrnined. Examination of the amino acid sequences deduced to be encoded by this DNA enabled the sequence to be divided into S putative geneis, three of which are encoded in their entirety by this fragment of DNA (designated pMGA1.2, pMGA1.3 and pMGAl.4 respectively) with the 5' end of a fourth gene (designated pMGA1.5) and the 3' end of a fi-fth gene (designated pMGJA1.6) also deduced to be present. Comparison 20 of the amino acid sequence of these genes using the ClustalV program to conduct multiple aligmnents (10) showed the 5 genes to be closely related with about 40% amino acid similarity between the 3 complete genes. The DNA sequence of ~he five genes and the regions between each gene were also compared (Figure 5). Two regions of veryhigh similarity were identified in the noncoding region between each gene and at the 5' 25 end of each gene. Additionally a highly conserved repeated element, consisting of seven or more repeats of the trinucleotide ('JAA were identified within the conserved noncoding region.
Extellt and Orgallis~tion OI Chromosomal Regiolls Encodin~ pMGA-like Genes Two cloned fragments of pMGAl.2 were used as hybridisation probes to establish the extent of the loci encoding genes in the pMGA family. Both fragments hybridised to 941 107,p \opcir\jmw,20889.C~n,23 - 2'1 -mostly the same fragments in restriction endonuclease digests of the genomic DNA of M. galliseptieurn strain S6. These fragments were mapped to two regions on the genome, one of 100 kb and a second of 20 kb, indicating that the genome contains at least a,~ different pMGA genes arranged in tandem.
Comparison of restriction fragments hybridising to the pMGA1.2 gene in three different strains of M. gallisepticum revealed a high degree of interstrain variability1 consistent with high frequency recombination or mutation within this region of the genome.
10 Use of Conser~ed Sequences to D~t~t M, gallisepticum by Polymera~e Chain Reaction Two short sequences separated by 216 bases within the conserved regions of the pMGA
loci were chosen and oligonucleotides synthesised. The sequences of the 15 oligonucleotides were Oligonucleotide 1: GAAGAAGAAGAAGAAGAAGAA&A
Oligonucleotide 2: ACGAACCAATACCTAATAAACTAACAA
20 Samples of DNA extracted from each of four avian mycoplasrna species (M.
gallisepticum, M, synoviae, M. pullorum and M. gallinarum) were added to separa~e tubes with a buffer containing I OmM dA*P, I OmM dTTP, 1 OmM dGTP, 1 OmM dCTP, lOmM KCl 20mM Tris-HCI (pH 8.8 at 25C), lOmM (NH4)2S04, 2mM MgSO4, 0.1%
Triton X-100, lOO,ug bovine serum albumin, 5~1M of each of the oligonucleotides and 25 1 ~mit of Vent DNA Polymerase. The reactions were subjected to 30 temperature cycles of 30 seconds at 94C, 30 seconds at 50C and 20 seconds at 72C. A fragment of DNA of 216 base pairs was amplifiled :from A~: gallisepticum DNA as predicted, and no fragments were amplified from other avian mycoplasmas (Figure 6).
Sequerleing of lOkb lkl. gallisep~icl~m DNA fragment 941 107,p:\0p~r\jmr/,20g89.CIul,24 Subclones based on the lOkb DNA fragment isola~ed in Example I were produced as follows. The 10kb fragment is represented diagrammatically below.
Subc1On~/E~zym~ E E3 P E~ B pMl;A ~5 .. ~==
S
D~signotion ~MG~ i pl1~;AI.~ 1 3 pl'll;~ pMGAlo ~
GAA . GAA ~a~ GP~ 1 kb 10 The diagram above gives details of the gene arrangement determined by sequencing an Eco RI 9719 base pa~r (bp) fragment of M. g{llliscpticum S6 strain genomic DNA
inserted in the plasmid pUC 18. The original clone (Clone 16) was selec~ed based on the plasmid insert being reactive to specific oligonucleotide probes. Subclones were made from the original plJC 18 Clone 16 for DNA sequencing as follows. (Read frorn 15 left to right of tne above diagram).
No Restriction Sites Clone length Lab Designation 1. E-B Eco Rl-Bgl II 382 bp 0.5 kb 2. B-P Bgl II-PstI 950 bp 0.95 kb 3. P-B Bgl lI-Bgl II 1248 bp 1.2 kb 4. B-B Bgl 1I-Bg1 II 14~9 bp 1.4 kb 5. B-E Bgl II-Eco Rl 5619 bp 5.0 kb The 1 st clone did not appear to contain the leader or promoter sequence whereas the 2nd 25 clone contains the leader and promoter sequences for pMGA 1.2. Clone 3 did not appear to contain any promoter or leader sequences whilst Clone 4 contains the leader and promoter sequences for pMGA 1.3. The final or 5th Clone contains the sequences ~or pMGA 1.4 and pMGA 1.5.
E~M[PLE 3 Production of ~ l~ve vaccine USillg the ts-l ll strain o~ ikI. g~lllise~icum 941 108,p:\oper\jn~w,20889,Can,25 The 5' conserved region identi-fied in Example 1 comprises a strong promoter andencodes the signal or leader sequence for pMGA which is responsible for pMGA being directed to the surface of M. gallisepticum and anchored in the membrane.
The 5' conserved region can be used for the expression of genes encoding S protective antigens from other respiratory pathogens such that these antigens appear on the surface of an attenuated M. gallisepticum strain such as ts-11 (Whithear et al ~1990) Aust. Vet.J. 67: 159-165). Genes encoding antigens from respiratory pathogens such as those causing the following conditions could be used: infectious bronchitis, Newcastle Disease, E. coli respiratory infection, infectious laryngotracheitis, turkey rhinopneumonitis, infectious bursal disease, avian inflwenza, avian encephalomyelitis and chicken anaemia agent.
The S' conserved region is spliced from the pMGA gene and ligated to the 5' end of the coding sequence of the required antigen. Most conveniently, the antigen will be one for which there are monoclonal antibodies, or other detection means available, for ready detection of recombinants. The recombinant *agment thus produced is transformed into ts-11 using electroporation and will integrate into the ts-11 genome.
Recombinants expressing the required antigen are detected using monoclonal antibodies or o~er convenient detection means. Recombinants detected in this way are examined for stability of expression.
Development of a specific serological marlcer can be achieved by insertional inactivation of an antigen in ts-11. Specifically the gene for the foreign antigen is inserted into the initial coding region of a deleted version of the gene for a non-essential, antigen common with the wild-type pathogen. This construct is used for insertion of the foreign gene into ts-11 by homologous recombination. Concurrently the gene encoding this deleted Mycoplasrna gallisepticum antigen is cloned and expressed in E. coli, f enabling a highly specific ELISA or l~atex agglutination test to be developed.
Thus ts-11 (engineered) vaccinated birds would test positive for pMGA, bu~
negative for the deleted antigen, while wild type exposed birds would test positive for both antigens. Use of these assays would retain the ability to maintain and confirm a wild type ll~coplusma gallisepticum-free status in conjunction with use of a ts-11 vector vaccme.
941 108,p:\oper\jmw,20889.C~n,26 I`he publications referred to at the end of the specification are herein incorporated by reference.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is S to be lmderstood that the invention includes all such variations and modifications which fall within its spirit and scope. The invention also includes all the steps, i~eatures, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
94 1 107,p:\oper\jmw,20889.Chn,27 - 2~ -1. Suggs, S.V., Wallace R.B., Hirose T., Kawashima E.H. and Itakura K. (1981) Use of synthetic oligonucleotide as hybridisation probes: Isolation of cloned cDNA sequences from hurnan ,B-microglobulin Proc.Natl.Acad.Sci 78: 6613 2. Sambrook et al. Conditions for Hybridisation of Polynucleotide Probes, in Molecular Cloning-A Lab Manual, 2d ed., p. 11.46, Cold Spring Harbor Press (1989).
3. Erhlich, H.A., Gelfand, D. and Sninsky J.T. ~1991) Recent advances in the Polymerase chain reaction, Science 252: 1643-1656 4. Frey, M.L., R.P. Hanson, and D.P. Anderson. 1968. A medium for the isolation of avian Mycoplasmas. Am. J. Vet.Res., 29: p. 2163-2171.
5. Whithear, K.G., D.D. Bowtell, E. Ghiocas, and K.L. Hughes. 1983. Evaluation and use of a micro broth dilution procedure for testing sensitivity of fermentative avian mycoplasmas to antibiotics. Avian Dis, 27: p. 937-949.
6. Markharn, P.F., M.D. Glew, M.R. Brandon, I.D. Walker, and K.G. Whithear.
1992. Characterisation of a major hemagglutinin protein from Mycoplas~u gallisepticum. Infect. Immun.,60: 3885-3891.
1992. Characterisation of a major hemagglutinin protein from Mycoplas~u gallisepticum. Infect. Immun.,60: 3885-3891.
7. Schagger, H. and G.v. Jagow. 1987. Tricine-sodium dodecyl sulphate-poltacrularnide gel electrophoresis fro the separation of proteins in the r~mge from 1 to lOOkDa. Anal. Biochem., 166: p. 368-379.
8. Murphy, B.F., L. Kirszbaum, I.D. Walker, and A.J.F. d'Apice. 1987. SP-40,40,a newly identified nonnal human serum protein ~ound in the SCSb-9 complex of complement and in the imrnune deposits in glornerulonephritis. J.Clin.Inves.,81:p.185~-186~.
941 107,p:\opcr\jmw,20889.C~n,28 9. Pearson, W.R. and D.J. Lipman. 1988. Improved tools for biological sequence cs)mparison. Proc. Natl. Acad. Sci., 85:p.2444-2448.
941 107,p:\opcr\jmw,20889.C~n,28 9. Pearson, W.R. and D.J. Lipman. 1988. Improved tools for biological sequence cs)mparison. Proc. Natl. Acad. Sci., 85:p.2444-2448.
10. Higgins D.G. et al 1991 (CLUSTAL V: improved software for multiple sequence alignment. ms. submitted to CABIOS) 11. Henikoff, S. 1984 Gene 28:357 12. Whithear, K.G., Soeripto, K.E. Harringan and E. Ghiocas (1990). Safety of temperature sensitive mutant Mycoplasmagallisepficum vaccine. Aust. Vet.J. 67:
159-165.
159-165.
13. Evans R.D. and Y.S. ~afe~ (1992). Evaluation of a Mycoplasma gallisepticum strain exhibiting reduced virulence for prevention and control of poultry mycoplasmosis. Avian Diseasçs 36: 197-201.
9~tl 107,p:\oper\jmw,20889.CDn,29 - ~o-SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Browning, Glenn F.
(ii) TITLE OF IMVENTION: LIVE VACCINE VECTORS BASED ON MYCOPLASMA
GALLISEPTICUM AND NUCLEIC ACID PROBES THEREFROM
(iii) NUMBER OF SEQUENCES: 17 (iv) CORRESPONDENCE ADDRESS:
(A) AD~RESSEE: Scully, Sco~t, Murphy & Press~r (B) STREET: 400 Garden City Plaz~
(C) CITY: Garden City (D) STATE: New York (E) COUNTRY: U.S.A.
(F) ZIP: 11530 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy dis~
(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 08/230,312 (B~ FILING DATE: April 20, 1994 (Cl CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: DiGiglio, Frank S.
(B) REGISTRATION NUMBER: 31,346 (C) REFERENCE/DOCKET NUMBER: 8801Z
(ix) TELECOMMIJNICATION INFORMATION:
(A) TELEPHONE: (516) 742-4343 (B) TELEFAX: (516) 742-4366 (C) TELEX: 230 901 SANS UR
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
A) LENGTH: 255 base pairs (B) TYPE: nucleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ I~ NO:1:
GAAGAAGAAG AAGAAGAAGA AGAAGAAGAA GWAGAAG~AG AAGAAGTTCT TAGGAGTTCK 60 ATATATTCTT TARWYAATAA TAGACG~GKT KAACGTAAGT TATTGRCTTA AYTTTAAGTG 180 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
(2) INFORMATIGN FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nllcleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID No:4:
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOI.OGY: linear ti.i) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
(~) INFORMATION FOR SEO ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2809 base pairs (B) TYP~: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: ~404..2808 (i~) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 109..2049 (D) OTHER INFORMATION: /~odon= (seq: "tg~", aa: Trp) (xi) SEQUENCE DESCRIPTION: SEQ ID NO.6:
Val Lys Lys Lys Asn Ile Leu Lys Phe Val Ser Leu Leu Gly Ile Gly Ser Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr Pro Thr Pro Asn Pro Thr Pro Asn Pro Asn Pro Pro Ser Gly Gly Met Asn Gly Gly Asp Thr Asn Pro Gly Asp Gly Gln Gly Met Met Asn Al~ Ala Ser Gln Glu Leu Ala Ala GCA AGA P.TS GGG TTA ACT ACT ATA TTT GAT TCT AAA GCT AAG AAT CTT 357 Ala Arg Met Gly I,eu Thr Thr Ile Phe Asp Ser Lys Ala Lys Asn Leu Gly Leu Tyr Val Asp Tyr Lys Lys Thr Gln Asn Thr Leu Thr Lys Ala ~5 90 95 Tyr Asp Ala Ala Lys Thr Val Leu Asp Asn Ser Ser Ser Thr Thr Gln 1~0 105 110 115 Asn Leu Asn Glu Ala Lys Thr Arg Leu Glu Thr Ala Ile Arg Thr Ala Ala Thr Ser Lys Gln Thr Phe Asp Glu Gl.n His Ala Glu Leu Val Lys 135 140 1~5 Val Tyr Lys Glu Leu Lys Thr Thr Leu Ser Asn Glu Thr Ala Thr Leu GCT CCA TAT GCA GAT GCG CAA TAT GCT GGA ATT AAA ATG CAT TTA AGT 6~15 Ala Pro Tyr Ala Asp Ala Gln Tyr Ala Gly Ile Lys Met His Leu Ser Gly Leu Tyr Asp Ala Gly Lys Ala ~le Thr Thr Lys Thr Leu Glu Pro Val Glu Gly .Asp Pro Leu Thr Ala Ser ~la Val Met Met Ala Asn Thr Lys Ile Val Glu Ala Ile Lys Asp Glu Val Leu Asn Pro Gln Lys Glu AAC GCA ACA AAA CTA GCT GAT AGT TTG TTA AGC AGT ATA GTA AAG AAA 837 .:
Asn Ala Thr Lys Leu Ala Asp Ser Leu Leu Ser Ser Ile Val Lys Lys Ile Thr Gly Val Glu Glu Ala His Asn Lys Ala Gln Pro Ala Asn Tyr Ser Phe Val Gly Tyr Lys Arg Trp Tyr Thr Glu Leu Leu Leu Asp Lys 260 265 270 27, Gln Val Phe Pro Asn Trp Asp Tyr Ala Gln Arg Thr Ile Phe Thr Asn Ser Asp Glu Pro Arg Ser lle Ser Asn Thr Pro Ala Asp Gly Gln Thr Met Ala Gln Pro Leu Ser Asn Val Ser Trp Ile Tyr Ser Leu Ala Gly Thr Gly Ala Lys Tyr Thr Leu Glu Phe Thr Tyr Tyr Gly Pro Ser Thr :.
325 330 335 :.
Gly Tyr Leu Tyr Phe Pro Tyr Lys Leu Val Asn Thr Ser Asp Gln Val AAA CTA GGT CTA G~A TAT AAA TTA AAT GAT GCG ACT AAA CCA AGT GCG 1221 Lys Leu Gly Leu Glu Tyr Lys Leu Asn Asp Ala Thr Lys Pro Ser Ala Ile Thr Phe Gly Ssr ~sp Gln Thr Met Asn Gly Lys Thr Pro Thr Val Asn Asp Ile Asn Val Ala Lys Val Thr Leu Ala Asn Leu Asn Phe Gly TCA AAC A~A ATT GAG TTT AGT GTT CCA GCA GAA AAA GTA AGT CCG ATG 1365 Ser Asn Lys Ile Glu Phe Ser Val Pro Ala Glu Lys Val Ser Pro Met Ile Gly Asn Met Tyr Leu Ser Ser Ser Pro Asn Asn Trp Asn Lys Ile Tyr Asp Asp Ile Phe Gly Asn Ser Val Thr Thr Lys Asn Asn Arg Thr 440 ~45 450 Ile Ile Ser Val Asp Ala Leu Asn Gly Tyr Ser Leu Ala Ser Asp Trp TCA AC.~ TAT ATT GCT GAA TAC AGT GGT GCA GGT TTA ACA TTA AAC GAC 1557 Ser Thr Tyr Ile Ala Glu Tyr Ser Gly Ala Gly Leu Thr Leu Asn Asp Gln Ala Lys Pro Asn Glu Lys Tyr Tyr Leu Ile Gly Tyr Val Gly Gly Thr Gly Ala Arg ~sn Asp Met Met Val Pro Lys Asn Asn Val Gln Lys Phe Pro Leu Ala Asn Asn Thr Ser Asn Arg Asn Tyr Val Phe Tyr Val AAC GCA CCA AGA GAA GGT GAT TAT TAT ATT AoA GGA GTC TTT GCT TCA 1749 A3n Ala Pro Arg Glu Gly Asp Tyr Tyr Ile Lys Gly Val Phe Ala Ser Gly Val Gly Ser Asp Leu Lys Phe Ser Thr Gly Asp Met Ser Ser Asn Asn Val Thr Val Lys Gln Leu Ph~ Thr Gly Asn Leu Thr Thr Thr Leu 565 . 570 575 Arg Thr Phe Asp Thr Ser Ala Thr Th. Glu Ser Thr Arg Val Thr Thr GAT CCT ACT AAT AAA AAG ACG I'TA ACT CTA GTA GAA GGA TTA AAT AAG 1941 Asp Pro Thr Asn I.ys Lys Thr Leu Thr Leu Val Glu Gly Leu Asn Lys ATA GTA GTT AGT GGA ACT ACT GAA AAT ATT GGT GCT CCA AAT TTl' GGA 1989 Ile Val Val Ser Gly Thr Thr Glu Asn Ile Gly Ala Pro Asn Phe Gly Tyr Leu Glu Phe Ile Leu Asn Glu ~hr Gln Pro Glu Thr Thr Asn Val 630 635 6~0 Ser Asn Pro Ser GTATTTTATA TAAGrrTATTT TGTTTGTCAT TTAACATCAA AATCAATTCG AATTTTGATG 2149 Val Lys Arg Lys Asn Ile Leu Lys Phe Val Ser Leu l 5 10 Leu Gly Ile Gly Ser Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr 15 20 ~5 P.ro Val Asn Pro Thr Pro Asn Pro Thr Pro Thr Pro Asn Pro Glu Pro Asn Pro Gly Gly Gly Gly Gly Met Ser Asp Gly Asn Thr Asn Pro Gly :
:
AAT G~T GGA GGT ATG ATG GGC GAC AAT CCT AAT CCT GGG AAC ACC ACA 2631 Asn Gly Gly Gly Met Met Gly Asp Asn Pro Asn Pro Gly Asn Thr Thr Pro Glu Gln Gln Leu Ala Ala Ala Arg Lys Thr Leu Thr Asp Leu Leu Gly Thr Glu Asn Thr Asn Val Ala Lau Tyr Ala Asp Tyr Ala Lys Ile ~ln Ser Thr Leu Ser Thr Ala Tyr Met Thr Ala Lys Thr Ala Ser Glu Asn Thr Ser Ala Thr Leu Glu Asn Leu Thr Pro (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 647 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Val Lys Lys Lys Asn Ile Leu Lys Phe Val Ser Leu Leu Gly Ile Gly Ser Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr Pro Thr Pro Asn Pro Thr Pro Asn Pro Asn Pro Pro Ser Gly Gly Met Asn Gly Gly Asp Thr Asn Pro Gly Asp Gly Gln Gly Met Met Asn Ala Ala Ser Gln Glu Leu Ala Ala Ala Arg Met Gly Leu Thr Thr Ile Phe Asp Ser Lys Ala Lys Asn Leu Gly Leu Tyr Val Asp Tyr Lys Lys Thr Gln Asn Thr Leu ~5 hr Lys Ala Tyr Asp Ala Ala Lys Thr Val Leu Asp Asn Ser Ser Ser Thr Thr Gln Asn Leu Asn Glu Ala Lys Thr Arg Leu Glu Thr Ala Ile Arg Thr Ala Ala Thr Ser Lys Gln Thr Phe Asp Glu Gln His Ala Glu Leu Val Lys Val Tyr Lys Glu Leu ~ys Thr Thr Leu Ser Asn Glu Thr la Thr Leu Ala Pro Tyr Ala Asp Ala Gln Tyr Ala Gly Ile Lys Met is Leu Ser Gly Leu Tyr Asp Ala Gly Lys Ala Ile Thr Thr Lys Thr Leu Glu Pro Val Glu Gly Asp Pro Leu Thr Ala Ser Ala Val Met Met Ala Asn Thr Lys Ile Val Glu ~la Ile Lys Asp Glu Val Leu Asn Pro Gln Lys Glu Asn Ala Thr Lys Leu Ala Asp Ser Leu Leu Ser Ser Ile al Lys Lys Ile Thr Gly Val Glu Glll Ala His Asn Lys Ala Gln Pro la Asn Tyr Ser Phe Val G~.y Tyr Lys Arg Trp Tyr Thr Glu Leu Lau Leu Asp Lys Gln Val Phe Pro Asn Trp Asp Tyr Ala Gln Arg Thr Ile Phe Thr Asn Ser Asp Glu Pro Arg Sex Ile Ser Asn Thr Pro Ala Asp 290 ~95 300 Gly Gln Thr Met Ala Gln Pro Leu Ser Asn Val Ser Trp Ile Tyr Ser 305 310 315 3~0 eu Ala Gly Thr Gly Ala Lys Tyr Thr Leu Glu Phe Thr Tyr Tyr Gly ro Ser Thr Gly Tyr Leu Tyr Phe Pro Tyr Lys Leu Val Asn Thr Ser 340 3~5 350 sp Gln Val Lys Leu Gly Leu Glu Tyr Lys Leu Asn ~sp Ala Thr Lys Pro Ser Ala Ile Thr Phe Gly Ser Asp Gln Thr Met Asn Gly Lys Thr Pro Thr Val Asn Asp lle Asn Val Ala Lys Val Thr Leu Ala Asn Leu sn Phe Gly Ser Asn Lys Ile Glu Phe Ser Val Pro Ala Glu Lys Val er Pro Met Ile Gly Asn Met Tyr Leu Ser Ser Ser Pro Asn Asn Trp ~20 425 430 Asn Lys Ile Tyr Asp Asp Ile Phe Gly Asn Ser Val Thr Thr Lys Asn 435 4~0 44~
Asn Arg Thr Ile Ile Ser Val Asp Ala Leu Asn Gly Tyr Ser Leu Ala Ser Asp Trp Ser Thr Tyr Ile Ala ~lu Tyr Ser Gly Ala Gly Leu Thr 465 470 475 4~0 eu Asn Asp Gln Ala Lys Pro Asn Glu Lys Tyr Tyr Leu Ile Gly Tyr ~85 490 495 al Gly Gly Thr Gly Ala Arg Asn Asp Met Met Val Pro Lys Asn Asn Val Gln Lys Phe Pro Leu Ala Asn Asn Thr Ser Asn Arg Asn Tyr Val Phe Tyr Val Asn Ala Pro Arg Glu Gly Asp Tyr Tyr Ile Lys Gly Val Phe Ala Ser Gly Val Gly Ser Asp Leu Lys Phe Ser Thr Gly Asp Met er Ser Asn Asn Val Thr Val Lys Gln Leu Phe Thr Gly Asn Leu Thr hr Thr Leu Arg Thr Phe Asp Thr Ser Ala Thr Thr Glu Ser Thr Arg Val Thr Thr Asp Pro Thr Asn Ly~ Lys Thr Leu Thr Leu Val Glu Gly Leu Asn Lys Ile Val Val Ser Gly Thr Thr Glu Asn Ile Gly Ala Pro - '~o -Asn Phe Gly Tyr Leu Glu Phe Ile Leu Asn Glu Thr Gln Pro Glu Thr hr Asn Val Ser Asn Pro Ser 2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS: :
(A) LENGTH: 135 amino acids (B) TYPE: amino acid (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Val Lys Arg Lys Asn Ile Leu Lys Phe Val Ser Leu Leu Gly Ile Gly er Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr Pro Val Asn Pro Thr Pro Asn Pro Thr Pro Thr Pro Asn Pro Glu Pro Asn Pro Gly Gly ~0 45 ~ly Gly Gly Met Ser Asp Gly Asn Thr Asn Pro Gly Asn Gly Gly Gly Met Met Gly Asp Asn Pro Asn Pro Gly Asn Thr Thr Pro Glu Gln Gln eu Ala Ala Ala Arg Lys Thr Leu Thr Asp Leu Leu Gly Thr Glu Asn hr Asn Val Ala Leu Tyr Ala Asp Tyr Ala Lys Ile Gln Ser Thr Leu sQr Thr Ala Tyr ~et Thr Ala Lys Thr Ala Ser Glu Asn T~lr Ser Ala Thr Leu Glu Asn Leu Thr Pro (2) INFORMATION FOR SEQ ID NO:9:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2282 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: doubl~
(D) TOPOLOGY: linear (iil MOL~CULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
TTCTTGATAA TTCATCATCA ACAACACAAA ACCTTAATGA GGCTAAGACT AGATTAG~AA 540 CTGC~ATTA6 AACAGCTGCT ACTAGTAAAC AAACCTTTGA TGAACAACAT GCCGAGTTAG 600 -~2-CTTCTAGTCC TAATA~CTGG AATAAGATCT ATGATGATAT TTTCGGTAAT AGTGTTACAA 1500 RACCTAATGA AAAATACTAT TT~AT'rGGGT ATGTGGGTGG AACTGGTGCT CGTAATGATA 1680 GAATTTTTTT TAAAAACATT TCTCTGAATT TGCTACAAAA ATTAGTGAAA ccTTTrrATTT 2280 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGT}I: 2453 base pairs (B) TYPE: nucleic acid ~C) STRANDEDNESS: double (D) TOPOI.OGY: linear (ii) MOLECULE TYPE: DNA (genomic) -4~--(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GGGGTTTAGG GCTGGTCTGA TCGGCGAAAA TAA~CGCGAT Tl'ATTCCATA ATTGAACTTT 120 ATATATTcTT TAGACAATAA TAGACGTGGT GAACGTAAGT TATTGGCTTA ACTTTAAGTG 180 GCATCAGAAA ATACAAGCGC CACTTTAGAA AATC'rAAGAT CTGCATCAAC TACACTACAA 600 -4~-ATCTATAATG AAA~CTTCGG TAATACTAGT AACTCAAGCG ACAATTCAAC ATCTGTCACT 1680 GGATTAAACA AAGTTGTTAT TAGTGGAGTT TCAAACGGTG ~TACTCCTTA TATTGGTAAT 2220 (2) INFORMATION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2417 base p~irs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: llnear (li) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
r - -AAAcccTGcA CCAAAACCAG ATCCAATGCC AAATCCTGGT GGTGGTATGA TGGGTGGTAT 360 CATl"rAATTA TTATGGGCCT TCAACAGGTT TTTTATATTT CCCTTATAAG TTAGTTAATA 1260 --~6-CTGAAACTAA CACACCTGCT GAAGGAACTT CTACTGAACA TGCAAAATAA AATTcTTATA 2280 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2004 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear ~ii) MOLECUhE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ lD NO:12:
GAAG~AGAAG AAGAAGAAGA AGAAGAAGAA GTTCTTAGGA GTTCGGGGGT TTTCGTTTGG 60 C~AAAAACTG CACCAAAACC AGATCCAAAG CCAAATCCTG GTGGTGGTAT GATGGGTGGT 360 AAACATGCTA TTAATACAGC TGTTAATGAA ~GAAAGTTT TTGACGAAAA TAATTCTGAA 660 CAACAAAAAf, CTAATGCAGA TATGCTTGCA ACTAGTTTTA CAAAACAAGT ACTAAATGAT 960 CAAAGTAATA AATTAACAGA CGTAI'CATGG ATTTATAGCT TATCGGGAAT GGGTGCTAAA 1200 ATTGGTAATT TAACATTCAC TTTAATTATT ACTCGTCAGT ATCTGAAGTA GACTAGCACA 1~20 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) I,ENGTH: 297 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 263 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
_~9_ (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 256 base pairs (B) TYPE: nucleic acid (C3 STRANDEDNESS: double (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
TGGGGCTGGT TTGATCGGAG AAAATAAACC ~GATTTATTA CTTACTGAAC TTTATATATT 120 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 247 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (~i) SEQUENCE DESCRIPTION: SEQ ID NO:16:
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 255 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii~ MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
GAAGAAGAAG AAGAAGAAGA AGAAGAAGAA GW~GAAGAAG AAGAAGTTCT TAGGAGTTCK 60 GGGGTTTDSG KYTGGTYTGA TCDG~GAAAA TWAASBCGAT TTATTMCATW AYTGAACTTT 120 AARARAAAAA ACATWTTAAA GTTTGTTAGT I'TATTAGGTA TTGGTTCGTT TGTAATGTTR 240 GCWGCWGCTA GTTGT ~55
9~tl 107,p:\oper\jmw,20889.CDn,29 - ~o-SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Browning, Glenn F.
(ii) TITLE OF IMVENTION: LIVE VACCINE VECTORS BASED ON MYCOPLASMA
GALLISEPTICUM AND NUCLEIC ACID PROBES THEREFROM
(iii) NUMBER OF SEQUENCES: 17 (iv) CORRESPONDENCE ADDRESS:
(A) AD~RESSEE: Scully, Sco~t, Murphy & Press~r (B) STREET: 400 Garden City Plaz~
(C) CITY: Garden City (D) STATE: New York (E) COUNTRY: U.S.A.
(F) ZIP: 11530 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy dis~
(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 08/230,312 (B~ FILING DATE: April 20, 1994 (Cl CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: DiGiglio, Frank S.
(B) REGISTRATION NUMBER: 31,346 (C) REFERENCE/DOCKET NUMBER: 8801Z
(ix) TELECOMMIJNICATION INFORMATION:
(A) TELEPHONE: (516) 742-4343 (B) TELEFAX: (516) 742-4366 (C) TELEX: 230 901 SANS UR
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
A) LENGTH: 255 base pairs (B) TYPE: nucleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ I~ NO:1:
GAAGAAGAAG AAGAAGAAGA AGAAGAAGAA GWAGAAG~AG AAGAAGTTCT TAGGAGTTCK 60 ATATATTCTT TARWYAATAA TAGACG~GKT KAACGTAAGT TATTGRCTTA AYTTTAAGTG 180 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
(2) INFORMATIGN FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nllcleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID No:4:
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOI.OGY: linear ti.i) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
(~) INFORMATION FOR SEO ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2809 base pairs (B) TYP~: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: ~404..2808 (i~) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 109..2049 (D) OTHER INFORMATION: /~odon= (seq: "tg~", aa: Trp) (xi) SEQUENCE DESCRIPTION: SEQ ID NO.6:
Val Lys Lys Lys Asn Ile Leu Lys Phe Val Ser Leu Leu Gly Ile Gly Ser Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr Pro Thr Pro Asn Pro Thr Pro Asn Pro Asn Pro Pro Ser Gly Gly Met Asn Gly Gly Asp Thr Asn Pro Gly Asp Gly Gln Gly Met Met Asn Al~ Ala Ser Gln Glu Leu Ala Ala GCA AGA P.TS GGG TTA ACT ACT ATA TTT GAT TCT AAA GCT AAG AAT CTT 357 Ala Arg Met Gly I,eu Thr Thr Ile Phe Asp Ser Lys Ala Lys Asn Leu Gly Leu Tyr Val Asp Tyr Lys Lys Thr Gln Asn Thr Leu Thr Lys Ala ~5 90 95 Tyr Asp Ala Ala Lys Thr Val Leu Asp Asn Ser Ser Ser Thr Thr Gln 1~0 105 110 115 Asn Leu Asn Glu Ala Lys Thr Arg Leu Glu Thr Ala Ile Arg Thr Ala Ala Thr Ser Lys Gln Thr Phe Asp Glu Gl.n His Ala Glu Leu Val Lys 135 140 1~5 Val Tyr Lys Glu Leu Lys Thr Thr Leu Ser Asn Glu Thr Ala Thr Leu GCT CCA TAT GCA GAT GCG CAA TAT GCT GGA ATT AAA ATG CAT TTA AGT 6~15 Ala Pro Tyr Ala Asp Ala Gln Tyr Ala Gly Ile Lys Met His Leu Ser Gly Leu Tyr Asp Ala Gly Lys Ala ~le Thr Thr Lys Thr Leu Glu Pro Val Glu Gly .Asp Pro Leu Thr Ala Ser ~la Val Met Met Ala Asn Thr Lys Ile Val Glu Ala Ile Lys Asp Glu Val Leu Asn Pro Gln Lys Glu AAC GCA ACA AAA CTA GCT GAT AGT TTG TTA AGC AGT ATA GTA AAG AAA 837 .:
Asn Ala Thr Lys Leu Ala Asp Ser Leu Leu Ser Ser Ile Val Lys Lys Ile Thr Gly Val Glu Glu Ala His Asn Lys Ala Gln Pro Ala Asn Tyr Ser Phe Val Gly Tyr Lys Arg Trp Tyr Thr Glu Leu Leu Leu Asp Lys 260 265 270 27, Gln Val Phe Pro Asn Trp Asp Tyr Ala Gln Arg Thr Ile Phe Thr Asn Ser Asp Glu Pro Arg Ser lle Ser Asn Thr Pro Ala Asp Gly Gln Thr Met Ala Gln Pro Leu Ser Asn Val Ser Trp Ile Tyr Ser Leu Ala Gly Thr Gly Ala Lys Tyr Thr Leu Glu Phe Thr Tyr Tyr Gly Pro Ser Thr :.
325 330 335 :.
Gly Tyr Leu Tyr Phe Pro Tyr Lys Leu Val Asn Thr Ser Asp Gln Val AAA CTA GGT CTA G~A TAT AAA TTA AAT GAT GCG ACT AAA CCA AGT GCG 1221 Lys Leu Gly Leu Glu Tyr Lys Leu Asn Asp Ala Thr Lys Pro Ser Ala Ile Thr Phe Gly Ssr ~sp Gln Thr Met Asn Gly Lys Thr Pro Thr Val Asn Asp Ile Asn Val Ala Lys Val Thr Leu Ala Asn Leu Asn Phe Gly TCA AAC A~A ATT GAG TTT AGT GTT CCA GCA GAA AAA GTA AGT CCG ATG 1365 Ser Asn Lys Ile Glu Phe Ser Val Pro Ala Glu Lys Val Ser Pro Met Ile Gly Asn Met Tyr Leu Ser Ser Ser Pro Asn Asn Trp Asn Lys Ile Tyr Asp Asp Ile Phe Gly Asn Ser Val Thr Thr Lys Asn Asn Arg Thr 440 ~45 450 Ile Ile Ser Val Asp Ala Leu Asn Gly Tyr Ser Leu Ala Ser Asp Trp TCA AC.~ TAT ATT GCT GAA TAC AGT GGT GCA GGT TTA ACA TTA AAC GAC 1557 Ser Thr Tyr Ile Ala Glu Tyr Ser Gly Ala Gly Leu Thr Leu Asn Asp Gln Ala Lys Pro Asn Glu Lys Tyr Tyr Leu Ile Gly Tyr Val Gly Gly Thr Gly Ala Arg ~sn Asp Met Met Val Pro Lys Asn Asn Val Gln Lys Phe Pro Leu Ala Asn Asn Thr Ser Asn Arg Asn Tyr Val Phe Tyr Val AAC GCA CCA AGA GAA GGT GAT TAT TAT ATT AoA GGA GTC TTT GCT TCA 1749 A3n Ala Pro Arg Glu Gly Asp Tyr Tyr Ile Lys Gly Val Phe Ala Ser Gly Val Gly Ser Asp Leu Lys Phe Ser Thr Gly Asp Met Ser Ser Asn Asn Val Thr Val Lys Gln Leu Ph~ Thr Gly Asn Leu Thr Thr Thr Leu 565 . 570 575 Arg Thr Phe Asp Thr Ser Ala Thr Th. Glu Ser Thr Arg Val Thr Thr GAT CCT ACT AAT AAA AAG ACG I'TA ACT CTA GTA GAA GGA TTA AAT AAG 1941 Asp Pro Thr Asn I.ys Lys Thr Leu Thr Leu Val Glu Gly Leu Asn Lys ATA GTA GTT AGT GGA ACT ACT GAA AAT ATT GGT GCT CCA AAT TTl' GGA 1989 Ile Val Val Ser Gly Thr Thr Glu Asn Ile Gly Ala Pro Asn Phe Gly Tyr Leu Glu Phe Ile Leu Asn Glu ~hr Gln Pro Glu Thr Thr Asn Val 630 635 6~0 Ser Asn Pro Ser GTATTTTATA TAAGrrTATTT TGTTTGTCAT TTAACATCAA AATCAATTCG AATTTTGATG 2149 Val Lys Arg Lys Asn Ile Leu Lys Phe Val Ser Leu l 5 10 Leu Gly Ile Gly Ser Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr 15 20 ~5 P.ro Val Asn Pro Thr Pro Asn Pro Thr Pro Thr Pro Asn Pro Glu Pro Asn Pro Gly Gly Gly Gly Gly Met Ser Asp Gly Asn Thr Asn Pro Gly :
:
AAT G~T GGA GGT ATG ATG GGC GAC AAT CCT AAT CCT GGG AAC ACC ACA 2631 Asn Gly Gly Gly Met Met Gly Asp Asn Pro Asn Pro Gly Asn Thr Thr Pro Glu Gln Gln Leu Ala Ala Ala Arg Lys Thr Leu Thr Asp Leu Leu Gly Thr Glu Asn Thr Asn Val Ala Lau Tyr Ala Asp Tyr Ala Lys Ile ~ln Ser Thr Leu Ser Thr Ala Tyr Met Thr Ala Lys Thr Ala Ser Glu Asn Thr Ser Ala Thr Leu Glu Asn Leu Thr Pro (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 647 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Val Lys Lys Lys Asn Ile Leu Lys Phe Val Ser Leu Leu Gly Ile Gly Ser Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr Pro Thr Pro Asn Pro Thr Pro Asn Pro Asn Pro Pro Ser Gly Gly Met Asn Gly Gly Asp Thr Asn Pro Gly Asp Gly Gln Gly Met Met Asn Ala Ala Ser Gln Glu Leu Ala Ala Ala Arg Met Gly Leu Thr Thr Ile Phe Asp Ser Lys Ala Lys Asn Leu Gly Leu Tyr Val Asp Tyr Lys Lys Thr Gln Asn Thr Leu ~5 hr Lys Ala Tyr Asp Ala Ala Lys Thr Val Leu Asp Asn Ser Ser Ser Thr Thr Gln Asn Leu Asn Glu Ala Lys Thr Arg Leu Glu Thr Ala Ile Arg Thr Ala Ala Thr Ser Lys Gln Thr Phe Asp Glu Gln His Ala Glu Leu Val Lys Val Tyr Lys Glu Leu ~ys Thr Thr Leu Ser Asn Glu Thr la Thr Leu Ala Pro Tyr Ala Asp Ala Gln Tyr Ala Gly Ile Lys Met is Leu Ser Gly Leu Tyr Asp Ala Gly Lys Ala Ile Thr Thr Lys Thr Leu Glu Pro Val Glu Gly Asp Pro Leu Thr Ala Ser Ala Val Met Met Ala Asn Thr Lys Ile Val Glu ~la Ile Lys Asp Glu Val Leu Asn Pro Gln Lys Glu Asn Ala Thr Lys Leu Ala Asp Ser Leu Leu Ser Ser Ile al Lys Lys Ile Thr Gly Val Glu Glll Ala His Asn Lys Ala Gln Pro la Asn Tyr Ser Phe Val G~.y Tyr Lys Arg Trp Tyr Thr Glu Leu Lau Leu Asp Lys Gln Val Phe Pro Asn Trp Asp Tyr Ala Gln Arg Thr Ile Phe Thr Asn Ser Asp Glu Pro Arg Sex Ile Ser Asn Thr Pro Ala Asp 290 ~95 300 Gly Gln Thr Met Ala Gln Pro Leu Ser Asn Val Ser Trp Ile Tyr Ser 305 310 315 3~0 eu Ala Gly Thr Gly Ala Lys Tyr Thr Leu Glu Phe Thr Tyr Tyr Gly ro Ser Thr Gly Tyr Leu Tyr Phe Pro Tyr Lys Leu Val Asn Thr Ser 340 3~5 350 sp Gln Val Lys Leu Gly Leu Glu Tyr Lys Leu Asn ~sp Ala Thr Lys Pro Ser Ala Ile Thr Phe Gly Ser Asp Gln Thr Met Asn Gly Lys Thr Pro Thr Val Asn Asp lle Asn Val Ala Lys Val Thr Leu Ala Asn Leu sn Phe Gly Ser Asn Lys Ile Glu Phe Ser Val Pro Ala Glu Lys Val er Pro Met Ile Gly Asn Met Tyr Leu Ser Ser Ser Pro Asn Asn Trp ~20 425 430 Asn Lys Ile Tyr Asp Asp Ile Phe Gly Asn Ser Val Thr Thr Lys Asn 435 4~0 44~
Asn Arg Thr Ile Ile Ser Val Asp Ala Leu Asn Gly Tyr Ser Leu Ala Ser Asp Trp Ser Thr Tyr Ile Ala ~lu Tyr Ser Gly Ala Gly Leu Thr 465 470 475 4~0 eu Asn Asp Gln Ala Lys Pro Asn Glu Lys Tyr Tyr Leu Ile Gly Tyr ~85 490 495 al Gly Gly Thr Gly Ala Arg Asn Asp Met Met Val Pro Lys Asn Asn Val Gln Lys Phe Pro Leu Ala Asn Asn Thr Ser Asn Arg Asn Tyr Val Phe Tyr Val Asn Ala Pro Arg Glu Gly Asp Tyr Tyr Ile Lys Gly Val Phe Ala Ser Gly Val Gly Ser Asp Leu Lys Phe Ser Thr Gly Asp Met er Ser Asn Asn Val Thr Val Lys Gln Leu Phe Thr Gly Asn Leu Thr hr Thr Leu Arg Thr Phe Asp Thr Ser Ala Thr Thr Glu Ser Thr Arg Val Thr Thr Asp Pro Thr Asn Ly~ Lys Thr Leu Thr Leu Val Glu Gly Leu Asn Lys Ile Val Val Ser Gly Thr Thr Glu Asn Ile Gly Ala Pro - '~o -Asn Phe Gly Tyr Leu Glu Phe Ile Leu Asn Glu Thr Gln Pro Glu Thr hr Asn Val Ser Asn Pro Ser 2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS: :
(A) LENGTH: 135 amino acids (B) TYPE: amino acid (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Val Lys Arg Lys Asn Ile Leu Lys Phe Val Ser Leu Leu Gly Ile Gly er Phe Val Met Leu Ala Ala Ala Ser Cys Thr Thr Pro Val Asn Pro Thr Pro Asn Pro Thr Pro Thr Pro Asn Pro Glu Pro Asn Pro Gly Gly ~0 45 ~ly Gly Gly Met Ser Asp Gly Asn Thr Asn Pro Gly Asn Gly Gly Gly Met Met Gly Asp Asn Pro Asn Pro Gly Asn Thr Thr Pro Glu Gln Gln eu Ala Ala Ala Arg Lys Thr Leu Thr Asp Leu Leu Gly Thr Glu Asn hr Asn Val Ala Leu Tyr Ala Asp Tyr Ala Lys Ile Gln Ser Thr Leu sQr Thr Ala Tyr ~et Thr Ala Lys Thr Ala Ser Glu Asn T~lr Ser Ala Thr Leu Glu Asn Leu Thr Pro (2) INFORMATION FOR SEQ ID NO:9:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2282 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: doubl~
(D) TOPOLOGY: linear (iil MOL~CULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
TTCTTGATAA TTCATCATCA ACAACACAAA ACCTTAATGA GGCTAAGACT AGATTAG~AA 540 CTGC~ATTA6 AACAGCTGCT ACTAGTAAAC AAACCTTTGA TGAACAACAT GCCGAGTTAG 600 -~2-CTTCTAGTCC TAATA~CTGG AATAAGATCT ATGATGATAT TTTCGGTAAT AGTGTTACAA 1500 RACCTAATGA AAAATACTAT TT~AT'rGGGT ATGTGGGTGG AACTGGTGCT CGTAATGATA 1680 GAATTTTTTT TAAAAACATT TCTCTGAATT TGCTACAAAA ATTAGTGAAA ccTTTrrATTT 2280 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGT}I: 2453 base pairs (B) TYPE: nucleic acid ~C) STRANDEDNESS: double (D) TOPOI.OGY: linear (ii) MOLECULE TYPE: DNA (genomic) -4~--(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GGGGTTTAGG GCTGGTCTGA TCGGCGAAAA TAA~CGCGAT Tl'ATTCCATA ATTGAACTTT 120 ATATATTcTT TAGACAATAA TAGACGTGGT GAACGTAAGT TATTGGCTTA ACTTTAAGTG 180 GCATCAGAAA ATACAAGCGC CACTTTAGAA AATC'rAAGAT CTGCATCAAC TACACTACAA 600 -4~-ATCTATAATG AAA~CTTCGG TAATACTAGT AACTCAAGCG ACAATTCAAC ATCTGTCACT 1680 GGATTAAACA AAGTTGTTAT TAGTGGAGTT TCAAACGGTG ~TACTCCTTA TATTGGTAAT 2220 (2) INFORMATION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2417 base p~irs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: llnear (li) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
r - -AAAcccTGcA CCAAAACCAG ATCCAATGCC AAATCCTGGT GGTGGTATGA TGGGTGGTAT 360 CATl"rAATTA TTATGGGCCT TCAACAGGTT TTTTATATTT CCCTTATAAG TTAGTTAATA 1260 --~6-CTGAAACTAA CACACCTGCT GAAGGAACTT CTACTGAACA TGCAAAATAA AATTcTTATA 2280 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2004 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear ~ii) MOLECUhE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ lD NO:12:
GAAG~AGAAG AAGAAGAAGA AGAAGAAGAA GTTCTTAGGA GTTCGGGGGT TTTCGTTTGG 60 C~AAAAACTG CACCAAAACC AGATCCAAAG CCAAATCCTG GTGGTGGTAT GATGGGTGGT 360 AAACATGCTA TTAATACAGC TGTTAATGAA ~GAAAGTTT TTGACGAAAA TAATTCTGAA 660 CAACAAAAAf, CTAATGCAGA TATGCTTGCA ACTAGTTTTA CAAAACAAGT ACTAAATGAT 960 CAAAGTAATA AATTAACAGA CGTAI'CATGG ATTTATAGCT TATCGGGAAT GGGTGCTAAA 1200 ATTGGTAATT TAACATTCAC TTTAATTATT ACTCGTCAGT ATCTGAAGTA GACTAGCACA 1~20 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) I,ENGTH: 297 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 263 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
_~9_ (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 256 base pairs (B) TYPE: nucleic acid (C3 STRANDEDNESS: double (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
TGGGGCTGGT TTGATCGGAG AAAATAAACC ~GATTTATTA CTTACTGAAC TTTATATATT 120 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 247 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (~i) SEQUENCE DESCRIPTION: SEQ ID NO:16:
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 255 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii~ MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
GAAGAAGAAG AAGAAGAAGA AGAAGAAGAA GW~GAAGAAG AAGAAGTTCT TAGGAGTTCK 60 GGGGTTTDSG KYTGGTYTGA TCDG~GAAAA TWAASBCGAT TTATTMCATW AYTGAACTTT 120 AARARAAAAA ACATWTTAAA GTTTGTTAGT I'TATTAGGTA TTGGTTCGTT TGTAATGTTR 240 GCWGCWGCTA GTTGT ~55
Claims (40)
1. An isolated nucleotide sequence comprising a promotor region derivable from a5' conserved region adjacent a pMGA gene of M. gallisepticum.
2. An isolated nucleotide sequence comprising a promoter region in the 5' conserved sequence of M. gallisepticum according to Figures 3, 4, 5a or 5b herein, or functional fragments, homologues, analogues, mutants, variants or derivatives thereof.
3. The sequence of claim 2 which commences adjacent the end of the GAA repeat through to about 100 bases downstream.
4. The sequence of claim 2 which commences adjacent the end of the GAA repeat through to about 60 bases downstream.
5. An isolated nucleotide sequence encoding a polypeptide leader sequence in the5' conserved sequence of M. gallisepticum according to Figure 3, 4, 5a or 5b herein, or functional fragments, mutants or variants thereof.
6. The nucleotide sequence of claim S which encodes a polypeptide including the first transcribed codon for the amino acid methionine or valine through to cysteine, or a functional fragment, homologues, analogues, mutants, variants or derivatives thereof.
7. The nucleotide of claim 1 or claim 2 which is DNA.
8. An isolated nucleotide molecule comprising the sequence of claim 1 or claim 2operably linked to a gene encoding an antigen.
9. A method of producing a multivalent mycoplasma live vaccine vector, said method comprising placing at least one foreign antigen gene under the control of a promoter region derivable from a 5' conserved sequence of M. gallisepticum, or afunctional part, homologue, analogue, mutant, variant or derivative thereof, in a mycoplasma strain and obtaining expression of said foreign antigen gene.
10. The method of claim 9 where a nucleotide sequence encoding the leader sequence from the 5' conserved sequence of M. gallisepticum, or functional part, homologue, analogue, mutant, variant or derivative thereof is placed adjacent to said foreign gene such that foreign antigen produced is located on the cell surface of said mycoplasma strain.
11. The method of claim 9 wherein said mycoplasma strain is an attenuated strain.
12. The method of claim 11 wherein said attenuated strain is ts-11 described herein.
13. The isolated nucleotide molecule of claim 8 or the method of claim 9 whereinsaid antigen is derived from E. coli, Newcastle Disease virus or from the aetiological agents causing infectious bronchitis, infectious bursal disease, avian influenza, avian encephalomyelitis, chicken anaemia agent and infectious laryngotracheitis.
14. The method of claim 9 wherein said foreign antigen is inserted into an inessential antigen gene which is shared with a corresponding wild-type mycoplasma, wherein said insertion causes inactivation of expression of said inessential antigen gene, thus allowing said vaccine vector and said wild-type strain to be distinguished.
15. The method of claim 14 wherein said inessential antigen gene is the P45 gene.
16. The method of claim 15 wherein said vaccine vector is M. gallisepticum.
17. A method of determining whether a bird vaccinated with the vaccine vector produced by the method of claim 14 is infected with said vaccine vector or a wild-type M. gallisepticum strain, said method comprising detecting the presence of said inessential antigen, or an antibody specific therefor in a sample from the bird.
18. A multivalent live vaccine vector which comprises an attenuated mycoplasma strain, the genome of which encodes at least one foreign antigen under the control of the promoter region derivable from a 5' conserved region of the pMGA gene, wherein native mycoplasma antigens and at least one foreign antigen are expressed.
19. The vaccine vector of claim 18 wherein the nucleotide sequence encoding the leader sequence from the 5' conserved nucleotide sequence of the pMGA gene is placed adjacent to said foreign antigen gene, such that the foreign antigen expressed is anchored to the cell membrane of said mycoplasma.
20. The vaccine vector of claim 18 wherein said foreign antigen is derived from E. coli, Newcastle Disease virus or from one of the aetiological agents causing infectious bronchitis, infectious bursal disease, avian influenza, avianencephalomyelitis, chicken anaemia agent and infectious laryngotracheitis.
21. The vaccine vector of claim 18 wherein said mycoplasma is M. gallisepticum.
22. The vaccine vector of claim 18 wherein said mycoplasma is M. gallisepticum strain ts-11 described herein.
23. A vaccine composition comprising the vaccine vector of claim 18 and a pharmaceutically or veterinarily acceptable carrier, diluent or excipient.
24. A method of vaccinating an animal against mycoplasma infection and at least one other aetiological agent said method comprising administering an effective amount of the vaccine vector of claim 18 to said animal.
25. The method of claim 24 wherein said animal is a chicken, turkey, duck or other domestic bird.
26. The method of claim 24 wherein said vaccine vector is administered by eye-drop, spraying or in drinking water.
27. A detection system for mycoplasma, including detection of different strains within a species, where the detection system is a method which comprises contacting a sample suspected of containing said mycoplasma with at least one nucleic acid probe specific for a mycoplasma under appropriate hybridisation conditions to stably hybridise the probe to a genetic sequence from said mycoplasma and then detecting hybridisation.
28. The system of claim 27 wherein the probe is specific for the species M.
gallisepticum or different strains thereof.
gallisepticum or different strains thereof.
29. The system of claim 27 when used to detect mycoplasma infection in poultry, humans or other animals.
30. The system of claim 27 wherein the probe is used to differentiate between M.gallisepticum, M. synoviae, M. pullorum or M. gallinarum.
31. The system of claim 27 wherein said probe comprises the following sequence:
or a fragment which hybridises specifically therewith or a homologue, analogue mutant, variant or derivative thereof, where K denotes G or T, M denotes A or C, R denotes A
or G, Y denotes C or T, W denotes A or T and S denotes G or C.
or a fragment which hybridises specifically therewith or a homologue, analogue mutant, variant or derivative thereof, where K denotes G or T, M denotes A or C, R denotes A
or G, Y denotes C or T, W denotes A or T and S denotes G or C.
32. A polypeptide or fragment thereof encoded by the probe used in claim 27.
33. A polynucleotide molecule comprising the following sequence:
or a fragment which hybridises therewith or a homologue, analogue, mutant, variant or derivative thereof, where K denotes G or T, M denotes A or C, R denotes A or G, Y
denotes C or T, W denotes A or T and S denotes G or C.
or a fragment which hybridises therewith or a homologue, analogue, mutant, variant or derivative thereof, where K denotes G or T, M denotes A or C, R denotes A or G, Y
denotes C or T, W denotes A or T and S denotes G or C.
34. The nucleotide of claim 33 wherein said sequence comprises 8 or more nucleotides.
35. A nucleotide molecule comprising the following sequence:
5'(GAA)n3' where n is between 2 and 30, or a hybridisable fragment thereof or a homologue, analogue, mutant, variant or derivative thereof.
5'(GAA)n3' where n is between 2 and 30, or a hybridisable fragment thereof or a homologue, analogue, mutant, variant or derivative thereof.
36. The nucleotide of claim 35 wherein n is 4 to 13.
37. A polypeptide or fragment thereof encoded by one or more nucleotide sequences selected from the group:
a) where the letters K, M, R, Y, W and S have the meaning given in claim 31, and b) 5'(GAA)n3' wherein n is between 2 and 30, or hybridisable fragments or derivatives, variants, analogues or homologues of said nucleotide sequences.
a) where the letters K, M, R, Y, W and S have the meaning given in claim 31, and b) 5'(GAA)n3' wherein n is between 2 and 30, or hybridisable fragments or derivatives, variants, analogues or homologues of said nucleotide sequences.
38. A method of manipulating the genome of a mycoplasma bacterium comprising using the nucleotide sequence selected from the group:
a) where the letters K, M, R, Y, W and S are given in claim 29, and b) 5'(GAA)n3' where n is between 2 and 30, or hybridisable fragments thereof or homologues, analogues, mutants, variants or derivatives thereof, for insertion, deletion or other modification of genes in said bacteria by positioning said sequence(s) on mycoplasma DNA and treating said bacterium such that its genome undergoes insertion, deletion or other modification.
a) where the letters K, M, R, Y, W and S are given in claim 29, and b) 5'(GAA)n3' where n is between 2 and 30, or hybridisable fragments thereof or homologues, analogues, mutants, variants or derivatives thereof, for insertion, deletion or other modification of genes in said bacteria by positioning said sequence(s) on mycoplasma DNA and treating said bacterium such that its genome undergoes insertion, deletion or other modification.
39. A kit comprising at least two containers having a first container comprising at least one probe used in claim 27, and a second container comprising one or more reagents which detect the presence of said probe in a hybridised state.
40. An isolated nucleotide sequence, a method of producing a live multivalent vaccine vector, a multivalent live vaccine vector, a vaccine composition, a method of vaccinating an animal, a detection system for mycoplasma, the polynucleotide sequences, a method of manipulating the mycoplasma genome and a kit according to the present invention substantially as described herein.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU50593/93A AU682152B2 (en) | 1992-11-10 | 1993-11-10 | Mycoplasma vaccines and probes |
| AU50593/93 | 1993-11-10 | ||
| US23031294A | 1994-04-20 | 1994-04-20 | |
| US230,312 | 1994-04-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2135330A1 true CA2135330A1 (en) | 1995-05-11 |
Family
ID=25629001
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2135330 Abandoned CA2135330A1 (en) | 1993-11-10 | 1994-11-08 | Live vaccine vectors based on mycoplasma gallisepticum and nucleic acid probes therefrom |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA2135330A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999014317A1 (en) * | 1997-09-19 | 1999-03-25 | Synbiotics Corporation | Methods for the diagnosis of feline infectious anemia |
-
1994
- 1994-11-08 CA CA 2135330 patent/CA2135330A1/en not_active Abandoned
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999014317A1 (en) * | 1997-09-19 | 1999-03-25 | Synbiotics Corporation | Methods for the diagnosis of feline infectious anemia |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2926180B2 (en) | Streptococcal M protein gene and its molecular probe | |
| US5055400A (en) | Leukotoxin gene of pasteurella haemolytica | |
| JP2004507217A (en) | Listeria monocytogenes genomes, polypeptides and uses thereof | |
| JP2003000276A (en) | Lawsonia intracellulis vaccine | |
| AU615429B2 (en) | Vaccines and diagnostic assays for haemophilus influenzae | |
| CA2779515A1 (en) | Haemophilus parasuis polypeptides and methods of use | |
| US8784829B2 (en) | Lawsonia intracellularis vaccines | |
| KR930702942A (en) | Recombinant Cat Coronavirus S Protein | |
| Singh et al. | Molecular heterogeneity of plpE gene in Indian isolates of Pasteurella multocida and expression of recombinant PlpE in vaccine strain of P. multocida serotype B: 2 | |
| JP2003527100A (en) | protein | |
| Goto et al. | Expression of the nucleoprotein of rabies virus in Escherichia coli and mapping of antigenic sites | |
| JP2001521361A (en) | LKP pilin structural gene and operon of non-typeable Haemophilus influenzae (HAEMOPHILUS INFLUENZAE) | |
| EP0117063A1 (en) | Methods and materials for development of parvovirus vaccine | |
| JP3245169B2 (en) | Canine coronavirus S gene and uses thereof | |
| US8216594B2 (en) | Proteins with repetitive Bacterial-Ig-like (Big) domains present in Leptospira species | |
| Ward et al. | The LspB protein is involved in the secretion of the LspA1 and LspA2 proteins by Haemophilus ducreyi | |
| CA2135330A1 (en) | Live vaccine vectors based on mycoplasma gallisepticum and nucleic acid probes therefrom | |
| JPH10507902A (en) | ROCHALIMAEA HENSELAE and ROCHALIMAEA QUINTANA nucleic acids and methods and compositions for diagnosing ROCHALIMAEA HENSELAE and ROCHALIMAEA QUINTANA infections | |
| WO2000031115A1 (en) | Methods of identifying antigen gene sequences | |
| MX2010009516A (en) | Novel sequences of brachyspira, immunogenic compositions, methods for preparation and use thereof. | |
| JP2001292786A (en) | Gene encoding outer membrane protein of salmonella typhi and its protein | |
| AU682152B2 (en) | Mycoplasma vaccines and probes | |
| US5695960A (en) | Hippuricase gene | |
| US5981189A (en) | Hippuricase gene | |
| US6087128A (en) | DNA encoding an avian E. coli iss |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Dead |